Human anti-human PLA2R antibody standard and its application

Abstract

The present invention discloses a human anti-human PLA2R antibody or an antigen-binding fragment thereof. The antibody or the antigen-binding fragment thereof comprises: a CDR sequence selected from at least one of the following or an amino acid sequence having at least 80% identity therewith, a heavy chain variable region CDR sequence selected from SEQ ID NO: 1 to 105, and a light chain variable region CDR sequence selected from SEQ ID NO: 106 to 210. The antibody or the antigen-binding fragment thereof has a high affinity with the PLA2R protein and can be used as an anti-human PLA2R antibody standard. The antibody or the antigen-binding fragment thereof can be obtained by cell recombination expression, has the advantages of stability and mass production, and can exclude the possibility of being contaminated by pathogenic microorganisms during the preparation process, thereby ensuring the purity and stability of the anti-human PLA2R antibody standard.

Description

Technical Field

[0001] The present invention belongs to the field of bioengineering. Specifically, the present invention relates to a human anti-human PLA2R antibody standard and its application. More specifically, the present invention relates to an anti-human PLA2R antibody or its antigen-binding fragment, nucleic acid molecule, expression vector, recombinant cell, kit and its application. Background Art

[0002] Primary membranous nephropathy is one of the important causes of renal failure and the leading cause of nephrotic syndrome. Although no more than 30% of primary membranous nephropathy may spontaneously remit, 30% of patients' renal function will slowly progress to renal failure in about 10 years, posing a serious threat to people's lives and health. Basic research in recent years has confirmed that primary membranous nephropathy is an autoimmune disease. The body's autoimmune antigens activate the immune system under disease conditions and produce autoimmune antibodies. Autoimmune antibodies bind to autoimmune antigens on glomerular podocytes, causing the immune system to attack podocytes and surrounding tissues, causing inflammation and glomerular damage.

[0003] The autoimmune antigens of primary membranous nephropathy that have been studied more clearly are PLA2R and THSD7A. About 70%-80% of primary membranous nephropathy is PLA2R type, and less than 10% of primary membranous nephropathy is THSD7A type.

[0004] PLA2R antibodies (PLA2R-Ab) play an important role in the development and progression of PLA2R-type MN. The level of PLA2R-Ab in serum can be used as a predictive marker for PLA2R-type MN. A higher PLA2R-Ab titer means a lower chance of spontaneous remission. A decrease in PLA2R-Ab titer is often associated with spontaneous remission and is as low as undetectable in patients with complete remission of the disease. Immunosuppressive therapy can reduce PLA2R-Ab titer.

[0005] The concentration of PLA2R antibodies can be qualitatively or quantitatively detected by diagnostic kits. PLA2R antibody diagnostic kits usually use immunological detection methods such as ELISA to detect the signal generated by antibodies in samples, and compare it with the signal generated by antibody standards to obtain relative concentrations. The standard used in the current PLA2R antibody diagnostic kit is diluted human serum, and there are several major defects in using diluted human serum as a standard. First, the human serum standard is a relative concentration obtained by comparing it with the antibodies in standard human serum, so the chemical concentration of antibodies in plasma cannot be absolutely quantified, and only the relative unit RU can be obtained, which has limited value for clinical research and treatment, and the development of drugs and treatment methods; secondly, although human serum standards have been tested for several viruses such as HIV and HCV, contamination by other viruses and pathogenic microorganisms cannot be ruled out, so there is a risk of pathogen contamination; finally, the source of standards prepared with human serum is narrow and limited, the production cost is high, and the antibodies produced by different patients are different, so batch differences are prone to occur.

[0006] Therefore, there is an urgent need to provide a PLA2R antibody standard that is simple to prepare and less prone to batch differences. Summary of the invention

[0007] The present invention aims to solve at least one of the technical problems existing in the prior art to a certain extent. To this end, the present invention provides an anti-human PLA2R antibody or an antigen-binding fragment thereof, which has a high affinity for the PLA2R protein, has the advantages of simple preparation and is not prone to batch differences, and can be used as an anti-human PLA2R antibody standard.

[0008] The present invention is accomplished based on the following findings of the inventors:

[0009] PLA2R is a membrane protein highly expressed on the surface of glomerular podocytes, including Figure 1 The antibody in the patient's plasma mainly recognizes the three domains of CysR, FNII and CTLD1 in PLA2R. Therefore, the inventors designed and recombinantly expressed these three domains, used them as antigens, screened human antibodies targeting these three domains using a humanized recombinant phage library, used them as anti-human PLA2R antibody standards, and used the marketed diagnostic kit for calibration, and the concentration conversion relationship between the anti-human PLA2R antibody standard and the antibody in human serum can be obtained. In addition, the antibody can be obtained by recombinant expression of mammalian cells, which can achieve the purpose of stable and large-scale production, thereby improving the yield and quality of standard antibodies, reducing production costs, and eliminating the possibility of contamination by pathogenic microorganisms.

[0010] In one aspect of the present invention, the present invention proposes an antibody or an antigen-binding fragment thereof. According to an embodiment of the present invention, the antibody or its antigen-binding fragment comprises: a CDR sequence selected from at least one of the following or an amino acid sequence having at least 80% identity therewith: heavy chain variable region CDR sequence: SEQ ID NO: 1-105; light chain variable region CDR sequence: SEQ ID NO: 106-210. The antibody or its antigen-binding fragment has a high affinity with the PLA2R protein and can be used as an anti-human PLA2R antibody standard. The antibody or its antigen-binding fragment can be obtained by cell recombinant expression, has the advantages of stability and mass production, and can eliminate the possibility of contamination by pathogenic microorganisms during the preparation process, avoid batch differences, and thus ensure the purity and stability of the anti-human PLA2R antibody standard.

[0011] In another aspect of the present invention, the present invention provides a nucleic acid molecule. According to an embodiment of the present invention, the nucleic acid molecule encodes the aforementioned antibody or antigen-binding fragment thereof. The nucleic acid molecule of the present invention can effectively express the aforementioned antibody or antigen-binding fragment thereof.

[0012] In another aspect of the present invention, the present invention provides an expression vector. According to an embodiment of the present invention, the expression vector carries the aforementioned nucleic acid molecule. The expression vector of the present invention can effectively express the aforementioned antibody or antigen-binding fragment thereof.

[0013] In another aspect of the present invention, the present invention provides a recombinant cell. According to an embodiment of the present invention, the recombinant cell: carries the aforementioned nucleic acid molecule; or, expresses the aforementioned antibody or antigen-binding fragment thereof. The recombinant cell of the embodiment described in the present invention can be used for in vitro expression and large-scale acquisition of the aforementioned antibody or antigen-binding fragment thereof.

[0014] In another aspect of the present invention, the present invention proposes a use of the aforementioned antibody or antigen-binding fragment thereof, the aforementioned nucleic acid molecule, the aforementioned expression vector or the aforementioned recombinant cell as a PLA2R antibody standard. As can be seen from the foregoing, the aforementioned antibody or antigen-binding fragment thereof has a high affinity with the PLA2R protein, and can be obtained by recombinant expression of mammalian cells, and has the advantages of being stable and mass-produced, thereby eliminating the possibility of being contaminated by pathogenic microorganisms during the preparation process. Therefore, the aforementioned antibody or antigen-binding fragment thereof can be used as an anti-human PLA2R antibody standard to improve the accuracy of PLA2R antibody detection.

[0015] In another aspect of the present invention, the present invention proposes a kit. According to an embodiment of the present invention, the kit includes: the aforementioned antibody or antigen-binding fragment thereof; the aforementioned nucleic acid molecule; the aforementioned expression vector; or the aforementioned recombinant cell. As can be seen from the foregoing, the aforementioned antibody or antigen-binding fragment thereof has a high affinity with the PLA2R protein, can be stably and mass-produced, can exclude contamination by pathogenic microorganisms, and can be used as an anti-human PLA2R antibody standard. Therefore, the kit containing the above-mentioned antibody or antigen-binding fragment thereof has the advantages of high accuracy in detecting PLA2R antibodies.

[0016] In another aspect of the present invention, the present invention proposes a use of the aforementioned antibody or antigen-binding fragment thereof, the aforementioned nucleic acid molecule, the aforementioned expression vector or the aforementioned recombinant cell in preparing a kit, and the kit is used to detect PLA2R antibodies or diagnose PLA2R antibody-positive membranous nephropathy. As can be seen from the above, the aforementioned antibody or antigen-binding fragment thereof has a high affinity with the PLA2R protein, can be stably and mass-produced, can exclude contamination by pathogenic microorganisms, and can be used as an anti-human PLA2R antibody standard. Therefore, the kit containing the above antibody or antigen-binding fragment thereof has the advantages of high accuracy in detecting PLA2R antibodies.

[0017] In another aspect of the present invention, the present invention proposes a method for detecting PLA2R antibodies. According to an embodiment of the present invention, the method comprises: based on the detection result of PLA2R antibodies, using the aforementioned antibody or its antigen-binding fragment as a PLA2R antibody standard product to determine the content of PLA2R antibodies in the sample to be tested. Thus, the accuracy of PLA2R antibody detection can be improved. As can be seen from the above, the aforementioned antibody or its antigen-binding fragment has a high affinity with PLA2R protein, can be stably and mass-produced, can exclude pathogenic microorganism contamination, and can be used as an anti-human PLA2R antibody standard product. Therefore, the method of the present invention has the advantages of high accuracy in detecting PLA2R antibodies.

