Gene pagerf49 for regulating development of poplar leaves and stems and application thereof
By cloning and overexpressing the poplar PagERF49 gene, the development of poplar leaves and stems was regulated, solving the problem that traditional breeding techniques could not improve wood properties and achieving a significant improvement in the growth characteristics of poplar.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- ZHEJIANG FORESTRY UNIVERSITY
- Filing Date
- 2024-05-15
- Publication Date
- 2026-07-21
AI Technical Summary
Existing technologies are insufficient to effectively regulate the development of poplar leaves and stems. Traditional breeding techniques struggle to overcome bottlenecks in improving tree species properties and stress resistance research. The long growth cycle and high heterozygosity of trees hinder progress in improving wood properties.
The poplar PagERF49 gene was cloned, and an overexpression vector pK2GW7-eYGFP was constructed. This vector was then transformed into *Populus alba* 84K using Agrobacterium-mediated transformation to achieve efficient expression of PagERF49 in poplar and regulate leaf and stem development.
Overexpression of the PagERF49 gene resulted in reduced leaf margin notches, significantly increased plant height, increased xylem width, and reduced vessel area, thus significantly improving the growth and development characteristics of poplar.
Smart Images

Figure CN118345091B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to a gene PagERF49 that regulates the development of poplar leaves and stems and its applications, belonging to the fields of plant genetic engineering and biotechnology. Background Technology
[0002] Poplar (Populus spp.) is a general term for tree species belonging to the genus Populus L. of the family Salicaceae in the class Dicotyledonous plants of the phylum Angiospermae. Poplars are fast-growing, highly adaptable, widely used, and easy to propagate, making them a major fast-growing timber species in my country. They play a vital role in my country's ecological protection, industrial production, and other development and construction, generating significant economic, ecological, and social benefits.
[0003] Poplar trees possess characteristics such as small genome size, concise structure, and ease of transformation and genetic inheritance. Furthermore, their genetic background has been thoroughly studied; the complete genome sequencing of *Poplar trichocarpa* was completed as early as 2006, marking the formal entry of poplar molecular breeding into the genomic era and greatly advancing the research process. Simultaneously, poplars are natural hosts for *Agrobacterium tumefaciens*, and *Agrobacterium*-mediated transformation is generally used in genetic transformation. Therefore, poplars are considered a model tree species for forest genetic engineering. The ability of poplars to undergo genetic transformation and express exogenous genes was discovered and confirmed by Parsons et al. in 1986. Currently, poplar genetic engineering research has expanded to multiple aspects, including wood property improvement, resistance to biotic and abiotic stresses, hormone regulation, flowering regulation, and phytoremediation.
[0004] Timber is an important renewable resource, serving not only as a source of biomass energy but also as a raw material for industries such as furniture manufacturing, construction, and papermaking. However, the long growth cycle and high heterozygosity of trees make it difficult to overcome research bottlenecks in areas such as species property improvement and stress resistance research using traditional breeding techniques alone, resulting in slow overall research progress. Therefore, it is essential to utilize modern molecular biology methods to accurately target the technical challenges in improving timber performance, conduct targeted research to achieve breakthroughs, enhance the operability of timber performance improvement, and thereby accelerate the process of improving the quality of forest timber.
[0005] Wood formation, or the development of secondary xylem, involves biological processes such as cambium cell proliferation, xylem cell enlargement and differentiation, secondary cell wall formation, programmed cell death, and heartwood formation. Numerous transcription factors and functional genes participate in this process, forming a complex molecular regulatory network. With the application of genomics, molecular genetics, and other research techniques in the exploration and verification of forest tree gene function, the mechanisms of action of some transcription factors and functional genes controlling wood properties have been further elucidated.
