Use of serum tsRNA in preparation of non-small cell lung cancer early diagnosis or detection reagent

Through the fluorescence quantitative PCR detection of the serum tsRNA-Asp-5-0013 marker, the problem of early diagnosis of non-small cell lung cancer has been solved, and a high-sensitivity and high-specificity diagnostic effect has been achieved, which can accurately distinguish the pathological stage of the tumor.

CN118360399BActive Publication Date: 2025-10-17NINGBO UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202410471554.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-04-19
Publication Date
2025-10-17
Estimated Expiration
2044-04-19

AI Technical Summary

Technical Problem

Existing technologies make it difficult to achieve early diagnosis of non-small cell lung cancer, and traditional screening methods are highly invasive or costly, making them unsuitable for early screening.

Method used

Serum tsRNA-Asp-5-0013 was used as a diagnostic marker. Its expression was detected by fluorescence quantitative PCR. Specific primers were designed for amplification for the early diagnosis of non-small cell lung cancer and tumor pathological staging.

Benefits of technology

It achieves high-sensitivity and high-specificity early diagnosis of non-small cell lung cancer, can distinguish pathological stages such as tumor size, lymph node metastasis and distant metastasis, and improves the accuracy and efficiency of diagnosis.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118360399B_ABST
    Figure CN118360399B_ABST
Patent Text Reader

Abstract

The application discloses application of serum tsRNA in preparation of a non-small cell lung cancer early diagnosis or detection reagent, and is characterized in that the serum tsRNA is tsRNA-Asp-5-0013 sequence, the stem loop structure reverse transcription primer sequence is CACTCAACAGACCTGCACGAGCACGAC AGTCACAAGAGGTGCAGGTCTGT, the fluorescence quantitative PCR specific amplification upstream primer is GAGAACACTGACAGCACGAG, and the downstream primer is CCTTCCTCGTTAGTATAGT. The application also provides application of the serum tsRNA in preparation of non-small cell lung cancer and benign tumor, tumor size, non-small cell lung cancer N0 and N1-3 stage, M0 and M1 stage and TNM stage diagnosis, and has high specificity and sensitivity.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the field of molecular biology, and particularly relates to application of serum tsRNA in preparation of a non-small cell lung cancer early diagnosis or detection reagent. BACKGROUND

[0002] Lung cancer is the most common cause of cancer death worldwide, with about 1.6 million people dying from lung cancer every year, 85% of which are non-small cell lung cancer (NSCLC). According to statistics, the five-year survival rate of lung cancer patients is only 20%-30%, and one of the reasons for such a low survival rate is that lung cancer is often diagnosed in the late stage. Although great progress has been made in gene diagnosis and targeted therapy of NSCLC in recent years, the prognosis of patients is still poor due to low early diagnosis rate and high risk of recurrence. Current lung cancer diagnosis includes different types of imaging examination, supplemented by pathological evaluation of biopsy, gene diagnosis, etc., but these screening methods are invasive or have high examination costs, and are not suitable for early screening of lung cancer. Therefore, finding new non-invasive markers with high sensitivity and specificity to improve the level of early diagnosis of lung cancer has important clinical significance for improving the survival rate of lung cancer.

[0003] Transfer RNA (tRNA)-derived small RNA (tsRNA) is a new type of non-coding small RNA, which is cut from tRNA by enzymes to regulate gene expression at the transcription and translation levels. tRNA can be specifically cut into many small fragments by various enzymes. tsRNA is mainly divided into tRNA-derived RNA fragments (tsRNA) and tRNA halves. Similar to other non-coding RNAs, tsRNA has tissue specificity and relative stability. tsRNA can regulate gene expression at the transcription and translation levels, and is widely involved in the pathogenesis and progression of various diseases, including immune disorders, metabolic disorders and the development of malignant tumors. In recent years, more and more tumor-related tsRNAs have been found, and their roles in cancer have been revealed. tsRNA is widely enriched in various biological fluids, making them a class of high-quality biomarkers, and they are expected to become new markers for tumor diagnosis. SUMMARY

[0004] The technical problem to be solved by the present application is to provide a serum tsRNA for preparing a non-small cell lung cancer early diagnosis or detection reagent, which has high specificity and sensitivity. The serum tsRNA diagnosis marker is positively correlated with the prevalence of non-small cell lung cancer.

[0005] The application solves the above technical problems by adopting the technical scheme of application of serum tsRNA in preparation of a non-small cell lung cancer early diagnosis or detection reagent, wherein the serum tsRNA is tsRNA-Asp-5-0013, and the nucleotide sequence of the tsRNA-Asp-5-0013 is TCCTCGTTAGTATAGTGGTGAGT.