[0018] In another aspect of the present invention, the present invention proposes a method for diagnosing PLA2R antibody-positive membranous nephropathy. According to an embodiment of the present invention, the method comprises: based on the detection result of PLA2R antibody in the sample to be tested, using the aforementioned antibody or its antigen-binding fragment as a PLA2R antibody standard product, so as to obtain the content of PLA2R antibody in the sample to be tested; based on the content of the PLA2R antibody, determining whether the patient corresponding to the sample to be tested suffers from PLA2R antibody-positive membranous nephropathy. Thus, the accuracy of PLA2R antibody detection can be improved. As can be seen from the foregoing, the aforementioned antibody or its antigen-binding fragment has a high affinity with the PLA2R protein, can be stably and mass-produced, can exclude pathogenic microorganism contamination, can be used as an anti-human PLA2R antibody standard product, and can accurately detect the content of PLA2R antibody. Thus, the method of the present invention has a high diagnostic accuracy for PLA2R antibody-positive membranous nephropathy.

[0019] Additional aspects and advantages of the present invention will be given in part in the following description and in part will be obvious from the following description, or will be learned through practice of the present invention.

[0020] The amino acid sequence table of the present invention is as follows:

[0021]

[0022]

[0023]

[0024]

[0025]

[0026]

[0027]

[0028]

[0029]

[0030]

[0031] The nucleotide sequence table of the present invention is as follows:

[0032]

[0033]

[0034]

[0035]

[0036]

[0037]

[0038]

[0039]

[0040]

[0041]

[0042]

[0043]

[0044]

[0045] BRIEF DESCRIPTION OF THE DRAWINGS

[0046] The above and / or additional aspects and advantages of the present invention will become apparent and easily understood from the description of the embodiments in conjunction with the following drawings, in which:

[0047] Figure 1 It is a schematic diagram of the structure of PLA2R in the present invention.

[0048] Figure 2 Schematic diagram of the structure of the expression framework in Example 1 of the present invention.

[0049] Figure 3 This is the SDS-PAGE analysis of CC1H in Example 1 of the present invention; wherein lane 1 is a molecular weight reference; lane 2 is purified CC1H without reduction; and lane 3 is purified CC1H with reduction.

[0050] Figure 4 The results are the binding activity of each antibody and CC1h in Example 3 of the present invention.

[0051] Figure 5 The results are the binding activity of each antibody and CC1h in Example 3 of the present invention.

[0052] Figure 6 The protein standard curve (y=0.6849x+0.6325, R 2 =0.9925).

[0053] Figure 7This is a diagram showing the purification effect of CC1H-Biotin detected by SDS-PAGE in Example 4 of the present invention; wherein lane 1 is CC1H-Biotin in a reducing loading buffer containing DTT, and lane 2 is CC1H-Biotin in a non-reducing loading buffer.

[0054] Figure 8 The standard curve was prepared by diluting the A13 (P59368) and A13SP (P62297) antibodies in Example 5 of the present invention at 1RU / mL=70ng / mL to the same concentration as the standard.

[0055] Fig. 9 For the 9 antibodies in Example 5 of the present invention ( Fig. 9 A) and its SP mutant antibodies ( Fig. 9 B) The standard curve was prepared by diluting the sample to an equivalent concentration of 1RU / mL = 70ng / mL. DETAILED DESCRIPTION

[0056] The embodiments of the present invention are described in detail below. The embodiments described below are exemplary and are only used to explain the present invention, and should not be understood as limiting the present invention.

[0057] It should be noted that the terms "first" and "second" are used for descriptive purposes only and should not be understood as indicating or implying relative importance or implicitly indicating the number of the indicated technical features. Therefore, the features defined as "first" and "second" may explicitly or implicitly include one or more of the features. Further, in the description of the present invention, unless otherwise specified, the meaning of "plurality" is two or more.

[0058] The endpoints and any values ​​of the ranges disclosed in this article are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of each range, the endpoint values ​​of each range and the individual point values, and the individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed in this article.

[0059] In order to make the present invention more easily understood, certain technical and scientific terms are specifically defined below. Unless otherwise clearly defined elsewhere in this document, all other technical and scientific terms used herein have the meanings commonly understood by those of ordinary skill in the art to which the present invention belongs. The abbreviations for amino acid residues are standard 3-letter and / or 1-letter codes used in the art to refer to one of the 20 commonly used L-amino acids.

[0060] In this document, the terms “include” or “comprising” are open expressions, that is, including the contents specified in the present invention but not excluding other contents.

[0061] As used herein, the terms "optionally", "optional", "optionally", "optional" or "optional" generally mean that the subsequently described event or circumstance may but need not occur, and that the description includes instances where the event or circumstance occurs and instances where it does not occur.

[0062] As used herein, the terms "identity", "homology" or "similarity" are used to describe an amino acid sequence or a nucleic acid sequence relative to a reference sequence, and the percentage of identical amino acids or nucleotides between two amino acid sequences or nucleic acid sequences is determined by conventional methods, for example, see Ausubel et al., eds. (1995), Current Protocols in Molecular Biology, Chapter 19 (Greene Publishing and Wiley-Interscience, New York); and the ALIGN program (Dayhoff (1978), Atlas of Protein Sequence and Structure 5: Suppl. 3 (National Biomedical Research There are many algorithms for aligning sequences and determining sequence identity, including the homology alignment algorithm of Needleman et al. (1970) J. Mol. Biol. 48:443; the local homology algorithm of Smith et al. (1981) Adv. Appl. Math. 2:482; the similarity search method of Pearson et al. (1988) Proc. Natl. Acad. Sci. 85:2444; the Smith-Waterman algorithm (Meth. Mol. Biol. 48:443); the local homology algorithm of Smith et al. (1981) Adv. Appl. Math. 2:482; the similarity search method of Pearson et al. (1988) Proc. Natl. Acad. Sci. 85:24 ... .70:173-187 (1997); and BLASTP, BLASTN, and BLASTX algorithms (see Altschul et al. (1990) J. Mol. Biol. 215:403-410). Computer programs that utilize these algorithms are also available, and include, but are not limited to: ALIGN or Megalign (DNASTAR) software, or WU-BLAST-2 (Altschul et al., Meth. Enzym., 266:460-480 (1996)); or GAP, BESTFIT, BLAST Altschul et al., supra, FASTA, and TFASTA, available in the Genetics Computing Group (GCG) package, Version 8, Madison, Wisconsin, USA; and CLUSTAL in the PC / Gene program provided by Intelligenetics, Mountain View, California.

[0063] Under the premise of not substantially affecting the activity of the antibody (retaining at least 90% of the activity), those skilled in the art can replace, add and / or delete one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 or more) amino acids in the sequence of the present invention to obtain variants of the antibody or its antigen-binding fragment sequence. They are all considered to be included in the scope of protection of the present invention. For example, amino acids with similar properties are replaced in the variable region. The variant sequence of the present invention can have at least 90%, 95%, 96%, 97%, 98% or 99% consistency (or homology) with the reference sequence. The sequence consistency of the present invention can be measured using sequence analysis software. For example, the computer program BLAST with default parameters is used, especially BLASTP or TBLASTN. The amino acid sequences described in the present invention are all shown in a manner from N-terminus to C-terminus.

[0064] As used herein, the term "at least 80% homology" refers to at least 80%, and may be 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9% homology to each reference sequence. The term "at least 90% homology" refers to at least 90%, and may be 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9% homology to each reference sequence.

[0065] As used herein, the term "variant" or "mutant" may refer to any naturally occurring or engineered molecule comprising one or more nucleotide or amino acid mutations.

[0066] In this article, the term "expression vector" generally refers to a nucleic acid molecule that can be inserted into a suitable host and replicates itself, and the inserted nucleic acid molecule is transferred to a cell or host and / or between cells or hosts. The expression vector may include a vector that is mainly used to insert DNA or RNA into a cell, a vector that is mainly used to replicate DNA or RNA, and a vector that is mainly used to express the transcription and / or translation of DNA or RNA. The vector also includes a vector with a variety of the above functions. The expression vector can be a polynucleotide that can be transcribed and translated into a polypeptide when introduced into a suitable cell or host. Usually, the expression vector can produce a desired expression product by culturing a suitable cell or host containing the expression vector.

[0067] In this article, the term "recombinant cell" generally refers to the use of genetic engineering technology or cell fusion technology to modify or reorganize the genetic material of the host cell to obtain a cell with a unique trait of stable inheritance. Among them, the term "host cell" refers to a prokaryotic cell or eukaryotic cell that can be introduced into an expression vector. The terms "transformed" or "transfected" used herein refer to the introduction of nucleic acids (such as vectors) into cells by various techniques known in the art. Suitable host cells can be transformed or transfected with the DNA sequence of the present invention, and can be used for the expression and / or secretion of target proteins. Examples of suitable host cells that can be used in the present invention include immortalized hybridoma cells, NS / 0 myeloma cells, 293 cells, Chinese hamster ovary (CHO) cells, HeLa cells, Cap cells (cells derived from human amniotic fluid) and CoS cells.

[0068] The present invention provides an anti-human PLA2R antibody or an antigen-binding fragment thereof, a nucleic acid molecule, an expression vector, a recombinant cell, a kit and uses thereof, which will be described in detail below.

[0069] Antibodies or antigen-binding fragments thereof

[0070] In one aspect of the present invention, the present invention proposes an antibody or an antigen-binding fragment thereof. According to an embodiment of the present invention, the antibody or the antigen-binding fragment thereof comprises: a CDR sequence selected from at least one of the following or an amino acid sequence having at least 80% identity therewith: heavy chain variable region CDR sequence: SEQ ID NO: 1-105; light chain variable region CDR sequence: SEQ ID NO: 106-210. The antibody or the antigen-binding fragment thereof has a high affinity with the PLA2R protein and can be used as an anti-human PLA2R antibody standard. The antibody or the antigen-binding fragment thereof can be obtained by cell recombinant expression, has the advantages of stability and mass production, and can eliminate the possibility of contamination by pathogenic microorganisms during the preparation process, thereby ensuring the purity and stability of the anti-human PLA2R antibody standard.

