Method for detecting a variation in a target base sequence of a nucleic acid, method for selectively inhibiting amplification of a nucleic acid, and kit for carrying out the same

Abstract

The present invention aims to provide a simple method and a kit for implementing the method, which can detect mutant genes at a mutant gene content rate lower than the detection limit of mutant genes by the clamp-PCR method. In addition, the present invention aims to provide a simple method and a kit for implementing the method, which can selectively inhibit the amplification of a base sequence as a target in a nucleic acid amplification reaction. In the nucleic acid amplification reaction, an amphiphilic copolymer having an amino group-containing cationic structural unit (1) and anionic structural unit (2), wherein the molar ratio of the cationic structural unit (1) to the anionic structural unit (2) (cationic structural unit (1) / anionic structural unit (2)) is in the range of 0.13 to 1.62, is allowed to coexist with a clamp nucleic acid, thereby enhancing the inhibition of amplification of a nucleic acid having a base sequence complementary to the clamp nucleic acid.

Description

[Technical field]

[0001] The present invention relates to a method for detecting a variation in a target base sequence of a nucleic acid in a sample relative to a standard base sequence, a method for selectively inhibiting amplification of a nucleic acid having the target base sequence in a nucleic acid amplification reaction, and a kit for carrying out the same. More specifically, the present invention relates to a method for detecting a variation in a target base sequence relative to a standard base sequence by carrying out nucleic acid amplification in the presence of a specific amphiphilic copolymer in a nucleic acid amplification reaction using a clamp nucleic acid (sometimes also referred to as a blocker nucleic acid), a method for selectively inhibiting amplification of a nucleic acid having the target base sequence, and a kit for carrying out the same. [Background technology]

[0002] Gene mutations may be the cause of cancer, and it is expected that early detection of such gene mutations will be associated with early treatment of cancer. In addition, it is known that the mutation of a specific gene is closely related to the susceptibility to a certain disease, the therapeutic effect of the drug, the strength of the side effects, etc. For example, it is known that gefitinib (trade name: Iressa), a tyrosine kinase inhibitor of epidermal growth factor receptor (EGFR), has a great effect in a part of lung cancer patients with a specific gene mutation, and causes severe interstitial pneumonia in about 0.5% of patients (non-patent document 1). In addition, it is known that in colorectal cancer, if the KRAS gene is mutated, the efficacy of the molecular target drug cetuximab (trade name: Erbitux) is low, and if there is no mutation, the efficacy is high. Therefore, as long as the efficacy or side effects can be predicted for each patient, it is possible to control the administration to patients who cannot expect efficacy or patients who are expected to have severe side effects, and to carry out effective treatment with few side effects.

[0003] From this, it is recognized that clarifying gene mutations is important for early detection of cancer and improvement of treatment efficiency, and various technologies for detecting gene mutations are being developed to meet such needs. In particular, significant progress has been seen in gene amplification technologies such as PCR and overall gene analysis technologies such as NGS.

[0004] Of course, the genes extracted from tumor specimens contain a large amount of wild-type genes and a small amount of mutant genes. Conventional methods for detecting mutant genes still often lack sufficient sensitivity for detecting a small amount of mutant genes. For example, one of the methods for detecting gene mutations is a method of non-selectively amplifying mutant genes and wild-type genes and then distinguishing mutant genes from wild-type genes by electrophoresis or hybridization. However, in this method, it is difficult to detect a very small amount of mutant genes contained in a wild-type gene with sufficient sensitivity and accuracy.

[0005] In contrast, a so-called "clamp method" has been developed, which uses an artificial oligonucleotide having a base sequence complementary to a reference sequence of a wild-type gene to suppress amplification of a wild-type gene and selectively amplify a mutant gene during the gene amplification stage. The artificial nucleic acid used in this method is called a clamp nucleic acid, which has the following characteristics: (i) strongly hybridizes with a wild-type gene, (ii) does not strongly hybridize with a mutant gene, and (iii) is difficult to decompose during the nucleic acid amplification process. When using it to perform real-time PCR, the frequency of detecting a mutant gene can be changed to 1%, and when using the amplification product of real-time PCR as a template to perform direct sequencing, it is considered that the frequency of detecting a mutant gene can be changed to 0.1% (for example, Patent Document 1, Non-Patent Document 2, Non-Patent Document 3). As sandwich nucleic acids, peptide nucleic acids (PNA), locked nucleic acids (LNA) and bridged nucleic acids (BNA) have been developed, and amplification methods such as the PNA-LNA sandwich PCR method and the BNA sandwich PCR method have been developed (see, for example, Non-Patent Documents 2, 3, 6 and Patent Documents 1 to 9).

[0006] However, even with this clamp method, when the ratio of mutant genes to wild-type genes in the sample is extremely low, real-time PCR may amplify wild-type genes, but may fail to distinguish between wild-type genes and mutant genes. In addition, direct sequencing using the amplification product of clamp PCR as a template may increase the detection sensitivity of mutant genes, but sequence determination is not suitable for clinical situations that require on-site processing of large numbers of subjects.

[0007] [Prior art literature]

[0008] [Patent Literature]

[0009] [Patent Document 1] Patent No. 6242336

[0010] [Patent Document 2] Patent No. 5813263

[0011] [Patent Document 3] Patent No. 4731324

[0012] [Patent Document 4] Patent No. 4383178

[0013] [Patent Document 5] Patent No. 5030998

[0014] [Patent Document 6] Patent No. 4151751

[0015] [Patent Document 7] Japanese Patent Application Publication No. 2001-89496

[0016] [Patent Document 8] International Publication No. 2003 / 068795

[0017] [Patent Document 9] International Publication No. 2005 / 021570

[0018] [Patent Document 10] Patent No. 3756313

[0019] [Patent Document 11] International Publication No. 2016 / 167320

[0020]

Non-patent literature

[0021] [Non-patent document 1] Thomas J., et al., 2004, The New England Journal of Medicine, 350; 21

[0022] [Non-patent document 2] Nagai K., et al., 2005, Cancer Research, 65: 7276-7282

[0023] [Non-patent document 3] Nishino K. et al., 2019, Manual for detecting EGFR gene mutations in lung cancer patients, version 4.1

[0024] [Non-patent document 4] Luming Z. et al., 2011 BioTechniques, 50: 311-318

[0025] [Non-patent document 5] Nagakubo Y. et al., 2019, BMC Medical Genomics, 12: 162

[0026] [Non-patent document 6] Murina FF et al., 2020, Molecules, 25(4): 786

[0027] [Summary of the Invention]

[0028] [Problems to be solved by the invention]

[0029] Thus, in clinical or research sites, even when the ratio of mutant genes to wild-type genes in a sample is extremely low, there is a need for a method that can detect mutant genes, and research on methods corresponding thereto is being promoted (Patent Document 2, Non-Patent Document 4, Non-Patent Document 5). However, conventional methods require expensive equipment or complicated analysis steps of more than two stages in order to detect mutant genes with high sensitivity (Non-Patent Document 2), and methods that can detect mutant genes in samples with high sensitivity using simple methods are required in clinical sites or research sites.