[0006] Further, the stem loop structure reverse transcription primer sequence of the serum tsRNA-Asp-5-0013 is CACTCAACAGACCTGCACGAGCACGACAGTCACAAGAGGTGCAGGTCTGT.

[0007] Further, the fluorescence quantitative PCR specific amplification upstream primer sequence of the tsRNA-Asp-5-0013 is 5'-GAGAACACTGACAGCACGAG-3', and the downstream primer sequence is 5'-CTCCCTCTCCTCGTTAGTA-3'. The primer can be used to specifically detect the expression of the serum tsRNA-Asp-5-0013, and the detection result can be quickly, simply, intuitively and cheaply obtained by using a conventional fluorescence quantitative PCR method, so as to make a judgment.

[0008] The application further provides application of the above serum tsRNA in a non-small cell lung cancer diagnosis or detection target drug and kit.

[0009] The application further provides application of the above serum tsRNA in preparation of a non-small cell lung cancer and lung benign tumor diagnosis or detection reagent.

[0010] The application further provides application of the above serum tsRNA in preparation of a non-small cell lung cancer tumor size diagnosis or detection reagent, wherein the tumor size is divided into less than 5 cm and greater than or equal to 5 cm.

[0011] The application further provides application of the above serum tsRNA in preparation of a non-small cell lung cancer N0 and N1-3 stage diagnosis or detection reagent, wherein the NO stage is no lymph node metastasis, and the N1-3 stage is lymph node metastasis.

[0012] The application further provides application of the above serum tsRNA in preparation of a non-small cell lung cancer M0 and M1 stage diagnosis or detection reagent, wherein the MO stage is no distant metastasis, and the M1 stage is distant metastasis.

[0013] The application further provides application of the above serum tsRNA in preparation of a non-small cell lung cancer TNM staging I-II stage and III-IV stage diagnosis or detection reagent.

[0014] Compared with the prior art, the application has the advantages that the application provides application of serum tsRNA in early diagnosis or detection of non-small cell lung cancer and tumor pathological staging, and discloses serum tRF: tsRNA-Asp-5-0013 for early diagnosis or detection of non-small cell lung cancer for the first time. The tsRNA-Asp-5-0013 marker is highly expressed in serum of non-small cell lung cancer patients, and the expression amount thereof is positively correlated with non-small cell lung cancer. By detecting the tsRNA-Asp-5-0013 in serum through serum samples collected conveniently, non-small cell lung cancer can be diagnosed and tumor pathological staging can be performed at a molecular level conveniently, quickly and efficiently, and the application has high specificity, high sensitivity, strong pertinence, good reliability, more accurate results, high early diagnosis rate of NSCLC, more opportunities for early treatment of patients, and great and innovative application prospects. BRIEF DESCRIPTION OF DRAWINGS

[0015] Figure 1 is a standard curve of tsRNA-Asp-5-0013;

[0016] Figure 2 is a sequencing result of tsRNA-Asp-5-0013;

[0017] Figure 3 is expression of serum tsRNA-Asp-5-0013 in NSCLC cases, Pneumonia cases, Benign cases and Healthy cases;

[0018] Figure 4 is an ROC curve of serum tsRNA-Asp-5-0013 for distinguishing benign tumors and malignant tumors;

[0019] Figure 5 is expression of serum tsRNA-Asp-5-0013 in NSCLC with tumor size less than 5 cm and greater than 5 cm;

[0020] Figure 6 is expression of serum tsRNA-Asp-5-0013 in N0 stage and N1-3 stage;

[0021] Figure 7 is expression of serum tsRNA-Asp-5-0013 in M0 stage and M1 stage;

[0022] Figure 8 is expression of serum tsRNA-Asp-5-0013 in I-II stage and III-IV stage. DETAILED DESCRIPTION

[0023] The application will be described in further detail below with reference to the drawings. Specific embodiment one

[0025] Screening of serum tsRNA markers

[0026] In April 2023, we randomly selected samples from the clinical laboratory of Li Huiyi Hospital Affiliated to Ningbo University before surgery or treatment as serum marker screening samples. In this study, each subject filled out an informed consent form, and their blood was required for research. All blood sampling was approved by the Clinical Research Ethics Committee of the Medical Department of Ningbo University and complied with the principles of the Helsinki Declaration.