[0071] In this article, the term "antibody" is used in the broadest sense, which can include full-length monoclonal antibodies, multispecific antibodies, and chimeric antibodies, and the specific structure is not limited as long as they show the desired biological activity. It usually includes a light chain with a lighter molecular weight and a heavy chain with a heavier molecular weight, and the heavy chain (H chain) and the light chain (L chain) are connected by a disulfide bond to form an antibody molecule. Among them, the amino acid sequence of the amino terminal (N terminal) of the peptide chain varies greatly, which is called the variable region (V region); the carboxyl terminal (C terminal) is relatively stable and varies little, which is called the constant region (C region). The V regions of the L chain and the H chain are respectively called VL and VH, wherein both VL and VH contain the regions of the main amino acid residues that play a role in the binding affinity of the recognized antigen or epitope, namely CDR.

[0072] As used herein, the terms "complementarity determining region", "CDR" or "CDRs" refer to the highly variable regions of the heavy and light chains of immunoglobulins, and refer to the regions containing one or more or even all of the major amino acid residues that contribute to the binding affinity of the antibody or its antigen-binding fragment to its recognized antigen or epitope.

[0073] As used herein, the heavy chain complementary determining regions (heavy chain variable region CDRs) are referred to as "HCDRs" or "HCDRs", which include HCDR1 (also known as CDR-H1), HCDR2 (also known as CDR-H2) and HCDR3 (also known as CDR-H3); the light chain complementary determining regions (light chain variable region CDRs) are referred to as "LCDRs" or "LCDRs", which include LCDR1 (also known as CDR-L1), LCDR2 (also known as CDR-L2) and LCDR3 (also known as CDR-L3). Commonly used CDR definition schemes in the art include: Kabat, Chothia, IMGT, Contact and AbM. As used herein, "Kabat" refers to the definition system described in Kabat et al., USDept. of Health and Human Services, "Sequence of Proteins of Immunological Interest" (1983). "Chothia definition" refers to Chothia et al., J Mol Biol 196:901-917 (1987). Exemplary defined CDRs are listed in Table A below. The definitions in different documents are slightly different. Given the variable region amino acid sequence of an antibody, a person skilled in the art can routinely determine which residues comprise a specific CDR. It should be noted that the CDRs in the present invention include CDRs defined by other methods, not limited to those in Table A. CDRs determined by other rules disclosed in the art based on the heavy chain variable region and light chain variable region disclosed in this application also fall within the scope of protection of the present disclosure.

[0074] Table A: CDR Definition 1

[0075] CDR Kabat <![CDATA[AbM 2 ]]> Chothia HCDR1 <![CDATA[H31~H35 3 ]]> <![CDATA[H26~H35 3 ]]> <![CDATA[H26~H32..34 4 ]]> HCDR2 H50~H65 H50~H58 H52~H56 HCDR3 H95~H102 H95~H102 H95~H102 LCDR1 L24~L34 L24~L34 L24~L34 LCDR2 L50~L56 L50~L56 L50~L56 LCDR3 L89~L97 L89~L97 L89~L97

[0076] 1 The numbering of all CDR definitions in Table A is based on the Kabat numbering system (see below), with amino acid numbers on the heavy chain represented by "H+numbers" and amino acid numbers on the light chain represented by "L+numbers".

[0077] 2 "AbM" as used in Table A with a lowercase "b" refers to CDRs defined by Oxford Molecular's "AbM" antibody modeling software.

[0078] 3 If both H35A and H35B are absent, CDR-H1 ends at position 35; if only H35A is present, CDR-H1 ends at position 35A; if both H35A and H35B are present, CDR-H1 ends at position 35B.

[0079] 4 If both H35A and H35B are absent, CDR-H1 ends at position 32; if only H35A is present, CDR-H1 ends at position 33; if both H35A and H35B are present, CDR-H1 ends at position 34.

[0080] Kabat et al. also defined a numbering system applicable to the variable region sequence of any antibody. A person of ordinary skill in the art can clearly correspond the Kabat numbering system to any variable region sequence without relying on any experimental data other than the sequence itself. As described herein, "Kabat numbering" refers to the numbering system described in "Kabat et al., U. S. Patent. of Health and Human Services, "Sequence of Proteins of Immunological Interest" (1983)". The above numbering system is used to number the HCDRs and LCDRs of the antibodies or antigen-binding fragments thereof of the present application, and the specific numbering results are shown in Table A.

[0081] It should be noted that the CDR of the present invention is annotated according to the domain alignment (see "Ehrenmann F, Kaas Q, Lefranc MP. IMGT / 3Dstructure-DB and IMGT / DomainGapAlign: a database and a tool for immunoglobulins or antibodies, T cell receptors, MHC, IgSF and MhcSF. Nucleic Acids Res. 2010 Jan; 38 (Database issue): D301-7. PMID: 19900967." and "Ehrenmann F, Lefranc MP. IMGT / DomainGapAlign: IMGT standardized analysis of amino acid sequences of variable, constant, and groove domains (IG, TR, MH, IgSF, MhSF). Cold Spring Harb Protoc. 2011 Jun 1; 2011 (6): 737-49. PMID: 21632775."). However, a person of ordinary skill in the art is fully capable of converting the heavy chains and light chains in the sequence listing into other numbering systems (such as Kabat, Chothia, Contact and AbM) according to the definition rules of Table A for definition, and the CDRs obtained thereby are all within the scope of protection of the present invention.

[0082] As used herein, the terms "full-length antibody", "full-length monoclonal antibody" or "full-length monoclonal antibody" are composed of at least two identical light chains and at least two identical heavy chains connected by interchain disulfide bonds, such as immunoglobulin G (IgG), immunoglobulin A (IgA), immunoglobulin M (IgM), immunoglobulin D (IgD) or immunoglobulin E (IgE).

[0083] In this article, the terms "polyantibody" and "multispecific antibody" are synonymous, and both refer to antibodies that can recognize multiple antigenic epitopes, such as antibodies that can recognize two antigenic epitopes (bispecific antibodies, referred to as bispecific antibodies), antibodies that recognize three antigenic epitopes, or antibodies that recognize four antigenic epitopes. They are understood in a broad sense, and the specific structure is not limited, as long as they can recognize multiple antigenic epitopes. In the present invention, at least one of the multiple antigenic epitopes is derived from cTnI.

[0084] As used herein, the term "antigen-binding fragment" is a fragment comprising part or all of an antibody, which lacks at least some of the amino acids present in the full-length chain but is still capable of specifically binding to an antigen, for example, the fragment may comprise part or all of an antibody CDR. Such fragments are biologically active because they bind to an antigen and can compete with other antigen-binding molecules (including intact antibodies) for binding to a given epitope. Such fragments are selected from Fab, Fv, scFv or single domain antibodies. Such fragments can be produced by recombinant nucleic acid technology, or can be produced by enzymatic cleavage or chemical cleavage of antigen-binding molecules (including intact antibodies).

[0085] In some optional embodiments of the present invention, the above-mentioned antibody or antigen-binding fragment thereof may further include at least one of the following additional technical features:

[0086] In some optional embodiments of the present invention, the antibody or its antigen-binding fragment comprises: a heavy chain variable region CDR1 selected from an amino acid sequence as shown in any one of SEQ ID NOs: 1 to 35 or an amino acid sequence having at least 80% identity therewith; a heavy chain variable region CDR2 selected from an amino acid sequence as shown in any one of SEQ ID NOs: 36 to 70 or an amino acid sequence having at least 80% identity therewith; a heavy chain variable region CDR3 selected from an amino acid sequence as shown in any one of SEQ ID NOs: 71 to 105 or an amino acid sequence having at least 80% identity therewith; a light chain variable region CDR1 selected from an amino acid sequence as shown in any one of SEQ ID NOs: 106 to 140 or an amino acid sequence having at least 80% identity therewith; a light chain variable region CDR2 selected from an amino acid sequence as shown in any one of SEQ ID NOs: 141 to 175 or an amino acid sequence having at least 80% identity therewith; or a light chain variable region CDR3 selected from an amino acid sequence as shown in any one of SEQ ID NOs: 176 to 210 or an amino acid sequence having at least 80% identity therewith.

[0087] In some optional embodiments of the present invention, the antibody or antigen-binding fragment thereof comprises a heavy chain variable region of any one of the following groups:

[0088]

[0089]

[0090] And / or, the antibody or antigen-binding fragment thereof comprises a light chain variable region of any one of the following groups:

[0091]

[0092]

[0093] In some optional embodiments of the present invention, the antibody or antigen-binding fragment thereof comprises any one of the following combinations:

[0094]

[0095] In some optional embodiments of the present invention, the antibody or antigen-binding fragment thereof specifically recognizes PLA2R protein.

[0096] In some optional embodiments of the present invention, the antibody or antigen-binding fragment thereof specifically recognizes a PLA2R antigen epitope peptide.

[0097] Herein, the term "PLA2R antigen epitope peptide" refers to a polypeptide having an amino acid sequence derived from PLA2R. The "PLA2R antigen epitope peptide" comprises an antigen epitope that can specifically bind to a PLA2R antibody. For example, the PLA2R antigen epitope peptide comprises CysR, FnII, and PLA2R binding region 1; wherein the term "CysR" refers to the CysR domain in PLA2R, and the term "PLA2R binding region 1" refers to CTLD1 (or CTLD domain 1) in PLA2R. For specific structures, see Figure 1 .