[0030] Therefore, the present invention aims to provide a simple method and a kit for implementing the method that can detect mutant genes at a mutant gene content rate lower than the detection limit of mutant genes by the clamp-PCR method.

[0031] In addition, the present invention aims to provide a simple method for selectively inhibiting amplification of a target base sequence in a nucleic acid amplification reaction and a kit for implementing the method.

[0032]

Methods for solving the problem

[0033] The present inventors have repeatedly explored methods for improving the detection sensitivity of mutant genes by the clamp method. When a nucleic acid amplification reaction is carried out in the presence of a clamp nucleic acid and a specific amphiphilic copolymer, the effect of selectively inhibiting the amplification of the wild-type gene by the clamp nucleic acid is enhanced by the presence of the amphiphilic copolymer, thereby successfully improving the detection sensitivity of the mutant gene, thereby completing the present invention.

[0034] That is, the present invention provides the following methods, kits, enhancers, and uses.

[0035] [1] A method for detecting a variation in a target base sequence of a nucleic acid in a sample relative to a standard base sequence, comprising performing a nucleic acid amplification reaction using the nucleic acid in the sample as a template using the following substances:

[0036] A nucleic acid comprising a base sequence complementary to the above-mentioned standard base sequence, comprising at least one non-natural nucleotide residue, and

[0037] An amphoteric copolymer comprising a cationic structural unit (1) containing an amino group in the structure and an anionic structural unit (2), wherein the molar ratio of the cationic structural unit (1) to the anionic structural unit (2) (cationic structural unit (1) / anionic structural unit (2)) is in the range of 0.13 to 1.62,

[0038] The presence of the above-mentioned variation is determined based on the total amount of nucleic acid amplification products obtained by the above-mentioned nucleic acid amplification reaction, the number of amplification cycles of the above-mentioned nucleic acid amplification reaction until the total amount of the above-mentioned nucleic acid amplification products reaches a threshold value, the amount of the above-mentioned mutated nucleic acid in the above-mentioned nucleic acid amplification products, or the number of amplification cycles of the above-mentioned nucleic acid amplification reaction until the amount of the nucleic acid with the above-mentioned variation in the above-mentioned nucleic acid amplification products reaches a threshold value.

[0039] [2] The detection method according to [1], wherein at least a part of the cationic structural unit (1) has a secondary or tertiary amino group.

[0040] [3] The detection method described in [1] or [2], wherein the amphoteric copolymer further contains a nonionic constituent unit (3).

[0041] [4] The detection method according to any one of [1] to [3], wherein in the above-mentioned amphoteric copolymer,

[0042] At least a part of the cationic structural unit (1) is a structural unit (1-1) having a structure represented by the general formula (Ia) or the general formula (Ib) or a structure which is an acid addition salt thereof:

[0043]

Chemistry 1

[0044]

[0045] (Where R 1 represents a hydrogen atom, an alkyl group having 1 to 10 carbon atoms which may have a hydroxyl group, a cycloalkyl group having 5 to 10 carbon atoms, or an aralkyl group having 7 to 10 carbon atoms),

[0046] At least a part of the anionic structural unit (2) is a structural unit (2-1) represented by the general formula (II-a):

[0047]

Chemistry 2

[0048]

[0049] (R 9 is hydrogen or methyl, and Y is independently hydrogen, Na, K, NH4, 1 / 2Ca, 1 / 2Mg, 1 / 2Fe, 1 / 3Al or 1 / 3Fe for each bound carboxyl group).

[0050] [5] The detection method according to any one of [1] to [4], wherein the non-natural nucleotide is BNA.

[0051] [6] The detection method according to any one of [1] to [5], wherein the nucleic acid amplification is performed by real-time PCR.

[0052] [7] The detection method described in any one of [1] to [6], wherein the nucleic acid sample is genomic DNA.

[0053] [8] The detection method according to any one of [1] to [7], wherein

[0054] Furthermore, for example, when performing the above-mentioned nucleic acid amplification reaction, a nucleic acid amplification reaction is performed using a nucleic acid having the above-mentioned standard base sequence as a template.

[0055] When the number of amplification cycles of the nucleic acid amplification reaction until the total amount of the nucleic acid amplification product reaches a threshold value when the nucleic acid in the sample is used as a template is smaller than the number of amplification cycles of the nucleic acid amplification reaction until the total amount of the nucleic acid amplification product reaches a threshold value when the nucleic acid having the standard base sequence is used as a template, it is determined that the above-mentioned variation exists in the target base sequence of the nucleic acid in the sample.

[0056] [9] A kit for detecting a variation in a target base sequence of a nucleic acid in a sample relative to a standard base sequence, comprising:

[0057] A nucleic acid having a base sequence complementary to the above-mentioned standard base sequence, containing at least one non-natural nucleotide residue,

[0058] An amphoteric copolymer comprising a cationic structural unit (1) containing an amino group in its structure and an anionic structural unit (2), wherein the molar ratio of the cationic structural unit (1) to the anionic structural unit (2) (cationic structural unit (1) / anionic structural unit (2)) is in the range of 0.13 to 1.62.

[0059]

[10] The kit according to [9], wherein at least a part of the cationic structural unit (1) has a secondary or tertiary amino group.

[0060]

[11] The kit according to [9] or

[10] , wherein the amphoteric copolymer further contains a nonionic constituent unit (3).

[0061]

[12] The kit according to any one of [9] to

[11] , wherein in the amphoteric copolymer,

[0062] At least a part of the cationic structural unit (1) is a structural unit (1-1) having a structure represented by the general formula (Ia) or the general formula (Ib) or a structure which is an acid addition salt thereof:

[0063]

Chemistry 3

[0064]

[0065] (Where R 1represents a hydrogen atom, an alkyl group having 1 to 10 carbon atoms which may have a hydroxyl group, a cycloalkyl group having 5 to 10 carbon atoms, or an aralkyl group having 7 to 10 carbon atoms),

[0066] At least a part of the anionic structural unit (2) is a structural unit (2-1) represented by the general formula (II-a):

[0067]

Chemistry 4

[0068]

[0069] (R 9 is hydrogen or methyl, and Y is independently hydrogen, Na, K, NH4, 1 / 2Ca, 1 / 2Mg, 1 / 2Fe, 1 / 3Al or 1 / 3Fe for each bound carboxyl group).