[0006] AP2 / ERF transcription factors are widely distributed in plants and constitute one of the largest transcription factor families in the plant world. The ERF (Ethylene response factor) subfamily, known as ethylene response factors, has been isolated and analyzed in most species. It is a large family; through bioinformatics analysis and gene model screening, at least 170 ERFs have been identified in *Populus tomentosa*, significantly more than the 122 and 139 ERFs found in *Arabidopsis thaliana* and rice, respectively. With ongoing research into the function of ERFs, transcriptome analysis in *Arabidopsis thaliana* has shown that the expression levels of ERF family members AtERF1 and AtERF2 are higher in mature stems than in immature stems, indicating differential expression and suggesting their potential involvement in xylem development, playing a crucial role in *Arabidopsis thaliana* xylem development.
[0007] Furthermore, in the Arabidopsis eto (ethylene-overproducing) mutant, ERF1, ERF018, and ERF109 were observed to be essential for promoting cambium division, and their expression levels gradually increased with the development of vascular tissue, demonstrating that ERFs play a crucial role in ethylene signaling in vascular tissue. Overexpression of ERF139 in hybrid poplar (Populus tremula×tremuloides) revealed that, compared to the wild type, the transgenic plants exhibited significantly reduced diameters of xylem fiber cells and vessels, altering the morphology of fiber cells and tubular molecules. Similarly, in hybrid poplar, overexpression of ERF18, ERF21, ERF30, ERF85, and ERF139 altered the chemical composition of poplar wood. Plants overexpressing ERF18 and ERF21 showed higher concentrations of carbohydrates and glycosidic bonds, with reduced lignin content.
[0008] Leaf senescence is a normal physiological phenomenon in plants, essentially a process of programmed cell death. AtERF4 and AtERF8 can indirectly accelerate the senescence rate of Arabidopsis leaves, indicating their important role in leaf growth and development. These studies demonstrate that ERFs can directly or indirectly participate in plant growth and development, playing an irreplaceable role in wood formation and leaf growth.
[0009] Currently, there are relatively few reports on the functions of ERFs in woody plants, indicating a broad research prospect. Therefore, using Populus amurensis 84K as the research object, and combining molecular biology and genetic engineering techniques, this study aims to analyze the regulation of leaf and stem development by Populus amurensis PagERF49. This will provide a theoretical basis and technical support for the future use of this gene to create superior poplar trees that better meet the requirements of production and ecology, and will have practical guiding significance in improving the utilization efficiency of poplar trees and expanding their application space. Summary of the Invention
[0010] One of the objectives of this invention is to provide a gene, PagERF49, that regulates the development of poplar leaves and stems, addressing the shortcomings of existing technologies.
[0011] The above-mentioned objective of this invention is achieved through the following technical solution:
[0012] A gene, PagERF49, that regulates the development of poplar leaves and stems has its nucleotide sequence shown in Sequence 3 of the sequence listing.
[0013] Another objective of this invention is to provide an expression protein of the gene PagERF49 that regulates the development of poplar leaves and stems.
[0014] The amino acid sequence of PagERF49, a gene that regulates the development of poplar leaves and stems, is shown in Sequence 4 of the sequence listing.
[0015] Another objective of this invention is to provide a plant expression vector pK2GW7-eYGFP for the gene PagERF49, which regulates the development of poplar leaves and stems.
[0016] An overexpression vector for the gene PagERF49, used to regulate the development of poplar leaves and stems, is prepared as follows:
[0017] (1) Using PagERF49 primers and 84K Yang cDNA as template, PCR amplification was performed to construct the PagERF49 gene into the GATEWAY introductory vector pDONR207. The sequence is shown in sequence 5 of the sequence listing.
[0018] (2) Transformed into competent Escherichia coli DH5α by freeze-thaw method, positive clones were picked from the selection culture plate with added gentamicin, and PCR detection and sequencing verification were performed. The entry vector with PagERF49 gene was constructed into the plant expression vector pK2GW7-eYGFP through the Gateway system. The sequence is shown in sequence 6 in the sequence listing.
[0019] (3) The LR reaction was performed. After the LR reaction, the PagERF49 gene was introduced into the plant expression vector pK2GW7-eYGFP. The strong expression promoter 35S was assembled at the 5' end of the PagERF49 gene. The 35S promoter drove the eYGFP enhanced fluorescent protein to be expressed efficiently in the plant. The overexpression vector was successfully constructed by PCR detection and sequencing verification and was named pK2GW7-eYGFP-PagERF49.