[0098] In some optional embodiments of the present invention, the antibody or antigen-binding fragment thereof specifically recognizes the CysR, FNII and CTLD1 domains in the PLA2R protein.

[0099] In some optional embodiments of the present invention, the antibody or its antigen-binding fragment further comprises: at least one of a heavy chain framework region sequence and a light chain framework region sequence; wherein at least a portion of at least one of the heavy chain framework region sequence and the light chain framework region sequence is derived from at least one of a murine antibody, a human antibody, a primate antibody or a mutant thereof.

[0100] Herein, "framework region" or "FR" region includes heavy chain framework region and light chain framework region, and refers to the region excluding CDR in the antibody heavy chain variable region (which can be expressed as VH) and light chain variable region (which can be expressed as VL); wherein, the heavy chain framework region is represented by "HFR" and can be further subdivided into adjacent regions separated by CDR, including HFR1, HFR2, HFR3 and HFR4 framework regions; the light chain framework region is represented by "LFR" and can be further subdivided into adjacent regions separated by CDR, including LFR1, LFR2, LFR3 and LFR4 framework regions.

[0101] In some optional embodiments of the present invention, at least a portion of the heavy chain framework region sequence and the light chain framework region sequence are derived from a human antibody or a mutant thereof.

[0102] In some optional embodiments of the present invention, the antibody or antigen-binding fragment thereof has a heavy chain variable region with an amino acid sequence as shown in any one of SEQ ID NOs: 211 to 245.

[0103] In some optional embodiments of the present invention, the antibody or antigen-binding fragment thereof has a light chain variable region with an amino acid sequence as shown in any one of SEQ ID NOs: 246 to 280.

[0104] In some optional embodiments of the present invention, the antibody or antigen-binding fragment thereof comprises any one of the following combinations:

[0105] Combination number VH (SEQ ID NO: VL (SEQ ID NO: Combination number VH (SEQ ID NO: VL (SEQ ID NO: 1 211 246 19 229 264 2 212 247 20 230 265 3 213 248 21 231 266 4 214 249 22 232 267 5 215 250 23 233 268 6 216 251 24 234 269 7 217 252 25 235 270 8 218 253 26 236 271 9 219 254 27 237 272 10 220 255 28 238 273 11 221 256 29 239 274 12 222 257 30 240 275 13 223 258 31 241 276 14 224 259 32 242 277 15 225 260 33 243 278 16 226 261 34 244 279 17 227 262 35 245 280 18 228 263 .

[0106] In some optional embodiments of the present invention, the antibody contains at least one of a heavy chain constant region and a light chain constant region, and at least a portion of at least one of the heavy chain constant region and the light chain constant region is derived from at least one of a murine antibody, a human antibody, a primate antibody or a mutant thereof.

[0107] In some optional embodiments of the present invention, the heavy chain constant region includes a heavy chain constant region selected from IgG1, IgG2, IgG3, IgG4, IgA, IgM, IgE or IgD; or, the light chain constant region includes a light chain constant region selected from κ or λ.

[0108] In some optional embodiments of the present invention, the light chain constant region and the heavy chain constant region are both derived from human IgG4 antibody or a mutant thereof.

[0109] In some optional embodiments of the present invention, the heavy chain constant region is wild-type human IgG4 or a human IgG4 mutant.

[0110] In some optional embodiments of the present invention, the human IgG4 mutant (having the amino acid sequence shown in SEQ ID NO: 282) has an S228P site mutation compared to the heavy chain constant region of the wild-type human wild-type IgG4 antibody.

[0111] It should be noted that the numbering of the above-mentioned sites is obtained by converting the amino acid numbering of the wild-type human IgG4 Fc part (having the amino acid sequence shown in SEQ ID NO: 281) into the EU numbering system, for example, position 228 refers to position 228 numbered according to the EU numbering system; the "S228P" means that the serine at position 228 numbered according to the EU numbering system is replaced by proline.

[0112] In some optional embodiments of the present invention, the heavy chain constant region has an amino acid sequence as shown in SEQ ID NO: 281 or SEQ ID NO: 282.

[0113] In some optional embodiments of the present invention, the light chain constant region has an amino acid sequence as shown in SEQ ID NO:357.

[0114] In some optional embodiments of the present invention, the antibody or its antigen-binding fragment has a heavy chain as shown in any one of the amino acid sequences of SEQ ID NOs: 283 to 317 and SEQ ID NOs: 358 to 366; or the antibody or its antigen-binding fragment has a light chain as shown in any one of the amino acid sequences of SEQ ID NOs: 318 to 352.

[0115] In some optional embodiments of the present invention, the antibody or antigen-binding fragment thereof comprises any one of the following combinations:

[0116]

[0117]

[0118] In some optional embodiments of the present invention, the antibody comprises at least one selected from monoclonal antibody, polyclonal antibody, multimeric antibody and CDR-grafted antibody.

[0119] In some optional embodiments of the present invention, the antibody comprises at least one selected from single-chain antibody, Fab antibody, Fab' antibody, F(ab')2 antibody, Fv antibody, single-chain antibody, single-domain antibody and minimum recognition unit.

[0120] In some optional embodiments of the present invention, the antigen binding fragment includes at least one of a Fab fragment, a Fab' fragment, a F(ab)2 fragment, a F(ab')2 fragment, a Fv fragment, a scFv fragment, a scFv-Fc fusion protein, a scFv-Fv fusion protein, an Fv fragment and a minimum recognition unit.

[0121] The antigen-binding fragments of the above antibodies generally have the same binding specificity as the antibodies from which they are derived. It is easy for a person skilled in the art to understand based on the contents of the disclosure that the antigen-binding fragments of the above antibodies can be obtained by methods such as enzymatic digestion (including pepsin or papain) and / or by chemical reduction to split disulfide bonds. Based on the structure of the complete antibody in the disclosure, a person skilled in the art can easily obtain the above antigen-binding fragments.

[0122] The antigen-binding fragments of the above antibodies can also be synthesized by recombinant genetic techniques also known to those skilled in the art or by, for example, an automatic peptide synthesizer, such as those sold by Applied BioSystems and the like.

[0123] In this article, the terms "polyantibody" and "multispecific antibody" are synonymous, and both refer to antibodies that can recognize multiple antigenic epitopes, such as antibodies that can recognize two antigenic epitopes (referred to as bispecific antibodies), antibodies that can recognize three antigenic epitopes, or antibodies that can recognize four antigenic epitopes. This is understood in a broad sense, and the specific structure is not limited, as long as it can recognize multiple antigenic epitopes.

[0124] In this article, the terms "CDR transplanted antibody" and "modified antibody" both refer to transplanting the CDR of a monoclonal antibody of one species to the variable region of an antibody of another species. For example, the CDR of a mouse monoclonal antibody can be transplanted to the variable region of a human antibody to replace the human antibody CDR, so that the human antibody obtains the antigen binding specificity of the mouse monoclonal antibody while reducing its heterology. It should be noted that both polyclonal antibodies and monoclonal antibodies in this application can be CDR transplanted antibodies.

[0125] Herein, the terms "single domain antibody", "nanoantibody" and "VHH antibody" are used interchangeably, which were originally described as antigen-binding immunoglobulin (variable) domains of "heavy chain antibodies" (i.e., "antibodies lacking light chains") (Hamers-Casterman C, Atarhouch T, Muyldermans S, Robinson G, Hamers C, Songa EB, Bendahman N, Hamers R.: "Naturally occurring antibodies devoid of light chains"; Nature 363, 446-448 (1993)), comprising a heavy chain variable region (VH) and conventional CH2 and CH3 regions, which specifically bind to antigen proteins (e.g., cTnI) through the heavy chain variable region.

[0126] As used herein, the term "Fab antibody" or "Fab fragment" generally refers to an antibody or fragment containing only the Fab molecule, which is composed of the VH and CH1 of the heavy chain and a complete light chain, with the light chain and the heavy chain connected by a disulfide bond.

[0127] As used herein, the term "F(ab')2 antibody" or "F(ab')2 fragment" has two antigen-binding F(ab') portions linked together by a disulfide bond.

[0128] As used herein, the term "Fv antibody" or "Fv fragment" generally refers to an antibody or fragment consisting only of a light chain variable region (VL) and a heavy chain variable region (VH) connected by non-covalent bonds, and is the smallest functional fragment of an antibody that retains a complete antigen binding site.

[0129] As used herein, the terms "single-chain antibody" and "scFv fragment" refer to antibodies or fragments formed by connecting the heavy chain variable region and the light chain variable region of an antibody via a short peptide.

[0130] In this article, the terms "minimum recognition unit" and "MRU" both refer to antibodies or fragments consisting of only one CDR, and their molecular weight is very small, accounting for only about 1% of the complete antibody.

[0131] Nucleic acid molecules, expression vectors, recombinant cells and kits and their uses

[0132] In the process of preparing or obtaining the aforementioned antibodies or antigen-binding fragments thereof, nucleic acid molecules expressing these antibodies or antigen-binding fragments thereof can be connected to different vectors and then expressed in different cells to obtain the corresponding antibodies or antigen-binding fragments thereof.

[0133] In another aspect of the present invention, the present invention provides a nucleic acid molecule. According to an embodiment of the present invention, the nucleic acid molecule encodes the aforementioned antibody or antigen-binding fragment thereof. According to an embodiment of the present invention, the nucleic acid molecule can encode the aforementioned antibody or antigen-binding fragment thereof.