[0070]

[13] The kit according to any one of [9] to

[12] , wherein the non-natural nucleotide is BNA.

[0071]

[14] A method for inhibiting amplification of a nucleic acid in a sample having a specified target base sequence in a nucleic acid amplification reaction, comprising carrying out a nucleic acid amplification reaction using the nucleic acid in the sample as a template using the following substances:

[0072] A nucleic acid having a base sequence complementary to the target base sequence, comprising a non-natural nucleic acid of at least one residue,

[0073] An amphoteric copolymer comprising a cationic structural unit (1) containing an amino group in the structure and an anionic structural unit (2), wherein the molar ratio of the cationic structural unit (1) to the anionic structural unit (2) (cationic structural unit (1) / anionic structural unit (2)) is in the range of 0.13 to 1.62.

[0074]

[15] The method of

[14] , wherein at least a part of the cationic structural unit (1) has a secondary or tertiary amino group.

[0075]

[16] The method according to

[14] or

[15] , wherein the amphoteric copolymer further contains a nonionic structural unit (3).

[0076]

[17] The method according to any one of

[14] to

[16] , wherein in the above-mentioned amphoteric copolymer,

[0077] At least a part of the cationic structural unit (1) is a structural unit (1-1) having a structure represented by the general formula (Ia) or the general formula (Ib) or a structure which is an acid addition salt thereof:

[0078]

Chemistry 5

[0079]

[0080] (Where R 1 represents a hydrogen atom, an alkyl group having 1 to 10 carbon atoms which may have a hydroxyl group, a cycloalkyl group having 5 to 10 carbon atoms, or an aralkyl group having 7 to 10 carbon atoms),

[0081] At least a part of the anionic structural unit (2) is a structural unit (2-1) represented by the general formula (II-a):

[0082]

Chemistry 6

[0083]

[0084] (R 9 is hydrogen or methyl, and Y is independently hydrogen, Na, K, NH4, 1 / 2Ca, 1 / 2Mg, 1 / 2Fe, 1 / 3Al or 1 / 3Fe for each bound carboxyl group).

[0085]

[18] The method according to any one of

[14] to

[17] , wherein the non-natural nucleotide is BNA.

[0086]

[19] A kit for inhibiting amplification of a nucleic acid having a target base sequence in a nucleic acid amplification reaction, comprising:

[0087] A nucleic acid having a base sequence complementary to the target base sequence, containing at least one non-natural nucleotide residue, and

[0088] An amphoteric copolymer comprising a cationic structural unit (1) containing an amino group in the structure and an anionic structural unit (2), wherein the molar ratio of the cationic structural unit (1) to the anionic structural unit (2) (cationic structural unit (1) / anionic structural unit (2)) is in the range of 0.13 to 1.62.

[0089]

[20] The kit described in

[19] , wherein at least a part of the cationic structural unit (1) has a secondary or tertiary amino group.

[0090]

[21] The kit according to

[19] or

[20] , wherein the amphoteric copolymer further contains a nonionic constituent unit (3).

[0091]

[22] The kit according to any one of

[19] to

[21] , wherein in the amphoteric copolymer,

[0092] At least a part of the cationic structural unit (1) is a structural unit (1-1) having a structure represented by the general formula (Ia) or the general formula (Ib) or a structure which is an acid addition salt thereof:

[0093]

Chemistry 7

[0094]

[0095] (Where R 1 represents a hydrogen atom, an alkyl group having 1 to 10 carbon atoms which may have a hydroxyl group, a cycloalkyl group having 5 to 10 carbon atoms, or an aralkyl group having 7 to 10 carbon atoms),

[0096] At least a part of the anionic structural unit (2) is a structural unit (2-1) represented by the general formula (II-a):

[0097]

Chemistry 8

[0098]

[0099] (R 9 is hydrogen or methyl, and Y is independently hydrogen, Na, K, NH4, 1 / 2Ca, 1 / 2Mg, 1 / 2Fe, 1 / 3Al or 1 / 3Fe for each bound carboxyl group).

[0100]

[23] The kit according to any one of

[19] to

[22] , wherein the non-natural nucleotide is BNA.

[0101]

[24] an enhancer for suppressing the effect of nucleic acid amplification of a nucleic acid having a target base sequence by a non-natural nucleotide having a base sequence complementary to the target base sequence and containing at least one residue,

[0102] A reinforcing agent comprising an amphoteric copolymer having a cationic constituent unit (1) and an anionic constituent unit (2) containing an amino group in the structure, wherein the molar ratio of the cationic constituent unit (1) to the anionic constituent unit (2) (cationic constituent unit (1) / anionic constituent unit (2)) is in the range of 0.13 to 1.62.

[0103]

[25] The enhancer described in

[24] , wherein at least a part of the cationic structural unit (1) has a secondary or tertiary amino group.

[0104]

[26] The reinforcing agent described in

[24] or

[25] , wherein the amphoteric copolymer further contains a nonionic structural unit (3).

[0105]

[27] The reinforcing agent according to any one of

[24] to

[26] , wherein in the above-mentioned amphoteric copolymer,

[0106] At least a part of the cationic structural unit (1) is a structural unit (1-1) having a structure represented by the general formula (Ia) or the general formula (Ib) or a structure which is an acid addition salt thereof:

[0107]

Chemistry 9

[0108]

[0109] (Where R 1 represents a hydrogen atom, an alkyl group having 1 to 10 carbon atoms which may have a hydroxyl group, a cycloalkyl group having 5 to 10 carbon atoms, or an aralkyl group having 7 to 10 carbon atoms),

[0110] At least a part of the anionic structural unit (2) is a structural unit (2-1) represented by the general formula (II-a):

[0111]

Chemistry 10

[0112]

[0113] (R 9 is hydrogen or methyl, and Y is independently hydrogen, Na, K, NH4, 1 / 2Ca, 1 / 2Mg, 1 / 2Fe, 1 / 3Al or 1 / 3Fe for each bound carboxyl group).

[0114]

[28] Use of an amphiphilic copolymer in the manufacture of a nucleic acid amplification inhibition enhancer for enhancing the nucleic acid amplification inhibition effect of a nucleic acid, wherein

[0115] The amphoteric copolymer comprises a cationic structural unit (1) containing an amino group in the structure and an anionic structural unit (2), wherein the molar ratio of the cationic structural unit (1) to the anionic structural unit (2) (cationic structural unit (1) / anionic structural unit (2)) is in the range of 0.13 to 1.62.