[0020] Preferably, in step (1), the PCR amplification reaction system consists of 150 ng of fresh PCR product; 75 ng of pDONR207 vector; 0.8 μL of BP Clonase II enzyme mix; and sterile ddH2O to a final volume of 3 μL. The reaction procedure is: reaction at 25°C for at least 4 hours.
[0021] Preferably, in step (3), the reaction system of the LR reaction is pDONR207-PagERF49: 150ng, pK2GW7-eYGFP vector (vector) 75ng; Gateway LR Clonase (cloning enzyme) II Enzyme Mix (mixed enzyme) 0.8μL; sterile ddH2O to make up to 3μL; the reaction program is: reaction at 25℃ for more than 4h.
[0022] Another objective of this invention is to provide a genetic transformation of the gene PagERF49 for regulating the development of poplar leaves and stems.
[0023] The above-mentioned objective of this invention is achieved through the following technical solution:
[0024] The genetic transformation of PagERF49, a gene used to regulate the development of poplar leaves and stems, was carried out as follows: The constructed pK2GW7-eYGFP-PagERF49 overexpression vector was transformed into Agrobacterium competent cells GV3101 by freeze-thaw method, and the PagERF49 gene was transformed into Populus aurea 84K by Agrobacterium-mediated transformation.
[0025] Another object of the present invention is to provide an application of the gene PagERF49, which regulates the development of poplar leaves and stems.
[0026] The application of the gene PagERF49, which regulates the development of poplar leaves and stems, in the process of regulating the development of poplar leaves and stems.
[0027] Beneficial effects:
[0028] This invention involves transferring the PagERF49 gene into 84K poplar. Compared with the control, the transgenic poplar overexpressing PagERF49 showed reduced leaf margin notches, significantly increased plant height, significantly increased xylem width, and significantly reduced vessel area, indicating that the PagERF49 gene is a key regulatory gene that regulates the development of poplar leaves and stems.
[0029] This invention uses Populus aurea 84K as material to clone the PagERF49 gene; at the same time, it constructs an overexpression vector pK2GW7-eYGFP, which is located after the 35S promoter. Under the drive of the 35S promoter, PagERF49 can be overexpressed in poplar trees, thereby regulating the development of poplar leaves and stems.
[0030] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, but this does not imply any limitation on the scope of protection of the present invention. Attached Figure Description
[0031] Figure 1 This is a schematic diagram of the structure of the plant expression vector pK2GW7-eYGFP-PagERF49 in Example 2 of the present invention.
[0032] Figure 2-1 This is a diagram illustrating the PagERF49 transgenic plant cultivation process in Example 3 of this invention.
[0033] Figure 2-2 This is the autofluorescence image of eYGFP observed under a handheld ultraviolet lamp after genetic transformation in Example 3 of this invention.
[0034] Figure 3 This is a PCR identification and detection diagram of transgenic poplar trees that overexpress PagERF49 in Example 4 of this invention.
[0035] Figure 4 This is a real-time quantitative detection graph of the transcriptional level of transgenic poplar trees that overexpress PagERF49 in Example 4 of this invention.
[0036] Figure 5 This is a comparison of the physiological phenotypes and physiological indicators of non-transgenic poplar (84K) grown in soil for two months and transgenic poplar (OE#33, OE#39, OE#72) overexpressing PagERF49 in Example 4 of this invention.
[0037] Figure 6-1 This is a comparison of the stem cross-section between the 11th node of the non-transgenic 84K poplar (CK) grown in soil for two months and the PagERF49 overexpressing transgenic poplar (OE#33, OE#39, OE#72) in Example 4 of this invention.
[0038] Figure 6-2The percentage of xylem region in the stem cross section between the 11th node of the non-transgenic 84K poplar (CK) grown in soil for two months and the PagERF49 overexpressing transgenic poplar (OE#33, OE#39, OE#72) in Example 4 of this invention.