[0134] In some optional embodiments of the present invention, the nucleic acid molecule is DNA.

[0135] It should be noted that, for the nucleic acid molecules mentioned herein, those skilled in the art will understand that they actually include any one or two of the complementary double strands. For convenience, in this article, although only one strand is provided in most cases, the other strand complementary thereto is actually disclosed. In addition, the molecular sequence in the present invention includes a DNA form or an RNA form, and disclosing one of them means that the other is also disclosed.

[0136] In another aspect of the present invention, the present invention proposes an expression vector. According to an embodiment of the present invention, the aforementioned nucleic acid molecule is carried. When the aforementioned nucleic acid molecule is connected to the vector, the nucleic acid molecule can be directly or indirectly connected to the control element on the expression vector, as long as these control elements can control the translation and expression of the nucleic acid molecule. Of course, these control elements can come directly from the expression vector itself, or they can be exogenous, that is, they are not from the expression vector itself. Of course, the nucleic acid molecule can be operably connected to the control element. Herein, "operably connected" refers to connecting the exogenous gene to the vector so that the control elements in the vector, such as transcription control sequences and translation control sequences, etc., can play their expected functions of regulating the transcription and translation of the exogenous gene. Commonly used vectors can be, for example, plasmids, bacteriophages, etc. After the vectors according to some specific embodiments of the present invention are introduced into suitable recipient cells, the expression of the aforementioned antibody or its antigen-binding fragment can be effectively achieved under the mediation of the regulatory system, thereby achieving a large amount of in vitro acquisition of the antibody or its antigen-binding fragment.

[0137] In some optional embodiments of the present invention, the expression vector is a eukaryotic expression vector or a prokaryotic expression vector.

[0138] In some optional embodiments of the present invention, the expression vector is a plasmid expression vector.

[0139] In another aspect of the present invention, the present invention provides a recombinant cell. According to an embodiment of the present invention, the recombinant cell: carries the aforementioned nucleic acid molecule; or, expresses the aforementioned antibody or antigen-binding fragment thereof. The cell can be used to effectively express the aforementioned antibody or antigen-binding fragment thereof in the cell under suitable conditions.

[0140] In some optional embodiments of the present invention, the recombinant cell is obtained by introducing the aforementioned expression vector into a host cell.

[0141] In some optional embodiments of the present invention, the recombinant cell is a eukaryotic cell.

[0142] In some optional embodiments of the present invention, the recombinant cell is a mammalian cell.

[0143] It should be noted that the cells of the present invention are not particularly limited and can be prokaryotic cells, eukaryotic cells or bacteriophages. The prokaryotic cells can be Escherichia coli, Bacillus subtilis, Streptomyces or Proteus mirabilis, etc. The eukaryotic cells include fungi such as Pichia pastoris, Saccharomyces cerevisiae, Schizosaccharomyces pombe, Trichoderma, insect cells such as armyworm, plant cells such as tobacco, and mammalian cells such as BHK cells, CHO cells, COS cells, and myeloma cells.

[0144] In an optional embodiment of the present invention, the cell is a mammalian cell, including a BHK cell, a CHO cell, a NSO cell or a COS cell, and does not include an animal germ cell, a fertilized egg or an embryonic stem cell.

[0145] It should be noted that the "suitable conditions" described in the present invention refer to conditions suitable for the expression of the antibody or antigen-binding fragment thereof of the present invention. It is easy for those skilled in the art to understand that conditions suitable for the expression of the antibody or antigen-binding fragment thereof include, but are not limited to, suitable transformation or transfection methods, suitable transformation or transfection conditions, healthy cell states, suitable cell density, suitable cell culture environment, and suitable cell culture time. "Suitable conditions" are not particularly limited, and those skilled in the art can optimize the most suitable conditions for the expression of the antibody or antigen-binding fragment thereof according to the specific environment of the laboratory.

[0146] In another aspect of the present invention, the present invention provides a use of the aforementioned antibody or antigen-binding fragment thereof, the aforementioned nucleic acid molecule, the aforementioned expression vector or the aforementioned recombinant cell as a PLA2R antibody standard. The method according to some specific embodiments of the present invention can effectively obtain the antibody or antigen-binding fragment thereof in large quantities.

[0147] Based on the amino acid sequence of the antibody or antigen-binding fragment thereof disclosed in the present invention, those skilled in the art can easily think of using genetic engineering technology or other technologies (chemical synthesis, recombinant expression) to prepare the antibody or antigen-binding fragment thereof, for example, separating and purifying the antibody or antigen-binding fragment thereof from the culture product of a recombinant cell capable of recombinantly expressing the antibody or antigen-binding fragment thereof as described in any of the above items, which is easy to achieve for those skilled in the art. Based on this, no matter what technology is used to prepare the antibody or antigen-binding fragment thereof disclosed in the present invention, it belongs to the protection scope of the present disclosure.

[0148] In another aspect of the present invention, the present invention proposes a kit. According to an embodiment of the present invention, the kit includes: the aforementioned antibody or antigen-binding fragment thereof; the aforementioned nucleic acid molecule; the aforementioned expression vector; or the aforementioned recombinant cell. As can be seen from the foregoing, the aforementioned antibody or antigen-binding fragment thereof has a high affinity with the PLA2R protein, can be stably and mass-produced, can exclude contamination by pathogenic microorganisms, and can be used as an anti-human PLA2R antibody standard. Therefore, the kit containing the above-mentioned antibody or antigen-binding fragment thereof has the advantage of high accuracy in detecting PLA2R antibodies.

[0149] In an optional embodiment of the present invention, the kit may further include a reagent for detecting PLA2R antibodies.

[0150] In another aspect of the present invention, the present invention proposes a use of the aforementioned antibody or antigen-binding fragment thereof, the aforementioned nucleic acid molecule, the aforementioned expression vector or the aforementioned recombinant cell in preparing a kit for detecting PLA2R antibodies or diagnosing PLA2R antibody-positive membranous nephropathy.

[0151] method

[0152] In another aspect of the present invention, the present invention proposes a method for detecting PLA2R antibodies. According to an embodiment of the present invention, the method comprises: based on the detection result of PLA2R antibodies, using the aforementioned antibody or its antigen-binding fragment as a PLA2R antibody standard product to determine the content of PLA2R antibodies in the sample to be tested. Thus, the accuracy of PLA2R antibody detection can be improved. As can be seen from the above, the aforementioned antibody or its antigen-binding fragment has a high affinity with PLA2R protein, can be stably and mass-produced, can exclude pathogenic microorganism contamination, and can be used as an anti-human PLA2R antibody standard product. Therefore, the method of the present invention has the advantages of high accuracy in detecting PLA2R antibodies.

[0153] In another aspect of the present invention, the present invention proposes a method for diagnosing PLA2R antibody-positive membranous nephropathy. According to an embodiment of the present invention, the method comprises: based on the detection result of PLA2R antibody in the sample to be tested, using the aforementioned antibody or its antigen-binding fragment as a PLA2R antibody standard product, so as to obtain the content of PLA2R antibody in the sample to be tested; based on the content of the PLA2R antibody, determining whether the patient corresponding to the sample to be tested suffers from PLA2R antibody-positive membranous nephropathy. Thus, the accuracy of PLA2R antibody detection can be improved. As can be seen from the foregoing, the aforementioned antibody or its antigen-binding fragment has a high affinity with the PLA2R protein, can be stably and mass-produced, can exclude pathogenic microorganism contamination, can be used as an anti-human PLA2R antibody standard product, and can accurately detect the content of PLA2R antibody. Thus, the method of the present invention has a high diagnostic accuracy for PLA2R antibody-positive membranous nephropathy.

[0154] The scheme of the present invention will be explained below in conjunction with the embodiments. It will be appreciated by those skilled in the art that the following embodiments are only used to illustrate the present invention and should not be considered as limiting the scope of the present invention. Where specific techniques or conditions are not indicated in the embodiments, the techniques or conditions described in the literature in this area or the product specifications are used. The reagents or instruments used are not indicated by the manufacturer and are all conventional products that can be obtained commercially.

[0155] Example 1: Preparation of the major antigenic region CC1H of PLA2R

[0156] 1.1 Construction of recombinant protein of the main antigenic region of PLA2R

[0157] The plasmid vector used is the pcDNA3.4 transient expression vector, which contains the native full-length CMV promoter and the WPRE element downstream of the cloning site. The vector based on the CMV promoter usually has a good expression level for the CHO cell transient expression system. The WPRE element is located downstream of the multiple cloning site, which can effectively improve the transcription and expression of the gene. In Escherichia coli, it has an ampicillin resistance gene. Then, the vector gene pcDNA3.4 is amplified by PCR technology and connected with the synthetic gene (the gene sequence connected to the target gene (gene of interest) and the signal peptide (signal peptide) is referred to as the synthetic gene). The PCR template is obtained by gene synthesis, and the pcDNA3.4 vector fragment and the synthetic gene fragment are connected by a homologous recombination kit. The DH5α competent cell is transformed to obtain a single clone, and the single clone is amplified and sequenced. After sequencing confirmation, the plasmid is extracted to obtain the synthetic gene recombinant expression plasmid. Among them, the synthetic gene is cloned between the CMV promoter and the WPRE gene of the plasmid pcDNA3.4. For details, see Figure 2 .

[0158] Among them, the amino acid sequence of the signal peptide is:

[0159] MLLSPSLLLLLLLGAPRGCA(SEQ ID NO:353);

[0160] The nucleotide sequence of the signal peptide is:

[0161] ATGCTGCTGTCGCCGTCGCTGCTGCTGCTGCTGCTGCTGGGGGCGCCGGGGCTGCGCC (SEQ ID NO: 354).