[0116]

[29] The use described in

[28] , wherein at least a part of the cationic structural unit (1) has a secondary or tertiary amino group.

[0117]

[30] The use according to

[28] or

[29] , wherein the amphoteric copolymer further contains a nonionic structural unit (3).

[0118]

[31] The use according to any one of

[28] to

[30] , wherein in the above-mentioned amphoteric copolymer,

[0119] At least a part of the cationic structural unit (1) is a structural unit (1-1) having a structure represented by the general formula (Ia) or the general formula (Ib) or a structure which is an acid addition salt thereof:

[0120]

Chemistry 11

[0121]

[0122] (Where R 1 represents a hydrogen atom, an alkyl group having 1 to 10 carbon atoms which may have a hydroxyl group, a cycloalkyl group having 5 to 10 carbon atoms, or an aralkyl group having 7 to 10 carbon atoms),

[0123] At least a part of the anionic structural unit (2) is a structural unit (2-1) represented by the general formula (II-a):

[0124]

Chemistry 12

[0125]

[0126] (R 9 is hydrogen or methyl, and Y is independently hydrogen, Na, K, NH4, 1 / 2Ca, 1 / 2Mg, 1 / 2Fe, 1 / 3Al or 1 / 3Fe for each bound carboxyl group).

[0127]

[32] An amphoteric copolymer for enhancing the inhibitory effect of nucleic acid amplification by sandwiching nucleic acid, wherein the amphoteric copolymer has a cationic constituent unit (1) and an anionic constituent unit (2) containing an amino group in the structure, and the molar ratio of the cationic constituent unit (1) to the anionic constituent unit (2) (cationic constituent unit (1) / anionic constituent unit (2)) is in the range of 0.13 to 1.62.

[0128]

[33] The use described in

[32] , wherein at least a part of the cationic structural unit (1) has a secondary amino group or a tertiary amino group.

[0129]

[34] The use according to

[32] or

[33] , wherein the amphoteric copolymer further contains a nonionic structural unit (3).

[0130]

[35] The use according to any one of

[32] to

[34] , wherein in the above-mentioned amphoteric copolymer,

[0131] At least a part of the cationic structural unit (1) is a structural unit (1-1) having a structure represented by the general formula (Ia) or the general formula (Ib) or a structure which is an acid addition salt thereof:

[0132]

Chemistry 13

[0133]

[0134] (Where R 1represents a hydrogen atom, an alkyl group having 1 to 10 carbon atoms which may have a hydroxyl group, a cycloalkyl group having 5 to 10 carbon atoms, or an aralkyl group having 7 to 10 carbon atoms),

[0135] At least a part of the anionic structural unit (2) is a structural unit (2-1) represented by the general formula (II-a):

[0136]

Chemistry 14

[0137]

[0138] (R 9 is hydrogen or methyl, and Y is independently hydrogen, Na, K, NH4, 1 / 2Ca, 1 / 2Mg, 1 / 2Fe, 1 / 3Al or 1 / 3Fe for each bound carboxyl group).

[0139] The above-mentioned amphiphilic copolymer itself does not inhibit the nucleic acid amplification reaction, but can selectively enhance the effect of the sandwich nucleic acid on inhibiting the amplification of nucleic acids having a sequence complementary thereto. Therefore, according to one embodiment of the present invention, in the sample, for the ratio of nucleic acids having a standard base sequence complementary to the sandwich nucleic acid, even if the ratio of nucleic acids having a variation relative to the standard base sequence is very low (for example, less than 0.1%), the sandwich nucleic acid selectively inhibits the amplification of nucleic acids having the standard base sequence, while nucleic acids having a variation relative to the standard base sequence are amplified as usual, and detection of nucleic acids having a variation becomes possible with a very high sensitivity and a simple method.

[0140] [Brief description of the attached drawings]

[0141]

Figure 1

[0142] [Figure 2] shows an example of a nucleic acid amplification curve when the amplification of a mutant gene is not inhibited but the selective amplification inhibition effect of a wild-type gene by a BNA-containing clamp nucleic acid (BNA clamp) is enhanced, and the nucleic acid amplification curve is when a real-time PCR reaction is carried out using a wild-type gene or a mutant gene as a template with or without the addition of the polymer of Example 4 (a copolymer of dimethylaminopropylmethacrylamide hydrochloride, acrylamide, and acrylic acid in a ratio of 1:1:2) in the presence or absence of a BNA clamp.

[0143] [Figure 3] shows the nucleic acid amplification curve when real-time PCR reaction is performed in the presence of BNA clamp without adding a polymer or adding a polymer of Example 1, 2, 4 or 6 (a copolymer of diallylamine hydrochloride·maleic acid in a ratio of 1:1, a copolymer of diallylmethylamine·maleic acid in a ratio of 1:1, a copolymer of dimethylaminopropylmethacrylamide hydrochloride·acrylamide·acrylic acid in a ratio of 1:1:2, or a copolymer of diallylamine hydrochloride·acrylamide·acrylic acid in a ratio of 1:1:2), using KRAS gene with a mutant content rate of 10%, 1%, 0.10%, 0.01% or 0% (WT) as a template.

[0144]

Figure 4

[0145] [Figure 5] shows that in the presence of BNA clamp, without adding a polymer, or adding a polymer of Example 1, 2, 4 or 6 (a copolymer of diallylamine hydrochloride and maleic acid in a ratio of 1:1, a copolymer of diallylmethylamine and maleic acid in a ratio of 1:1, a copolymer of dimethylaminopropylmethacrylamide hydrochloride and acrylamide and acrylic acid in a ratio of 1:1:2, or a copolymer of diallylamine hydrochloride and acrylamide and acrylic acid in a ratio of 1:1:2), the expression of the mutant in the KRAS gene was significantly increased. Figure 4 Nucleic acid amplification curve when real-time PCR reaction is performed using plasmid DNA as a template.

[0146]

Figure 6

[0147] The embodiments of the present invention will be described in detail, but the present invention should not be construed as being limited to the following embodiments.