[0039] Figure 6-3 The image shows a comparison of the xylem of the 11th internode between the non-transgenic 84K poplar (CK) grown in soil for two months and the PagERF49 overexpressing transgenic poplar (OE#33, OE#39, OE#72) in Example 4 of this invention.
[0040] Figure 6-4 This is a statistical diagram showing the average area of xylem vessels in the 11th internode of non-transgenic 84K poplar (CK) grown in soil for two months and the PagERF49 overexpressing transgenic poplar (OE#33, OE#39, OE#72) in Example 4 of this invention. Detailed Implementation
[0041] The present invention will be further described below with reference to specific embodiments. Operations not described in detail in the following embodiments can be performed by referring to the instructions for use of molecular cloning related reagent kits.
[0042] Example 1: Cloning the PagERF49 gene
[0043] Using Populus alba × P. glandulosa ('84K') as material, total RNA was extracted from one-month-old soil-cultured seedlings using the RNeasy PlantMini kit and the RNase-free DNase I kit (Qiagen, Hilden, Germany). 1.0 μg of RNA was taken from each sample. The first strand of cDNA was synthesized using the SuperScript III first-strand synthesis system (Life Technologies, Carlsbad, CA, USA). Amplification primers were designed based on the full-length CDS sequence of PagERF49 from the Populus alba × P. glandulosa ('84K') database. Using '84K' cDNA as a template, the full-length gene of PagERF49 was amplified (GATEWAY adapters were introduced into the primers). The amplified products were recovered, ligated into T-vectors, and sequenced for verification.
[0044] Among them, the forward primer of PagERF49 (such as sequence 1 in the sequence listing) is shown in Table 1 below;
[0045] Table 1
[0046] PagERF49 forward primer GGGGACAACTTTGTACAAAAAAGTTGGAATGGCTCCGAGAGAAAGATCT
[0047] The reverse primer for PagERF49 is (as shown in Sequence 2 in the sequence listing) as shown in Table 2 below;
[0048] Table 2
[0049] PagERF49 reverse primer GGCGGCCGCACAACTTTGTACAAGAAAGTTGGGTATCATGAGACTTCCGGTGGT
[0050] The high-fidelity PCR reaction system is as follows: 25 μL of 2×Phanta Max Master Mix high-fidelity polymerase (Vazyme#P515), 2 μL of forward primer (10 μM), 2 μL of reverse primer (10 μM), 100 ng of template (84K Yang cDNA), and sterile ddH2O to a final volume of 50 μL. The amplification reaction program in the PCR instrument is set as follows: 95℃ pre-denaturation for 3 min, 95℃ denaturation for 15 s, annealing temperature adjusted according to the designed primers, set to 56℃ for 30 s, extension at 72℃ for 1 min based on the target gene length of 681 bp, "denaturation-annealing-extension" cycle for 35 times, and finally 72℃ for complete extension for 10 min.
[0051] The final full-length cDNA sequence of the gene was 681 bp, named PagERF49 gene, and the sequence is shown in Sequence 3 of the sequence listing, as shown in Table 3 below;
[0052] Table 3
[0053]
[0054] The protein sequence it compiles and expresses is shown in Sequence 4 of the sequence listing, as shown in Table 4 below.
[0055] Table 4
[0056]
[0057] Example 2: Construction of a plant expression vector for the PagERF49 gene
[0058] Using cloning technology, an overexpression vector for the PagERF49 gene was constructed. Using specific PCR primers (PagERF49 primers from Example 1) and 84K cDNA as a template, PCR amplification was performed to construct the PagERF49 gene into the GATEWAY introductory vector pDONR207. The sequence is shown in Sequence 5 of the sequence listing, as shown in Table 5 below.
[0059] Table 5
[0060]
[0061]
[0062]
[0063] The reaction system consisted of 150 ng of fresh PCR product; 75 ng of pDONR207 vector; 0.8 μL of BP Clonase II enzyme mix; and sterile ddH2O to a final volume of 3 μL. The reaction program was: 25°C for at least 4 hours.