[0027] To screen NSCLC-related tsRNA, we used Trizol reagent (Invitrogen, USA) to isolate RNA (concentration ≥ 200 ng / μL, total amount ≥ 10 μg, OD260 / 280 between 1.8-2.2) from serum samples of 4 healthy individuals and 4 NSCLC patients. Subsequently, 8 isolated RNA samples were sequenced on a small RNA sequencing platform, and the most significantly different tsRNA-Asp-5-0013 was screened as a predicted candidate marker for the possibility of non-small cell lung cancer diagnosis or detection according to the P value and fold change value. Obtain the 5'-3' sequence of tsRNA-Asp-5-0013 by tsRFun (https: / / rna.sysu.edu.cn / tsRFun / index.php): TCCTCGTTAGTATAGTGGTGAGT.

[0028] The above method for extracting RNA from serum is as follows: To do this, we first pipette 400 μL of serum into a 1.5 mL enzyme-free EP tube, centrifuge at 2000 g for 30 minutes at 4°C, and after centrifugation, pipette 350 μL of supernatant into a new 2 mL enzyme-free EP tube, add 1 mL of Trizol reagent (Thermo Fisher Scientific, USA), add 200 μL of chloroform (ChemMall, China) after lysis on ice for 3 min, and incubate on ice for 5 min. Next, centrifuge the mixture at 12000 g for 15 min at 4°C. Pipette the supernatant into a new 1.5 mL EP tube, add 500 μL of isopropanol (ChemMall, China), mix well by inverting, and incubate on ice for 10 min. Next, centrifuge at 12000 g for 10 min at 4°C. Take the precipitate, wash the precipitate twice with 1 mL of 75% ethanol, and finally dissolve with 50 μL of nuclease-free water to obtain the RNA extraction solution, which is stored at -80°C for future use. The RNA concentration is measured on a NanoDrop spectrophotometer (NanoDrop TMOne, Thermo Fisher Scientific, USA) was measured. Specific Embodiment Two

[0030] 1. Collection of clinical samples

[0031] With the approval of the hospital ethics committee and the informed consent of the patients, the serum samples of NSCLC (n=130), benign lung tumor (n=37), and pneumonia (n=40) patients before surgery or treatment were randomly selected from the clinical laboratory of Li Hui-Li Hospital Affiliated to Ningbo University from mid-2022 to the end of 2023. Forty-six serum samples from healthy people without a history of tumor were taken from Ningbo City Kangning Hospital Affiliated to Ningbo Medical College. The above samples were used as verification samples, and the clinical characteristics (age, gender, smoking status, histological subtype, TNM stage, lymph node metastasis, distant metastasis, tumor size, etc.) of all patients involved in the study are shown in Table 1.

[0032] Table 1. Serum samples and corresponding clinical parameters in this study

[0033]

[0034]

[0035]

[0036] 2. Primer design

[0037] Design of tsRNA primers: We first obtained the tsRNA-Asp-5-0013-5' sequence (TCCTCGTTAGTATAGTGGTGAGT) by tsRFun (https: / / rna.sysu.edu.cn / tsRFun / index.php). The specific stem-loop structure reverse transcription primer sequence was designed as: 3'-CACTCAACAGACCTGCACGAGCACGACAGTCACAAGAGGTGCAGGTCTGT-5'. First, the target tsRNA-Asp-5-0013 fragment was combined with the reverse transcription primer by annealing reaction; then, the template for qPCR was extended by reverse transcription reaction; finally, the amplification of the target tsRNA-Asp-5-0013 was achieved by using a pair of amplification primers. The specific amplification upstream primer sequence for fluorescent quantitative PCR was 5'-GAGAACACTGACAGCACGAG-3', and the downstream primer sequence was 5'-CTCCCTCTCCTCGTTAGTA-3'. Then, the specificity of the designed primer was verified by using the BLAST primer tool in NCBI. The specificity of the tsRNA product was verified by observing the melting curve after tsRNA amplification and agarose gel electrophoresis using real-time quantitative polymerase chain reaction (qRT-PCR). All primers were synthesized by Beijing Genomics Institute (China).

[0038] 3. cDNA synthesis

[0039] According to the manufacturer's recommendations, use ReverTra Ace qPCR RT Master Mix and gDNA Wiper (TOYOBO, Japan) to synthesize cDNA using Life Touch TC-96 / G / H (b) b (Bioer, China) PCR equipment. The specific experimental steps are as follows:

[0040] (1) Genomic DNA removal

[0041] Prepare the genomic DNA removal reaction system in the RNase-free centrifuge tube as follows: 2 μL 5×gDNA Wiper Mix, 8 μL RNA extraction solution (see Specific Example One for extraction method), mix well after preparation, and react at 42°C for 2 minutes.