[0148] In one embodiment, the present invention relates to a method for detecting a variation in a target base sequence relative to a standard base sequence by performing nucleic acid amplification in the presence of a specific amphiphilic copolymer in a nucleic acid amplification method using a sandwich nucleic acid. In other embodiments, the present invention relates to a method for inhibiting the amplification of a nucleic acid having a specified target base sequence by performing nucleic acid amplification in the presence of a sandwich nucleic acid and a specific amphiphilic copolymer. In addition, in other embodiments, the present invention relates to a kit for implementing these methods. In addition, in other embodiments, the present invention relates to an enhancer of the nucleic acid amplification inhibitory effect of a sandwich nucleic acid. Each embodiment is described in detail below.

[0149] [1. Method for detecting a variation in a target base sequence relative to a standard base sequence]

[0150] One embodiment of the present invention relates to a method for detecting a variation in a target base sequence of a nucleic acid in a sample relative to a standard base sequence. This method prepares a nucleic acid having a base sequence complementary to the standard base sequence, a non-natural nucleotide containing at least one residue, and a specific amphiphilic copolymer, and uses these to perform a nucleic acid amplification reaction using the nucleic acid in the sample as a template. When the target base sequence has a variation relative to the standard base sequence, the region containing the target base sequence is preferentially amplified by nucleic acid than the standard sequence, thereby making it possible to detect the presence of the variation.

[0151]

Sample

[0152] The sample provided for the method of the present invention is a sample that corresponds to the embodiment and is presumed to contain a nucleic acid having a mutation or a nucleic acid to be inhibited from amplification. In the present embodiment, it is presumed to contain a nucleic acid for detection of a desired mutation. The sample, for example, is a sample prepared from a subject collected from a mammal (typically a human). For example, liquid samples such as blood, pleural effusion, bronchial washings, bone marrow fluid, lymph fluid, etc., or solid samples such as lymph nodes, blood vessels, bone marrow, brain, spleen, skin, etc. can be cited. Since the method of the present invention can detect the mutation of nucleic acids with very high sensitivity, it can use not only samples from subjects collected from lesions such as cancer, but also samples from subjects containing only trace amounts of mutant genes such as blood.

[0153]

Target base sequence

[0154] In the present application, "target base sequence" refers to a base sequence that is the target of mutation detection or amplification inhibition according to the method according to an embodiment of the present invention. In addition, "nucleic acid in a sample" is a nucleic acid that may contain a base sequence that is the target of mutation detection or amplification inhibition. However, "target base sequence" does not refer to a base sequence that actually has a mutation or actually contains a base sequence that is inhibited by amplification, and "nucleic acid in a sample" does not refer to a base sequence that actually contains a base sequence that is the target of mutation detection or amplification inhibition.

[0155] In the method according to this embodiment, the "target base sequence" is the base sequence that is the object of detecting the presence or absence of a mutation, and the "nucleic acid in the sample" is the nucleic acid containing the base sequence that is the object of detecting the presence or absence of a mutation. In addition, the "region containing the target base sequence" is the region that becomes the target of amplification by the method of the present invention.

[0156]

Nucleic acid in the sample

[0157] The nucleic acid may be DNA or RNA, and may include all natural or non-natural nucleic acids such as genomic DNA, cDNA, plasmid DNA, cell-free DNA, circulating DNA, RNA, miRNA, and mRNA. When using a sample from a subject collected from a mammal (typically a human), the nucleic acid that becomes the object of mutation detection is DNA in most cases, and typically, it is genomic DNA of great clinical significance. In addition, even from the viewpoint of increasing the effect of enhancing the inhibitory effect of nucleic acid amplification by the sandwich nucleic acid, the nucleic acid in the sample is preferably genomic DNA.

[0158] As genomic DNA, for example, the genomic DNA associated with the onset and / or treatment sensitivity of a specific disease can be enumerated. Such diseases are mostly known, and their representative examples are various cancers. It is also known that as the gene associated with the onset and / or treatment sensitivity of cancer, for example, ABL / BCR fusion gene (chronic myeloid leukemia), HER2 gene (breast cancer), EGFR gene (non-small cell lung cancer), c-KIT gene (digestive tract stromal tumor), KRAS gene (colorectal cancer, pancreatic cancer), BRAF gene (melanoma, colorectal cancer), PI3KCA gene (lung cancer, colorectal cancer), FLT3 gene (acute myeloid leukemia), MYC gene (various cancers), MYCN gene (neuroblastoma), MET gene (lung cancer, gastric cancer, melanoma), BCL2 gene (cell B lymphoma) and EML4 / ALK fusion gene (lung cancer) can be enumerated.

[0159]

Standard base sequence and variation

[0160] In the present application, a "standard base sequence" refers to a base sequence that serves as a reference for determining whether the "target base sequence" has a variation in a method for detecting a variation in the "target base sequence", and a "variation" refers to a state in which the "target base sequence" has a certain base sequence difference relative to the "standard base sequence" due to substitution, insertion, deletion, inversion, duplication, transposition, or a combination of two or more of these. In the present application, such a "variation" may be a base sequence difference of less than 20%, a base sequence difference of less than 10%, a base sequence difference of less than 5%, or a base sequence difference of less than 1%.

[0161] The "standard base sequence" can be selected from various base sequences corresponding to the purpose of the inspection. Typically, it is a base sequence derived from a wild-type nucleic acid, preferably a base sequence derived from a wild-type gene known to be associated with the onset and / or treatment sensitivity of a specific disease. Thus, the "variant nucleic acid" is typically a nucleic acid that has a certain base sequence different from the base sequence of the nucleic acid derived from the wild type by substitution, insertion, deletion, inversion, duplication, transposition or a combination of two or more of these, preferably a nucleic acid with such a base sequence different from the wild-type gene known to be associated with the onset and / or treatment sensitivity of a specific disease. For example, it is known that the variation of the 12th codon or the 13th codon of the 2nd exon of the KRAS gene is associated with the efficacy of the molecular target drug cetuximab. In addition, it is known that in the BRAF gene, the variation of the 600th codon of the 15th exon is associated with the efficacy of the molecular target drug cetuximab or panitumumab.

[0162] Since the specific amphiphilic copolymer particularly increases the inhibitory effect of nucleic acid amplification by the sandwiched nucleic acid, the expected value of the ratio of the target base sequence containing the above mutation relative to the total of the target sequence (standard base sequence) not containing the mutation and the target sequence containing the above mutation contained in the nucleic acid in the above sample can also be less than 0.1%. In addition, in a preferred embodiment, it can be less than 0.05%, and in a more preferred embodiment, it can also be less than 0.01%. Among them, the expected value of the ratio of the target base sequence containing the mutation is clinically obtained for each mutation.