[0162] The structural diagram of PLA2R is shown in Figure 1 As shown, the target gene is the amino acid sequence 1 to 367 (Glu) of the PLA2R fragment. The constructed transient expression plasmid is named pcDNA3.4-CC1H.

[0163] The amino acid sequence of the synthetic gene (PLA2R major antigen region) is:

[0164] MLLSPSLLLLLLLGAPRGCAEGVAAALTPERLLEWQDKGIFVIQSESLKKCIQAGKSVLTLENCKQANKHMLWKWVSNHGLFNIGGSGCLGLNFSAPEQPLSLYECDSTLVSLRWRCNRKMITGPLQYSVQVAHDNTVVASRKYIHKWISYGSGGGDICEYLHKDLHTIKGNTHGMPCMFPFQYNHQWHHECTREGREDDLLWCATTSRYERDEKWGFCPDPTSAEVGCDTIWEKDLNSHICYQFNLLSSLSWSEAHSSCQMQGGTLLSITDETEENFIREHMSSKTVEVWMGLNQLDEHAGWQWSDGTPLNYLNWSPEVNFEPFVEDHCGTFSSFMPSAWRSRDCESTLPYICKKYLNHIDHEIVEGGHHHHHH(SEQ ID NO:355);

[0165] The nucleotide sequence of the synthetic gene (main antigen region of PLA2R) is:

[0166]

[0167] 1.2 Transient expression of CC1H

[0168] About 24 hours before transfection, take FreeStyle TM Cells (cell density 5-6×10 5 / mL, from FreeStyle, Gibco, USA TM MAX CHO Expression System, Catalog No.: K900020), cultured at 37°C, 5% CO2 and 120-135 rpm / min.

[0169] On the day of transfection, dilute the cells to a cell density of 1×10 6 / mL, add 10mL of cells to each shake flask (cell survival rate is above 95%).

[0170] Lightly blend FreeStyle TM Add MAX Reagent several times, being careful not to vortex.

[0171] Take pcDNA3.4-CC1H 12.5μg, add OptiPRO TM SFM to a total volume of 0.2 mL and mix gently.

[0172] Take 12.5 μL of FreeStyle TM MAX Reagent, added Opti-Pro TM Add SFM to a total volume of 0.2 mL and mix gently. Mix well and add to the plasmid mixture and mix gently to obtain 0.4 mL DNA-FreeStyle TM MAX mixture and incubate at room temperature for 10 min to allow complex formation.

[0173] Slowly add the above 0.4mL DNA-FreeStyle TM MAX complexes were added to the cells while slowly rotating the flask.

[0174] The cells were cultured at 37°C, 5% CO2 and 120-135 rpm / min without replacing or supplementing the culture medium. The cell culture supernatant was collected after 7 days.

[0175] 1.3 Purification and identification of CC1H

[0176] Sample: Take 25 mL of the cell culture supernatant from step 1.2. Centrifuge it at 4°C, 7000 rpm for 10 min, and filter through a 0.22 μm syringe filter. Apply to a Ni sepharose 6FF column at 2 mL / min. Elute with 20 mM phosphate buffer, 500 mM NaCl, and 20 mM imidazole at pH 6.8. Elute with 5 column volumes of 0-100% 20 mM phosphate buffer, 1 M NaCl, and 500 mM imidazole at pH 6.8. Collect 2 mL / tube.

[0177] The eluted peak was ultrafiltered three times in a 30kD ultrafiltration centrifuge tube, and the solution was replaced with 50mM phosphate buffer and 150mM NaCl, pH 7.4. Bradford method was used for quantification. The expression level of CC1H was measured to be 37mg / L. CC1H was analyzed by SDS-PAGE, and the analysis results are shown in Figure 3 shown.

[0178] Example 2: CC1H biotin labeling and humanized phage library screening

[0179] The biotin labeling of CC1H and the screening of humanized phage library were completed by Sanyou Biopharmaceuticals (Shanghai) Co., Ltd. CC1H was first labeled with biotin, and ELISA was used to confirm that CC1H was indeed labeled with biotin. Subsequently, the humanized recombinant antibody library constructed by Sanyou Biopharmaceuticals (Shanghai) Co., Ltd. was screened by solid-phase and liquid-phase cross-screening using immunotubes and magnetic bead screening instruments, and the specific Fab antibodies against CC1H were enriched by trypsin elution. The enrichment of different output sets was detected by ELISA, and most of the output sets with good enrichment were obtained at the ELISA level in this screening. After the initial ELISA screening, a total of 1748 clones were picked, and 834 positive clones that specifically bound CC1H were obtained, of which 98 were molecules with unique sequences, and 34 molecules (see P59365-P59376, P59378-P59399 in Table 1) were selected for full-length construction. These 34 molecules are IgG4 subtypes.

[0180] Nine antibodies with good affinity and expression level were selected at the phage level to construct IgG4SP subtype antibodies (see P62295-P62298, P62300-P62304 in Table 1, referred to as SP mutants).

[0181] A total of 43 antibodies were selected for expression (their amino acid sequences and nucleotide sequences are shown in the "Amino Acid Sequence Table of the Present Invention and the Nucleotide Sequence Table of the Present Invention" in the Summary of the Invention). The corresponding heavy chains and light chains were cloned between the CMV promoter and the WPRE gene of pcDNA3.4. CHO cells were transiently transfected and the expression level was detected (ExpiCHO Expression System Kit, ThermoFisher, Catalog No. A29133). The antibody numbers and expression levels are shown in Table 1.

[0182] Table 1: Antibody numbers and expression levels

[0183]

[0184]

[0185] Note: *IgG4SP is a point mutation of IgG4, which has an S228P mutation site in the hinge region, which increases the stability of the antibody.

[0186] Example 3: Human anti-human PLA2R antibody ELISA detection

[0187] The human anti-human PLA2R antibody after phage screening and expression in Example 2 was used to measure its binding to CC1h using the ELISA indirect method.

[0188] Add 30 μL CC1h (2 μg / mL, diluted with 1*PBS) to the reaction wells of the ELISA plate, seal the plate, and incubate at 4°C overnight; wash the plate 3 times with PBST and discard the liquid in the well; add 5% PBSM to block the ELISA plate at room temperature for 2 hours; wash the plate 3 times with PBST, add 30 μL Abs (diluted with 1*PBS) to each well of the ELISA plate, and incubate at room temperature for 60 minutes; wash the plate 3 times with PBST, add 30 μL anti-human IgG Fc HRP (diluted with 1% PBSM at a ratio of 1:8000) to each well, and incubate at room temperature for 60 minutes; add TMB and stop the reaction with 2M blocking solution and detect the OD value at 450nm. Recombinant Ipilimumab (Sanyou Biopharmaceuticals) was used as a negative control. The test results are shown in Tables 2 and Figure 4-5 .

[0189] Table 2: Binding activity of each antibody to CC1h

[0190] Protein name <![CDATA[EC 50 (ng / mL)]]> Protein name <![CDATA[EC 50 (ng / mL)]]> A2(P59365) 3.94 B67(P59388) 5.02 A5(P59366) 8.81 B83(P59389) 7.71 A8(P59367) 4.81 B88(P59390) - A13(P59368) 6.49 B90(P59391) 2.96 A21(P59369) 8.49 B109(P59392) 6.38 A22(P59370) - B114(P59393) 6.52 A23(P59371) 27.57 B117(P59394) 7.17 A26(P59372) 15.97 B123(P59395) 8.09 A44(P59373) 4.79 B145(P59396) - A53(P59374) 4.03 B156(P59397) 10.48 A61(P59375) 4.6 B201(P59398) 8.88 A67(P59376) 6.41 B307(P59399) 5.74 A156(P59378) 6.9 A2SP(P62295) 5.66 A187(P59379) 6.4 A5SP(P62296) 11.15 A378(P59380) 14.06 A13SP(P62297) 8.69 A382(P59381) 13.24 A61SP(P62298) 10.26 B16(P59382) 6.67 A156SP(P62300) 14.65 B20(P59383) 5.36 A187SP(P62301) 11.52 B24(P59384) 7.03 B88SP(P62302) 8.76 B29(P59385) 3.85 B90SP(P62303) 19.5 B44(P59386) - B156SP(P62304) 8.12 B53(P59387) 7.67

[0191] ELISA results showed that A22 (see Figure 4 A), B44 (see Figure 4 C), B88 (see Figure 4 C), B145 (see Figure 5A) These four antibodies did not bind to CC1h significantly, and the positive results in the phage library screening process may be false positives. The remaining antibodies all showed different binding strengths with CC1h. 50 The concentrations of the antibodies were between 3.85 ng / mL (B29) and 27.6 ng / mL (A23). The results showed that most of the antibodies specifically bound to CC1h.

[0192] Example 4: Kinetic and thermodynamic analysis of the interaction between antibodies and CC1H

[0193] Sartorius The N1 molecular interaction instrument detects the interaction between proteins and biomolecules, namely, the binding constant (Ka), dissociation constant (Kd) and affinity constant (KD) of the interaction between the 43 PLA2R human antibodies in Example 2 and biotin-labeled CC1H.

[0194] The specific experimental steps are as follows:

[0195] 4.1 Biotin labeling of CC1H

[0196] The CC1H protein purified in Example 1 was labeled with biotin using the EZ-Link Sulfo-NHS-LC-Biotin (ThermoScientific, 21335) kit, and the specific steps were as follows:

[0197] Equilibrate the kit to room temperature;

[0198] Prepare 10mM biotin reagent solution. For every 0.5mg of biotin reagent, add 90μL of sterile double distilled water to fully dissolve;

[0199] Add 20 times the molar number of the protein into the CC1H protein solution.