[0042] (2) First-strand cDNA synthesis

[0043] Prepare the following mixture in an RNase-free centrifuge tube:

[0044] Table 2 Reverse transcription reaction system

[0045]

[0046]

[0047] After configuration, mix well and react at the following temperatures: 25°C for 5 min; 50°C for 15 min; and 85°C for 5 min. After the reaction is completed, the product can be stored at -20°C.

[0048] 4. The tsRNA selected in this study was quantified by qRT-PCR

[0049] qRT-PCR reaction system: SYBR Green buffer (Yeasen Biotech, China), 5 μL; 10 μM upstream primer, 0.5 μL; 10 μM downstream primer, 0.5 μL; cDNA template, 1 μL; sterile enzyme-free water, 3 μL.

[0050] After the solution is configured, react at the following temperatures: 95°C for 10 min; 95°C for 15 s, 60°C for 30 s, and 72°C for 30 s, for 40 cycles; and finally store at 4°C. Perform on a Mastercycler gradient (Vaudaux-Eppendorf, Germany) instrument.

[0051] 5. Standard curve preparation

[0052] (1) Construct a plasmid standard of known concentration, and measure the OD TM of the plasmid stock solution on a NanoDrop spectrophotometer (NanoDrop 260 One, ThermoFisher Scientific, USA).

[0053] (2) Dilute the standard plasmid stock solution by 10 times in 12 gradients. Calculate the ct value at the corresponding concentration by the formula

[0054] (3) Measure the ct value of the diluted plasmid solution by qRT-PCR, and the qRT-PCR reaction system is shown in step 4.

[0055] (4) Take 6 gradient concentrations to draw the R 2 greater than or equal to 0.999 standard curve linear equation y = -kigx + b, where x is the number of copies per microliter of cDNA.

[0056] (5) The specificity of qRT-PCR product was evaluated by standard curve. The ct value of unknown serum sample was compared with the standard curve to get the corresponding copy number x, multiplied by 20 to get the gene copy number in 8 microliters of RNA extract, divided by 8 / 50 and then divided by 350 to get the gene copy number per microliter of serum. The standard curve constructed by plasmid standard is shown in Figure 1 , it can be seen that the logarithmic value of copy number is negatively correlated with ct value, and the fitting degree is good R Figure 1 = 0.9992. 2

[0057] 6、Sanger sequencing

[0058] We want to confirm that the tsRNA amplified by the designed primer is the required tsRNA-Asp-5-0013. We sent the PCR product after qRT-PCR to Beijing Genomics institute (China) for Sanger sequencing, compared the tsRNA sequence and analyzed the splicing site of tsRNA to determine the accuracy of tsRNA. The sequencing results are shown in Figure 2 , by Sanger sequencing of the PCR product after qRT-PCR, the amplified product was successfully identified as the fragment of the tsRNA-Asp-5-0013 marker.

[0059] 7、Statistical analysis

[0060] Statistical analysis was performed using SPSS 26.0 software package (SPSS Inc., Chicago, USA) and GraphPad Prism 8.0 (GraphPad Software, USA). After transforming the relative level of tsRNA into normal distribution, ANOVA and Tukey's HSD test were used to analyze the statistical differences of tsRNA levels in healthy group, pneumonia group, benign pulmonary tumor group and non-small cell lung cancer group. In order to compare the levels of tsRNA-Asp-5-0013 between different subgroups (tumor less than 5 cm and greater than or equal to 5 cm, N0 and N1-3 stage, M0 and M1, I-II stage and III-IV stage), we used non-parametric Mann-Whitney U test. The diagnostic ability of tsRNA was detected by receiver operating characteristic (ROC) curve, and the area under the curve (AUC) was calculated. P<0.05 was statistically significant, and P values were all two-sided.

[0061] 8、Research results

[0062] ​To investigate the diagnostic potential of tsRNA-Asp-5-0013 in NSCLC patients, we quantified the expression level of serum tsRNA-Asp-5-0013 in four sample groups of healthy people, pneumonia, benign lung tumor and non-small cell lung cancer. Then, we compared the expression level of tsRNA-Asp-5-0013 among different groups (tumor less than 5 cm and greater than or equal to 5 cm, N0 and N1-3 stage, M0 and M1 stage, I-II stage and III-IV stage). At the same time, ROC analysis was performed to evaluate the sensitivity and specificity of tsRNA-Asp-5-0013 in distinguishing lung benign tumor and NSCLC, and the results are shown in Figures 3-7 .