[0064] Transformed into competent E. coli DH5α cells using the freeze-thaw method, positive clones were picked from selection culture plates containing gentamicin, and PCR detection and sequencing verification were performed. The entry vector carrying the PagERF49 gene was constructed into the plant expression vector pK2GW7-eYGFP through the Gateway system. The sequence is shown in Sequence 6 of the sequence listing, see Table 6 below.
[0065] Table 6
[0066]
[0067]
[0068]
[0069]
[0070] The LR reaction was performed using the following reaction system: 150 ng pDONR207-PagERF49, 75 ng pK2GW7-eYGFP vector, 0.8 μL Gateway LR Clonase II Enzyme Mix, and sterile ddH2O to a final volume of 3 μL. The reaction program was: 25℃ for at least 4 hours. After the LR reaction, the PagERF49 gene was introduced into the plant expression vector pK2GW7-eYGFP. Figure 1 As shown, starting from the left-handed twist at the apex, the sequence consists of the strong terminator NOS, the kanamycin (Kan) resistant NPTⅡ gene, the NOS promoter, the strong expression promoter 35S, COR47-5'-UTR, the enhanced fluorescent protein eYGFP, HSP-T878, the strong expression promoter 35S, and the gene PagERF49 used in this study. A 35S promoter was assembled at the 5' end of the PagERF49 gene, enabling efficient expression of the PagERF49 gene in poplar. PCR detection and sequencing confirmed the successful construction of the overexpression vector, which was named pK2GW7-eYGFP-PagERF49.
[0071] Example 3: Genetic transformation of the PagERF49 gene
[0072] The constructed pK2GW7-eYGFP-PagERF49 overexpression vector was transformed into Agrobacterium GV3101 using the freeze-thaw method, and the PagERF49 gene was transformed into Populus aurea 84K via Agrobacterium-mediated transformation.
[0073] The transformation process is as follows Figure 2-1 As shown, from left to right, the process involves leaf scratching to induce callus formation, leaf differentiation to form callus, Agrobacterium infection of callus leading to shoot differentiation, and shoot rooting to seedling development. The specific steps of this process are as follows: The *Populus silvereris* 84K tissue culture seedlings used for genetic transformation were cultured at a temperature of 23-25℃, a light intensity of 16 / 8h (day / night), and a light intensity of 50 μMm. -2 s -1 Under suitable conditions, leaves of healthy 84K tissue culture seedlings were selected. Using a sterile blade, the leaves were incised perpendicularly to the main and lateral veins, the leaf tips were removed, and the petioles were cut off separately. The leaves were then laid flat, back side up, on callus induction medium and placed in darkness at 23±2℃ for about one month to induce callus formation. The pre-induced *Populus silvergrass* 84K callus, or leaves of healthy 84K tissue culture seedlings, were then incised and placed in a medium containing pK2GW7-eYGFP-PagERF49. Soak the infected leaf discs or callus tissue in Agrobacterium resuspension (OD600 = 0.6–0.8) for 15–20 minutes, then remove them with tweezers and place them on filter paper to air dry. Leaves should not be air-dried for too long, while callus tissue should be dried as much as possible by absorbing the bacterial suspension. Place the infected leaf discs or callus tissue on a co-culture medium and co-culture for 3–4 days in the dark at 23±2℃. After co-culture, transfer the leaf discs or callus tissue to a differentiation selection medium and culture at 23–25℃, with a light cycle of 16 / 8h (day / night) and a light intensity of 50 μMm. -2 s -1 Under specific conditions, adventitious shoots resistant to kanamycin sulfate were induced and screened. After 40 days of induction culture, the resistant adventitious shoots were transferred to rooting selection medium for kanamycin resistance screening and rooting induction. Because the overexpression vector contains eYGFP enhanced fluorescent protein, a handheld UV lamp can be used to irradiate callus tissue or adventitious shoots. If the vector is successfully transformed into plant tissue, autofluorescence can be observed. Figure 2-2 As shown, the left image shows the autofluorescence of callus tissue under a handheld UV lamp, and the right image shows the autofluorescence of adventitious buds under a handheld UV lamp. DNA was extracted from the leaves of the rooted plant with autofluorescence and identified by PCR to further confirm whether it is a transgenic plant.