[0200] The system was placed on ice and incubated for 2 hours, during which time the system was inverted several times to ensure thorough mixing.

[0201] 4.2 Purification of CClH-Biotin

[0202] Use G-25 pre-packed desalting column (Borgron, EG001) to purify biotin-labeled CC1H-Biotin:

[0203] Prepare 20 mM PBS buffer at pH 7.2 according to Table 3;

[0204] Table 3: PBS buffer preparation table

[0205]

[0206] balance:

[0207] Use a 10mL syringe to draw PBS buffer, connecting the column and the syringe "drop by drop" each time to prevent bubbles;

[0208] Cut off the outlet end;

[0209] A total of 25 mL of PBS buffer was passed through the column at 5 mL / min (120 drops / min) to remove the ethanol in the column, and the column effluent was discarded;

[0210] Loading:

[0211] Use a 3mL syringe to load 1.5mL of sample at 5mL / min (if less than 1.5mL, use PBS buffer to make up), and discard the column effluent;

[0212] A further 3 mL of PBS buffer was injected; approximately 2 mL was collected in total.

[0213] Column cleaning and storage:

[0214] Use a 10mL syringe to pass 25mL of PBS buffer, then pass 25mL of water, and discard the column effluent;

[0215] Use a 10 mL syringe to pass 25 mL of 20% ethanol and store at 4°C;

[0216] Sample Storage:

[0217] The collected samples were sterilized by suction filtration using a 0.2 μm pore size filter and stored in aliquots.

[0218] 4.3 Bradford method (Biyuntian, P0060) to measure CC1H-Biotin protein concentration

[0219] The protein standard (5 mg / ml BSA) was completely melted and mixed, and then diluted with PBS buffer to prepare 0, 0.125, 0.25, 0.5, 0.75, 1, and 1.5 mg / ml protein standards and mixed thoroughly;

[0220] 5 μL of protein standards of different concentrations were added to the standard wells of a 96-well immunoplate (Thermo Scientific, 468667);

[0221] Take 5 μL of sample into the sample well of 96-well immunoplate (if less than 5 μL, add PBS buffer to make up);

[0222] Add 250 μL G250 staining solution to each well;

[0223] A595 was measured using a microplate reader;

[0224] The protein concentration in the sample was calculated based on the standard curve. Figure 6 , where y = 0.6849x + 0.6325, R 2 =0.9925.

[0225] After calculation, the concentration of CC1H-Biotin protein was 2.36 mg / mL.

[0226] 4.4 Identification of sample purity and concentration by reducing / non-reducing SDS-PAGE

[0227] The purity and concentration of the samples were identified by reducing / non-reducing SDS-PAGE. Figure 7 As shown, the lanes from left to right are CCIH-Biotin in reducing loading buffer containing DTT and CCIH-Biotin in non-reducing loading buffer.

[0228] The molecular weight of CC1H-Biotin is about 40KDa and the purity is >98%.

[0229] 4.5 Using Pierce TM Biotin Quantitation Kit(HABA assay)(Thermo Scientific TM , 28005) kit to detect biotin incorporation levels. Equilibrate the ABA / Avidin premix to room temperature;

[0230] Add 100 μL of ultrapure water to the HABA / Avidin premix tube and blow evenly with a pipette tip;

[0231] Add 160 μL of PBS buffer to the wells of a 96-well immunoplate (Thermo Scientific, 468667);

[0232] Add 20 μL of HABA / Avidin premixed solution to the wells containing PBS buffer, shake and mix, and then measure A500;

[0233] Add 20 μL of biotinylated sample to the well containing HABA / Avidin, shake and mix, and then measure A500 to keep it constant for at least 15 seconds;

[0234] The biotin incorporation level was calculated according to Beer's law. The results are shown in Table 4. The biotin incorporation level of CC1H-Biotin was calculated to be 1.80 mol Biotin / mol protein.

[0235] Table 4: Biotin incorporation levels

[0236]

[0237] 4.6 Interaction assay between CC1H-Biotin and human PLA2R antibody screened from phage library

[0238] Using Sartorius N1 molecular interaction instrument, select SA sensor (Sartorius, Streptavidin(SA)Biosensor, 18-5019):

[0239] The sensor was pre-wetted in PBSTB buffer (PBS buffer with 0.02% Tween-20 and 0.1% BSA) for >10 min and loaded onto the molecular interaction instrument;

[0240] The sensor was immersed in different buffers successively and tested using the 5-step method:

[0241] Baseline 1 (PBSTB buffer 300 μL, 1 min) -> Immobilization (CC1H-biotin, 20 μg / mL 300 μL, 2 min) -> Baseline 2 (PBSTB buffer, 3 min) -> Binding (76.6-8.5 nM PLA2R human antibody prepared in Example 2 diluted in gradient with PBSTB buffer 300 μL, 2 min) -> Dissociation (PBSTB buffer 300 μL, 5 min) (due to the ExpiCHO in the human antibody sample TM Expression medium, baseline 2 and dissociation PBSTB buffer containing the corresponding concentration of ExpiCHO TM Expression medium (Gibco, A2910001);

[0242] The binding constant (Ka), dissociation constant (Kd) and affinity constant (KD) were calculated, see Table 5 for details.

[0243] Table 5: Ka, Kd, ​​KD values ​​of CC1H-Biotin and PLA2R human antibody

[0244] Protein No. Protein name KD(M) ka(1 / Ms) kd(1 / s) <![CDATA[R 2 ]]> P59365 A2 1.04E-10 7.55E+05 7.86E-05 0.992 P59366 A5 4.55E-10 5.77E+05 2.63E-04 0.999 P59368 A13 5.80E-10 4.80E+05 2.78E-04 0.998 P59375 A61 1.78E-11 1.06E+06 1.89E-05 0.995 P59378 A156 1.58E-10 6.44E+05 1.02E-04 0.996 P59379 A187 2.04E-09 1.94E+05 3.95E-04 0.999 P59390 B88 2.11E-02 5.91E+04 1.25E+03 0.000 P59391 B90 8.407E-10 6.08E+05 5.12E-04 0.991 P59397 B156 2.42E-10 5.16E+05 1.25E-04 0.999 P62295 A2SP <1E-12 8.72E+05 <1E-7 0.989 P62296 A5SP 1.56E-09 3.04E+05 4.75E-04 0.999 P62297 A13SP 3.587E-10 4.06E+05 1.46E-04 0.998 P62298 A61SP 1.26E-10 6.48E+05 8.17E-05 0.999 P62300 A156SP 4.56E-10 3.71E+05 1.69E-04 0.999 P62301 A187SP 1.36E-09 1.67E+05 2.27E-04 0.999 P62302 B88SP 1.448E-10 5.56E+05 8.04E-05 0.998 P62303 B90SP 6.594E-09 9.70E+04 6.39E-04 0.981 P62304 B156SP <1E-12 6.54E+05 <1E-7 0.997

[0245] As can be seen from the above table, except for P59390 (B88), other antibodies for detecting molecular interactions all bind well to CC1H and can be used as PLA2R antibody standards.

[0246] Example 5: Calibration of PLA2R Antibody Standards

[0247] 5.1 Measurement conversion relationship

[0248] The titers of A13 (P59368) and A13SP (P62297) prepared in Example 2 at different dilutions were detected using the Euroimmun anti-PLA2R (IgG) kit (Euroimmun, EA 1254-9601G (96)), and the average value was used as the conversion relationship between RU and ng, see Table 6.

[0249] Table 6: Titer test results of A13 and A13SP at different dilutions

[0250]

[0251] The quantitative conversion relationship of A13 / A13SP is about 1RU=70ng. Draw the A13 / A13SP standard curve according to 1RU=70ng and compare it with the standard product of Euromon. Figure 8 .

[0252] Depend on Figure 8 It can be seen that in a very high concentration range (>750RU / mL), the A13 / A13SP standard curve is slightly different from the Euromon standard. This may be because the kit standard is a polyclonal antibody, which is a mixture of multiple antibodies with significantly different affinities. Therefore, its ELISA curve performance is different from that of the screened monoclonal antibodies.

[0253] 2. Comparison of standard curves

[0254] The 9 antibodies and their SP mutants prepared in Example 2 were obtained by screening using the Euromon ELISA kit (see Fig. 9 ) were compared with the standard sample in the kit.

[0255] The experimental steps are as follows:

[0256] Add 100 μL / well of standard samples 1-5, human antibody samples, and negative control, seal the plate, and incubate at room temperature (25°C) for 30 min;

[0257] Discard the liquid in the wells and place on a plate washer (Bio-Rad, ImmunoWash TM 1575 plate washer) with the matching plate washing solution for 4 times, centrifuge at 600g for 1 min on a plate spinner (Hettich, Universal 16R), and pat dry several times;

[0258] Add 100 μL of the matching enzyme conjugate to each well, seal the plate, and incubate at room temperature (25°C) for 30 min;

[0259] Repeat the plate wash;

[0260] Add 100 μL of the supporting substrate colorimetric solution to each well, incubate at room temperature (25°C) in the dark for 15 min, then add 100 μL of the supporting stop solution to each well and measure A450.

[0261] Test results see Fig. 9 , Fig. 9 The concentration unit of the screening antibody was converted to RU according to 1RU=70ng.