[0163]

Nucleic acid clamp

[0164] In the present application, "sandwich nucleic acid" refers to an artificial nucleic acid composed of an oligonucleotide containing at least one non-natural nucleotide having a base sequence complementary to a "base sequence" (or "standard base sequence" or "target base sequence" depending on the embodiment) that is a target for inhibiting nucleic acid amplification. "Sandwich nucleic acid" hybridizes with the "base sequence" that is a target for inhibiting nucleic acid amplification to inhibit nucleic acid amplification, and does not strongly hybridize with nucleic acids having base sequences that are not complementary to its base sequence and does not inhibit nucleic acid amplification.

[0165] In the method for detecting a variation in a "target base sequence", the "base sequence" that is the target of nucleic acid amplification inhibition by the "sandwich nucleic acid" is the "standard base sequence", and the "sandwich nucleic acid" hybridizes with the "standard base sequence" to inhibit its nucleic acid amplification.

[0166] Examples of non-natural nucleotides include peptide nucleic acids (PNA), bridged nucleic acids (BNA), peptide nucleic acids with phosphate groups (PHONA), and morpholino nucleic acids. In addition, first-generation BNAs are also called locked nucleic acids (LNA) (see, for example, Non-Patent Documents 2 and 3 and Patent Documents 1 and 2).

[0167] A PNA-containing clamp nucleic acid (PNA clamp) is a fully modified artificial nucleic acid composed of an oligonucleotide containing one or more nucleotides whose backbone is formed by a peptide bond instead of a phosphate bond of a nucleic acid. The modified nucleotide typically replaces the sugar-phosphate backbone of the nucleotide with a backbone having N-(2-aminoethyl)glycine as a unit, and has a structure in which a base is bound by a methylene carbonyl group. Details of PNA are described in non-patent document 6. Since the hybridization ability of the PNA clamp with a DNA chain of a complementary structure is stronger than that of natural DNA, it has a preferred characteristic as a clamp nucleic acid that is not degraded by nucleases.

[0168] BNA-containing clamp nucleic acid (BNA clamp) is an artificial nucleic acid composed of an oligonucleotide containing one or more non-natural nucleotides with a structure that cross-links the oxygen atom at the 2' position and the carbon atom at the 4' position of the ribose. The first generation of BNA is also called locked nucleic acid (LNA). The BNA clamp has a fixed helical structure and can form a very stable double-stranded chain by hybridizing with a nucleic acid with a complementary chain. In addition, since the binding to the nucleic acid with a complementary chain is strengthened in proportion to the number of modified nucleotides, the appropriate hybridization energy can be obtained by adjusting the length of the nucleic acid and the number of modified nucleotides, and the clamp effect can be exerted with a relatively short oligonucleotide chain.

[0169] A representative example of a BNA clamp is an oligonucleotide comprising a modified nucleotide having the following structure.

[0170]

Chemistry 15

[0171]

[0172] First generation BNA: 2',4'-BNA (LNA) (e.g., Patent Document 10)

[0173]

Chemistry 16

[0174]

[0175]

Chemistry 17

[0176]

[0177]

Chemistry 18

[0178]

[0179] (Where,

[0180] Base represents a pyrimidine or purine nucleic acid base or a hydroxyl group, a hydroxyl group protected by a protecting group synthesized by nucleic acid, an alkoxy group having 1 to 5 carbon atoms, a thiol group, a thiol group protected by a protecting group synthesized by nucleic acid, an alkylthio group having 1 to 5 carbon atoms, an amino group, an amino group protected by a protecting group synthesized by nucleic acid, an amino group substituted by an alkyl group having 1 to 5 carbon atoms, a pyrimidine or purine nucleic acid base substituted by a substituent selected from the group consisting of an alkyl group having 1 to 5 carbon atoms and a halogen atom (e.g., a fluorine atom, a chlorine atom, a bromine atom or an iodine atom),

[0181] R2 represents a hydrogen atom, a linear or branched alkyl group having 1 to 20 carbon atoms, a linear or branched alkenyl group having 2 to 20 carbon atoms, a cycloalkyl group having 3 to 10 carbon atoms, an aryl group having 6 to 14 carbon atoms, an aralkyl group in which an alkyl group having 1 to 6 carbon atoms is substituted with an aryl group having 6 to 14 carbon atoms, an acyl group, a sulfonyl group, a silyl group, or a labeling molecule,

[0182] m is an integer from 0 to 2,

[0183] n is an integer from 1 to 3)

[0184] The modified nucleotide of formula (IV) is preferably Base, selected from benzoylaminopurine-9-yl, adenine, 2-isobutyrylamino-6-hydroxypurine-9-yl, guanine, 2-oxo-4-benzoylamino-1,2-dihydropyrimidine-1-yl, cytosine, 2-oxo-5-methyl-4-benzoylamino-1,2-dihydropyrimidine-1-yl, 5-methylcytosine, uracil, and thymine, R1 is methyl, m is 0, and n is 1.

[0185] However, the BNA used in the present invention is not limited to the above, and other BNAs (e.g., 5'-amino-2',4'-BNA, 2',4'-BNACOC, 2',4'-BNANC, etc.) can also be used. In addition, in the BNA clamp, the bond between the modified nucleotide and the nucleotide, or between the modified nucleotides is usually a phosphodiester bond, and may contain a phosphorothioate bond. The details of BNA are described in Patent Documents 1 to 10, and those skilled in the art in the technical field to which the present invention belongs can easily understand which artificial nucleic acid corresponds to the BNA clamp from the known technical matters in these documents, etc.

[0186] As a clamp nucleic acid, a BNA clamp is preferred, and a BNA clamp containing a modified nucleotide having a structure of formula (IV) is particularly preferred, in that it can form a stable double-stranded chain with a nucleic acid of a complementary sequence with relatively few nucleotides and selectively inhibit nucleic acid amplification of the nucleic acid (when a variation detection method using the amplification cycle number of a wild-type gene as a benchmark, such as the intercalator method described later, the ΔΔΔCt value is large).

[0187] The length of the sandwich nucleic acid and the number of non-natural nucleotides are factors that determine the binding force to the nucleic acid that is the object of inhibiting nucleic acid amplification. Therefore, these factors are preferably set appropriately in a manner that can strongly bind to the nucleic acid that is the object of inhibiting nucleic acid amplification (a nucleic acid with a standard base sequence in the method of detecting mutations) and selectively inhibit the amplification of the nucleic acid. In this regard, the length of the sandwich nucleic acid is usually 5 to 50mer, preferably 6 to 30mer, more preferably 7 to 25mer, more preferably 8 to 20mer, and particularly preferably 9 to 15mer.