[0074] The preparation methods for the culture media used in the above genetic transformation process are as follows:
[0075] Callus induction medium (1L): WPM449 (Phyto Technology #L449) 4.4g, morpholinoethanesulfonic acid (MES, Sigma) 0.5g, 2,4-dichlorophenoxyacetic acid (2,4-D) 2mg / L, naphthaleneacetic acid (NAA) 0.1mg / L, kinetin (KT) 0.1mg / L, sugar 20g, diluted to volume with deionized water and completely dissolved, then the pH was adjusted to 5.9 with 1mol / L NaOH, and 4g of plant gel (Phytagel, Sigma) was added. The mixture was then autoclaved.
[0076] Co-culture medium (1L): 2.4g WPM449 (Phyto Technology#L449), 0.5g morpholine ethanesulfonic acid (MES, Sigma), 20g sugar, diluted to volume with deionized water and completely dissolved, then the pH was adjusted to 5.9 with 1mol / L NaOH, 4g plant gel (Phytagel, Sigma#P8169) was added, and after high temperature and high pressure sterilization, the temperature was cooled to about 40-50℃ and 100μM acetylsylgenone (AS) was added;
[0077] Differentiation screening medium (1L): WPM449 (Phyto Technology#L449) 2.4g, morpholine ethanesulfonic acid (MES, Sigma) 0.5g, naphthaleneacetic acid (NAA) 0.1mg / L, 6-benzylaminopurine (6-BA) 0.5mg / L, sugar 20g, diluted to volume with deionized water and completely dissolved, then the pH was adjusted to 5.9 with 1mol / L NaOH, 4g of plant gel (Phytagel, Sigma) was added, and after high temperature and high pressure sterilization, the temperature was cooled to about 40-50℃ and 1mL of Timentin (200mg / mL) was added, followed by 100mg / L of kanamycin sulfate;
[0078] Rooting selection medium (1L): MS519 (Phyto Technology#L449) 2.2g, morpholine ethanesulfonic acid (MES, Sigma) 0.5g, naphthaleneacetic acid (NAA) 0.05mg / L, indolebutyric acid (IBA) 0.02mg / L, sugar 20g, adjust pH to 5.9 with 1mol / L NaOH, add agar powder 7.8g, autoclave, cool to about 40-50℃, add 1mL of Timentin (200mg / mL), and then add kanamycin sulfate (Kan) 100mg / L.
[0079] Example 4: Application of the PagERF49 gene
[0080] Following the experimental method described in Example 3, a total of 19 fluorescent resistant lines were obtained. DNA was extracted from leaves, and PCR amplification was performed using a sequence of both the vector and the gene as primers. Electrophoresis was then performed, with the vector plasmid serving as a positive control and wild-type 84K as a negative control (CK). Positive lines were identified based on the size of the bands. Eighteen of the obtained fluorescent lines were confirmed as positive plants. Figure 3 As shown, transcriptional levels were analyzed in a subset of identified overexpression-positive plants. Based on the results of real-time quantitative PCR, the lines with the highest expression levels (#33, #39, and #72) showed expression fold increases of 35-fold, 25-fold, and 47-fold, respectively, compared to the negative control (CK). Figure 4 As shown, therefore, #33, #39 and #72 were selected as the materials for subsequent experiments;
[0081] Overexpression lines #33, #39, and #72 with high expression levels, as well as wild-type 84K, were selected. At least 15 plants from each line were propagated, and tissue culture seedlings with relatively uniform growth were selected for transplanting into soil culture. The culture conditions were 24℃ and 16h / 8h light / dark. After two months of soil culture, samples were taken to observe and record the growth characteristics of the control 84K and PagERF49 overexpression plants. Figure 5 As shown, A is a comparison of the whole plant morphology of the control and transgenic plants, B is a statistical comparison of the plant height of the control and transgenic plants, C is a comparison of the leaves of the control and transgenic plants, and D is a magnified comparison of some leaves of the control and transgenic plants. Plants with uniform growth were selected and their plant height was measured with a long ruler and statistical analysis was performed. Nine plants were measured for each line to explore the effect of PagERF49 gene overexpression on the growth and development of poplar.