[0262] Depend on Fig. 9 A shows that P59390 (B88) cannot be detected by commercial kits, which is consistent with the results of CC1h ELISA and BLI analysis; other antibodies and their SP mutants are close to the standard curve of the European ELISA kit. Among them, the curve shape of the screened antibody is different from that of the kit standard, which may be because the kit standard is a polyclonal antibody, which is a mixture of multiple antibodies with significantly different affinities, so its ELISA curve performance is different from that of the screened monoclonal antibody.

[0263] In the description of this specification, the description with reference to the terms "one embodiment", "some embodiments", "example", "specific example", or "some examples" etc. means that the specific features, structures, materials or characteristics described in conjunction with the embodiment or example are included in at least one embodiment or example of the present invention. In this specification, the schematic representations of the above terms do not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described may be combined in any one or more embodiments or examples in a suitable manner. In addition, those skilled in the art may combine and combine the different embodiments or examples described in this specification and the features of the different embodiments or examples, without contradiction.

[0264] Although the embodiments of the present invention have been shown and described above, it is to be understood that the above embodiments are exemplary and are not to be construed as limitations of the present invention. A person skilled in the art may change, modify, replace and vary the above embodiments within the scope of the present invention.

Claims

1. An anti-PLA2R antibody or an antigen-binding fragment thereof, characterized in that: The antibody or antigen-binding fragment thereof comprises HCDR1, HCDR2, HCDR3, LCDR1, LCDR2, LCDR3; The amino acid sequence of the HCDR1 is shown in SEQ ID NO: 1, the amino acid sequence of the HCDR2 is shown in SEQ ID NO: 36, the amino acid sequence of the HCDR3 is shown in SEQ ID NO: 71, the amino acid sequence of the LCDR1 is shown in SEQ ID NO: 106, the amino acid sequence of the LCDR2 is shown in SEQ ID NO: 141, and the amino acid sequence of the LCDR3 is shown in SEQ ID NO: 176; or The amino acid sequence of the HCDR1 is shown in SEQ ID NO: 2, the amino acid sequence of the HCDR2 is shown in SEQ ID NO: 37, the amino acid sequence of the HCDR3 is shown in SEQ ID NO: 72, the amino acid sequence of the LCDR1 is shown in SEQ ID NO: 107, the amino acid sequence of the LCDR2 is shown in SEQ ID NO: 142, and the amino acid sequence of the LCDR3 is shown in SEQ ID NO: 177; or The amino acid sequence of the HCDR1 is shown in SEQ ID NO:4, the amino acid sequence of the HCDR2 is shown in SEQ ID NO:39, the amino acid sequence of the HCDR3 is shown in SEQ ID NO:74, the amino acid sequence of the LCDR1 is shown in SEQ ID NO:109, the amino acid sequence of the LCDR2 is shown in SEQ ID NO:144, and the amino acid sequence of the LCDR3 is shown in SEQ ID NO:

179.

2. The antibody or antigen-binding fragment thereof according to claim 1, characterized in that: The antibody or antigen-binding fragment thereof specifically recognizes the CysR, FNII and CTLD1 domains in the PLA2R protein.

3. The antibody or antigen-binding fragment thereof according to claim 1, characterized in that: The antibody or antigen-binding fragment thereof further comprises: At least one of a heavy chain framework region sequence and a light chain framework region sequence; Wherein, at least a portion of at least one of the heavy chain framework region sequence and the light chain framework region sequence is derived from at least one of a murine antibody, a human antibody, a primate antibody or a mutant thereof.

4. The antibody or antigen-binding fragment thereof according to claim 3, characterized in that: At least a portion of the heavy chain framework region sequence and the light chain framework region sequence are derived from a human antibody or a mutant thereof.

5. The antibody or antigen-binding fragment thereof according to claim 1, characterized in that: The antibody or antigen-binding fragment thereof comprises VH and VL; The amino acid sequence of the VH is shown in SEQ ID NO: 211, and the amino acid sequence of the VL is shown in SEQ ID NO: 246; or The amino acid sequence of the VH is shown in SEQ ID NO: 212, and the amino acid sequence of the VL is shown in SEQ ID NO: 247; or The amino acid sequence of the VH is shown in SEQ ID NO: 214, and the amino acid sequence of the VL is shown in SEQ ID NO:

249.

6. The antibody or antigen-binding fragment thereof according to claim 1, characterized in that: The antibody contains at least one of a heavy chain constant region and a light chain constant region, and at least a portion of at least one of the heavy chain constant region and the light chain constant region is derived from at least one of a murine antibody, a human antibody, a primate antibody or a mutant thereof.

7. The antibody or antigen-binding fragment thereof according to claim 6, characterized in that: The heavy chain constant region comprises a heavy chain constant region selected from IgG1, IgG2, IgG3, IgG4, IgA, IgM, IgE or IgD; or The light chain constant region comprises a light chain constant region selected from a kappa-type or a lambda-type.

8. The antibody or antigen-binding fragment thereof according to claim 6, characterized in that: The light chain constant region and the heavy chain constant region are both derived from human IgG4 antibody or its mutants.

9. The antibody or antigen-binding fragment thereof according to claim 6, characterized in that: The heavy chain constant region is wild-type human IgG4 or a human IgG4 mutant.

10. The antibody or antigen-binding fragment thereof according to claim 9, characterized in that: Compared with the heavy chain constant region of the wild-type human IgG4 antibody, the human IgG4 mutant has an S228P site mutation.

11. The antibody or antigen-binding fragment thereof according to claim 6, characterized in that: The heavy chain constant region has the amino acid sequence shown in SEQ ID NO: 281 or SEQ ID NO:

282.

12. The antibody or antigen-binding fragment thereof according to claim 6, characterized in that: The light chain constant region has the amino acid sequence shown in SEQ ID NO:

357.

13. The antibody or antigen-binding fragment thereof according to claim 1, characterized in that: The antibody or antigen-binding fragment thereof comprises: A heavy chain having an amino acid sequence as shown in SEQ ID NO: 283, and a light chain having an amino acid sequence as shown in SEQ ID NO: 318; or A heavy chain having an amino acid sequence as shown in SEQ ID NO: 358, and a light chain having an amino acid sequence as shown in SEQ ID NO: 318; or A heavy chain having an amino acid sequence as shown in SEQ ID NO: 284, and a light chain having an amino acid sequence as shown in SEQ ID NO: 319; or A heavy chain having an amino acid sequence as shown in SEQ ID NO: 359, and a light chain having an amino acid sequence as shown in SEQ ID NO: 319; or A heavy chain having an amino acid sequence as shown in SEQ ID NO: 286, and a light chain having an amino acid sequence as shown in SEQ ID NO: 321; or The heavy chain has an amino acid sequence as shown in SEQ ID NO:360, and the light chain has an amino acid sequence as shown in SEQ ID NO:

321.

14. The antibody or antigen-binding fragment thereof according to claim 1, characterized in that: The antibody is selected from at least one of a monoclonal antibody, a polyclonal antibody, a multimeric antibody and a CDR-grafted antibody.

15. The antibody or antigen-binding fragment thereof according to claim 1, characterized in that: The antibody is selected from at least one of a single-chain antibody, a Fab antibody, a Fab' antibody, a F(ab')2 antibody, a Fv antibody, and a single-chain antibody.

16. The antibody or antigen-binding fragment thereof according to claim 1, characterized in that: The antigen binding fragment includes at least one of a Fab fragment, a Fab' fragment, a F(ab)2 fragment, a F(ab')2 fragment, a Fv fragment, a scFv fragment, a scFv-Fc fusion protein, and a scFv-Fv fusion protein.

17. A nucleic acid molecule, characterized in that The nucleic acid molecule encodes the antibody or antigen-binding fragment thereof according to any one of claims 1 to 16.

18. The nucleic acid molecule according to claim 17, characterized in that The nucleic acid molecule is DNA.

19. An expression vector, characterized in that: Carrying the nucleic acid molecule according to any one of claims 17 to 18.

20. The expression vector according to claim 19, characterized in that The expression vector is a eukaryotic expression vector or a prokaryotic expression vector.

21. The expression vector according to claim 19, characterized in that The expression vector is a plasmid expression vector.

22. A recombinant cell, characterized in that The recombinant cell: Carrying the nucleic acid molecule according to any one of claims 17 to 18; or, Expressing the antibody or antigen-binding fragment thereof according to any one of claims 1 to 16.

23. The recombinant cell according to claim 22, characterized in that The recombinant cell is obtained by introducing the expression vector according to any one of claims 19 to 21 into a host cell.

24. The recombinant cell according to claim 22, characterized in that The recombinant cell is a eukaryotic cell.

25. The recombinant cell according to claim 22, characterized in that The recombinant cell is a mammalian cell.

26. Use of the antibody or antigen-binding fragment thereof according to any one of claims 1 to 16, the nucleic acid molecule according to any one of claims 17 to 18, the expression vector according to any one of claims 19 to 21, or the recombinant cell according to any one of claims 22 to 25 in the preparation of a PLA2R antibody standard.

27. A kit, characterized in that include: The antibody or antigen-binding fragment thereof according to any one of claims 1 to 16; The nucleic acid molecule according to any one of claims 17 to 18; The expression vector according to any one of claims 19 to 21; or The recombinant cell according to any one of claims 22 to 25.

28. Use of the antibody or antigen-binding fragment thereof according to any one of claims 1 to 16, the nucleic acid molecule according to any one of claims 17 to 18, the expression vector according to any one of claims 19 to 21, or the recombinant cell according to any one of claims 22 to 25 in the preparation of a kit for detecting PLA2R antibodies or diagnosing PLA2R antibody-positive membranous nephropathy.

Images