[0188] From the same point of view, the ratio of the non-natural nucleic acid in the sandwich nucleic acid is usually 10 to 100%, preferably 30 to 95%, more preferably 40 to 90%, further preferably 50 to 85%, and particularly preferably 60 to 80%.

[0189] The synthesis of the sandwich nucleic acid can be performed based on the documents of Patent Documents 7 to 10. Alternatively, the synthesis of the sandwich nucleic acid can be outsourced to the deposited company.

[0190]

Amphoteric copolymer

[0191] In the method of the present invention, when a nucleic acid amplification reaction is carried out using the above primer set with the nucleic acid in the sample as a template, the nucleic acid amplification reaction is carried out in the presence of a specific amphoteric copolymer together with the above blocker nucleic acid. The amphoteric copolymer used in the present invention is an amphoteric copolymer that enhances the selective nucleic acid amplification inhibition effect of the blocker nucleic acid, and has a cationic structural unit (1) and an anionic structural unit (2) containing an amino group in the structure, and the molar ratio of the cationic structural unit (1) to the above anionic structural unit (2) (cationic structural unit (1) / anionic structural unit (2)) is in the range of 0.13 to 1.62.

[0192] [Cationic structural unit (1)]

[0193] The cationic structural unit (1) constituting the amphoteric copolymer used in the present invention is a cationic structural unit containing an amino group in its structure.

[0194] The cationic structural unit (1) is not limited to structural units containing an amino group as a cationic functional group in its structure, and structural units of various structures can be used as the cationic structural unit (1) as long as the condition of being a structural unit containing an amino group in its structure is satisfied.

[0195] The amino group in the cationic structural unit (1) is also not particularly limited, but is preferably a secondary amino group or a tertiary amino group, and particularly preferably a tertiary amino group, because the effect of enhancing the inhibitory effect of nucleic acid amplification by the sandwiched nucleic acid is large.

[0196] Particularly preferred structural units as the cationic structural unit (1) include the following structural units (1-1), (1-2), (1-3) and (1-4). Among them, the structural unit (1-1), (1-3) or (1-4) is preferred as the cationic structural unit (1), and the structural unit (1-1) is particularly preferred as the cationic structural unit (1).

[0197] The amphoteric copolymer may contain only one cationic structural unit (1) or may contain two or more cationic structural units (1). When containing two or more cationic structural units (1), the two or more cationic structural units (1) may be a combination of structural units that are both classified as structural units (1-1), a combination of structural units that are both classified as structural units (1-2), a combination of structural units that are both classified as structural units (1-3), or a combination of structural units that are both classified as structural units (1-4), or may be a combination of structural units that are different from each other among the structural units (1-1) to (1-4). Cationic structural units that do not correspond to any of the structural units (1-1) to (1-4) may also be used in combination.

[0198]

Composition unit (1-1)

[0199] The structural unit (1-1) is a structural unit having a structure represented by the following general formula (Ia) or general formula (Ib) or a structure of an acid addition salt thereof. Since the structural unit (1-1) has a large effect of enhancing the inhibitory effect of nucleic acid amplification by sandwich nucleic acid, it is a particularly preferred structural unit as the cationic structural unit (1). That is, by using the structural unit (1-1) as all or part of the cationic structural unit (1), the inhibitory effect of nucleic acid amplification by sandwich nucleic acid can be further enhanced.

[0200]

Chemistry 19

[0201]

[0202] In the formula, R 1R represents a hydrogen atom, an alkyl group having 1 to 10 carbon atoms which may have a hydroxyl group, a cycloalkyl group having 5 to 10 carbon atoms, or an aralkyl group having 7 to 10 carbon atoms. 1 It is preferably a hydrogen atom, a methyl group, an ethyl group or a benzyl group, and particularly preferably a hydrogen atom or a methyl group.

[0203] The structural unit (1-1) is a structure of an inorganic acid salt or an organic acid salt, which may have a structure represented by the above structural formula (1-a) or (1-b), that is, a structure as an acid addition salt.

[0204] When the amphoteric copolymer has a structural unit (1-1), when producing the amphoteric copolymer, it is preferred to use a diallylamine monomer having an addition salt from the viewpoint of production cost, etc. Since the process of removing an addition salt such as HCl from the polymer is cumbersome and also causes an increase in cost, the use of an addition salt-type structural unit (1-1) that can be produced without requiring such a process is also a preferred embodiment from the viewpoint of cost, etc.

[0205] From the viewpoint of availability and controllability of the reaction, the inorganic acid salt or organic acid salt in the structural unit (1-1) of this embodiment is preferably a hydrochloride, a carboxylate, a sulfonate, or an alkyl sulfate ester salt, and particularly preferably a hydrochloride.

[0206]

Constitutional Unit (1-2)

[0207] The structural unit (1-2) is a structural unit having a structure represented by the following general formula (Ic) or general formula (Id).

[0208]

Chemistry 20

[0209]

[0210] In the formula, R 2 and R 3 are each independently a hydrogen atom, an alkyl group having 1 to 10 carbon atoms which may have a hydroxyl group, a cycloalkyl group having 5 to 10 carbon atoms, or an aralkyl group having 7 to 10 carbon atoms, and X a- represents a counterion, and a represents the valence of the counterion.

[0211] R 2 and R 3 Each independently is preferably a hydrogen atom, a methyl group, an ethyl group or a benzyl group, and particularly preferably a hydrogen atom or a methyl group.

[0212] In the counterion X a- There are no particular limitations, but from the viewpoints of availability and controllability of the reaction, chloride ions, carboxylate ions, sulfonate ions, or alkyl sulfate ions are preferred, and chloride ions or ethyl sulfate ions are particularly preferred.

[0213] When producing an amphoteric copolymer, it is preferred to use a diallylamine monomer having a counter ion from the viewpoint of production cost, etc. Since the process of removing the counter ion from the polymer is cumbersome and also causes an increase in cost, it is also a preferred embodiment from the viewpoint of cost, etc. to use an amphoteric copolymer having a counter ion type structural unit (1-2) that can be produced without requiring such a process.

[0214]

Constituent unit (1-3)

[0215] The structural unit (1-3) is a structural unit having a structure represented by the following general formula (Ie) or a structure which is an acid addition salt thereof.

[0216]

Chemistry 21

[0217]

[0218] In the formula, R 4 and R 5 Each independently represents a hydrogen atom, an alkyl group having 1 to 12 carbon atoms which may have a hydroxyl group, an aralkyl group having 7 to 12 carbon atoms, or a cycloalkyl group having 5 to 6 carbon atoms.