[0063] As shown in Figure 3 , the expression level of serum tsRNA-Asp-5-0013 in NSCLC patients is higher than that in healthy people, pneumonia patients and benign tumor patients, and there is a significant difference in the expression level of serum tsRNA-Asp-5-0013 between NSCLC patients and healthy people, pneumonia patients and benign tumor patients; for the differentiation of lung benign tumor and NSCLC, ROC curve analysis found that the AUC area of the gene expression level of tsRNA-Asp-5-0013 was 0.781, and its sensitivity and specificity were 0.723 and 0.811, respectively, as shown in Figure 4 .

[0064] As shown in Figure 5 , the expression level of serum tsRNA-Asp-5-0013 in NSCLC patients is significantly lower than that in NSCLC patients with tumor greater than 5 cm. As shown in Figure 6 , the expression level of serum tsRNA-Asp-5-0013 in NSCLC patients in N1-3 stage is significantly higher than that in N0 stage. As shown in Figure 7 , the expression level of serum tsRNA-Asp-5-0013 in NSCLC patients in M1 stage is significantly higher than that in M0 stage. As shown in Figure 8 , the expression level of serum tsRNA-Asp-5-0013 in NSCLC patients in III-IV stage is significantly higher than that in I-II stage.

[0065] Therefore, we concluded that tsRNA-Asp-5-0013 can distinguish lung benign tumors and NSCLC. At the same time, by detecting tsRNA-Asp-5-0013 in different subgroups (tumor less than 5 cm and greater than or equal to 5 cm, N0 and N1-3, M0 and M1, I-II and III-IV), we found that tsRNA-Asp-5-0013 can better distinguish NSCLC less than 5 cm and greater than or equal to 5 cm, N0 and N1-3, M0 and M1, I-II and III-IV.

[0066] In summary, this study found a tsRNA-Asp-5-0013 associated with NSCLC. By quantifying tsRNA-Asp-5-0013 by qRT-PCR, the relative levels of tsRNA-Asp-5-0013 in the serum of four study cohorts (healthy, pneumonia, benign lung tumors, and non-small cell lung cancer) were compared. We found that tsRNA-Asp-5-0013 was abnormally expressed in the serum of NSCLC patients, and had the ability to distinguish between lung benign tumors and NSCLC. The expression levels of the tsRNA-Asp-5-0013 in different subgroups (tumor less than 5 cm and greater than or equal to 5 cm, N0 and N1-3, less than 5 cm and greater than or equal to 5 cm, N0 and N-3, M0 and M1, I-II and III-IV) were compared, and we found that tsRNA-Asp-5-0013 can better distinguish NSCLC tumor size, N0 and N-3, M0 and M1, I-II and III-IV.

[0067] The above description is not a limitation of the present application, and the present application is not limited to the above examples. Changes, modifications, additions or substitutions made by those skilled in the art within the spirit and scope of the present application should also be within the protection scope of the present application.

Claims

1. Use of a reagent for detecting the expression level of serum tsRNA in the preparation of an early diagnosis reagent for non-small cell lung cancer, characterized in that: The serum tsRNA is tsRNA-Asp-5-0013, and the nucleotide sequence of the tsRNA-Asp-5-0013 is TCCTCGTTAGTATAGTGGTGAGT.

2. Use of the reagent for detecting the expression level of serum tsRNA according to claim 1 in the preparation of a reagent for early diagnosis of non-small cell lung cancer, characterized in that: The stem-loop structure reverse transcription primer sequence of the serum tsRNA-Asp-5-0013 is: CACTCAACAGACCTGCACGAGCACGACAGTCACAAGAGGTGCAGGTCTGT.

3. Use of the reagent for detecting the expression level of serum tsRNA according to claim 2 in the preparation of a reagent for early diagnosis of non-small cell lung cancer, characterized in that: The upstream primer sequence of the fluorescent quantitative PCR specific amplification of tsRNA-Asp-5-0013 is 5'-GAGAACACTGACAGCACGAG-3', and the downstream primer sequence is 5'-CTCCCTCTCCTCGTTAGTA-3'.

4. Use of the reagent for detecting the expression level of serum tsRNA according to any one of claims 1 to 3 in preparing a kit for early diagnosis of non-small cell lung cancer.

Citation Information

Patent Citations

  • Use of reagent for detecting pir-hsa-120522 in plasma in preparation of lung cancer screening or diagnosis kit

    WO2023273623A1