[0082] like Figure 6-1 The image shown is a comparison of the stem cross-section between the 11th node of a non-transgenic 84K poplar (CK) grown in soil for two months and a PagERF49 overexpressing transgenic poplar (OE#33, OE#39, OE#72) from Example 4 of this invention; as shown... Figure 6-2 The figure shows the percentage of xylem region in the cross-section of the stem between the 11th node of a non-transgenic 84K poplar (CK) grown in soil for two months and a PagERF49 overexpressing transgenic poplar (OE#33, OE#39, OE#72) in Example 4 of this invention; as shown. Figure 6-3 The image shown is a scanning electron microscope (SEM) comparison of the xylem of the 11th internode between non-transgenic 84K poplar (CK) grown in soil for two months and the PagERF49 overexpressing transgenic poplar (OE#33, OE#39, OE#72) in Example 4 of this invention; Figure 6-4The figure shows the average area of xylem vessels in the 11th internode of non-transgenic 84K poplar (CK) and PagERF49 overexpression transgenic poplar (OE#33, OE#39, OE#72) in Example 4 of this invention, after two months of soil cultivation. Analysis of growth phenotypes revealed that the plant height of the transgenic poplar PagERF49 (OE#33, OE#39, OE#72) was significantly increased compared to the control lines, approximately 1.21 times, 1.23 times, and 1.19 times that of the control lines, respectively. Note: t-test, **, p<0.01; leaf observation showed that the leaves of the overexpression lines all exhibited significantly reduced leaf margin notches, demonstrating different growth morphologies; furthermore, after cross-sectioning the stem, the xylem width of the overexpressing PagERF49 poplar was found to be significantly wider. Figure 6-1 , Figure 6-2 Furthermore, the area of a single vessel in the xylem region was significantly smaller than that of the control line. Figure 6-3 , Figure 6-4 This suggests that PagERF49 may be involved in the development of poplar wood and vessels, and plays an important role in this process.
[0083] Based on the observation of growth phenotypes and the analysis of physiological indicators, PagERF49 plays an important role in the growth of poplar trees. It participates in the development of poplar leaves and stems and may affect the material properties. Further experiments are needed to verify this.
[0084] This invention involves transferring the PagERF49 gene into 84K poplar. Compared with the control, transgenic poplar trees overexpressing PagERF49 showed increased plant height, reduced leaf margin notches, significantly increased xylem width, and reduced vessel area. This indicates that the PagERF49 gene is a key regulatory gene controlling the development of poplar leaves and stems, and has important application value in the fields of forest tree genetic engineering and clonal forestry. It also provides a reference for the study of ERFs in woody plants.
[0085] Obviously, the above embodiments of the present invention are merely examples for clearly illustrating the present invention, and are not intended to limit the implementation of the present invention. For those skilled in the art, other variations or modifications can be made based on the above description. It is impossible to exhaustively list all the implementation methods here. All obvious variations or modifications derived from the technical solutions of the present invention are still within the protection scope of the present invention.
Claims
1. A gene that regulates the development of poplar leaves and stems. PagERF49 Its nucleotide sequence is shown in Sequence 3 of the sequence listing.
2. An expression protein of PagERF49, a gene that regulates the development of poplar leaves and stems, the amino acid sequence of which is shown in sequence 4 of the sequence listing.
3. The application of overexpression of the gene PagERF49, which regulates the development of poplar leaves and stems as described in claim 1, in the process of regulating the development of poplar leaves and stems, wherein the process of regulating the development of poplar leaves and stems is: increased plant height, reduced leaf margin notches, significantly increased xylem width, and reduced vessel area.