[0219] As R 4 and R 5 The preferred alkyl or aralkyl group having 1 to 12 carbon atoms may be either linear or branched. Examples thereof include methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, pentyl, hexyl, octyl, decyl, dodecyl, and benzyl. 4 and R 5 Preferred cycloalkyl groups having 5 to 6 carbon atoms include cyclopentyl and cyclohexyl, but are not limited thereto.

[0220] R 4 and R 5 Each independently is preferably a hydrogen atom, a methyl group, an ethyl group or a benzyl group, and particularly preferably a hydrogen atom or a methyl group.

[0221] When the constituent unit (1-3) is an acid addition salt having a structure represented by the general formula (Ie), the type of addition salt is not particularly limited. From the viewpoint of availability or ease of reaction control, for example, hydrochlorides, sulfates, phosphates, nitrates, sulfites, phosphites, nitrites, hydrobromides, acetates, amide sulfates, methanesulfonates, trifluoroacetates, p-toluenesulfonates, etc. can be used.

[0222] Among them, hydrochlorides, sulfates, phosphates, and amide sulfates are preferred, and hydrochlorides, sulfates, phosphates, and amide sulfates having a structure derived from monoallylamine are particularly preferred.

[0223]

Constituent units (1-4)

[0224] The constituent units (1-4) are constituent units having a structure represented by the following general formula (I-f) or a structure that is an acid addition salt thereof.

[0225]

Chemical formula 22

[0226]

[0227] In the formula, R 6 represents a hydrogen atom or a methyl group, R 7 and R 8 each independently represent a hydrogen atom or an alkyl group having 1 to 4 carbon atoms, and n is an integer of 2 to 4.

[0228] R 6 is preferably a methyl group, n is preferably 2 to 3, and R 7 and R 8 are preferably each independently a hydrogen atom or a methyl group.

[0229] There are no particular restrictions on the types of addition salts when the constituent unit (1-4) is an acid addition salt of the structure represented by the general formula (I-f). From the viewpoints of chirality or ease of reaction control, etc., for example, hydrochloride, sulfate, phosphate, nitrate, sulfite, phosphite, nitrite, hydrobromide, acetate, amidosulfate, methanesulfonate, trifluoroacetate, p-toluenesulfonate, etc. can be used.

[0230] Among them, hydrochloride, sulfate, phosphate, and amidosulfate are preferred, and hydrochloride, sulfate, phosphate, and amidosulfate of a structure derived from monoallylamine are particularly preferred.

[0231] The proportion of the cationic constituent unit (1) in all the constituent units of the amphoteric copolymer is usually 10 to 70 mol%, preferably 15 to 60 mol%, and particularly preferably 20 to 55 mol%. When there are two or more types of cationic constituent units (1), the above proportion is defined based on the total amount of the two or more types of cationic constituent units (1).

[0232]

Anionic constituent unit (2)

[0233] The anionic constituent unit (2) that constitutes the amphoteric copolymer used in the present invention is a constituent unit having an anionic functional group in its structure.

[0234] The anionic structural unit (2) is not limited to structural units other than those containing anionic functional groups in their structures, and structural units of various structures can be used as the anionic structural unit (2) as long as the conditions for structural units containing anionic functional groups in their structures are satisfied.

[0235] Particularly preferred structural units as the anionic structural unit (2) include the following structural units (2-1), (2-2), (2-3) and (2-4). Among them, the structural unit (2-1) is particularly preferred as the anionic structural unit (2).

[0236] The characteristic amphoteric copolymer may contain only one anionic constituent unit (2) or may contain two or more anionic constituent units (2). When containing two or more anionic constituent units (2), the two or more anionic constituent units (2) may be a combination of constituent units that are both classified as constituent units (2-1), a combination of constituent units that are both classified as constituent units (2-2), a combination of constituent units that are both classified as constituent units (2-3), or a combination of constituent units that are both classified as constituent units (2-4), or may be a combination of constituent units that are different from each other among constituent units (2-1) to (2-4). Anionic constituent units that do not correspond to any of constituent units (2-1) to (2-4) may also be used in combination.

[0237]

Constitutional Unit (2-1)

[0238] The structural unit (2-1) is a structural unit having a structure represented by the following general formula (II-a).

[0239] By using the structural unit (2-1) as all or part of the anionic structural unit (2), the effect of suppressing nucleic acid amplification by the sandwich nucleic acid can be further enhanced.

[0240]

Chemistry 23

[0241]

[0242] Where R 9 is hydrogen or methyl, and Y independently represents hydrogen, Na, K, NH4, 1 / 2Ca, 1 / 2Mg, 1 / 2Fe, 1 / 3Al, or 1 / 3Fe for each bonded carboxyl group.

[0243] R 9 It is preferably hydrogen, and Y is preferably hydrogen or Na. It is particularly preferred that the structural unit (2-1) is derived from maleic acid.

[0244]

Constitutional Unit (2-2)

[0245] The structural unit (2-2) is a structural unit having a structure represented by the following general formula (II-b).

[0246]

Chemistry 24

[0247]

[0248] wherein Y independently represents hydrogen, Na, K, NH4, 1 / 2Ca, 1 / 2Mg, 1 / 2Fe, 1 / 3Al, or 1 / 3Fe for each bonded carboxyl group.

[0249] Y is preferably hydrogen or Na.

[0250]

Constitutional Unit (2-3)

[0251] The structural unit (2-3) is a structural unit having a structure represented by the following general formula (II-c).

[0252]

Chemistry 25

[0253]

[0254] wherein Y is independently hydrogen, Na, K, NH4, 1 / 2Ca, 1 / 2Mg, 1 / 2Fe, 1 / 3Al or 1 / 3Fe for each bound carboxyl group.

[0255] Y is preferably hydrogen or Na.

[0256]

Constituent unit (2-4)

[0257] The structural unit (2-4) is a structural unit having a structure represented by the following general formula (II-d).

[0258]

Chemistry 26

[0259]

[0260] Where R 10 R is hydrogen or methyl, and Y is independently hydrogen, Na, K, NH4, 1 / 2Ca, 1 / 2Mg, 1 / 2Fe, 1 / 3Al or 1 / 3Fe for each bonded carboxyl group. 10 Preferably, it is hydrogen, and Y is preferably hydrogen or Na.

[0261] The structural unit (2-4) is preferably derived from (meth)acrylic acid, and particularly preferably derived from acrylic acid.

[0262] Since the amphoteric copolymer used in the present invention contains the cationic structural unit (1) and the anionic structural unit (2), it is an amphoteric copolymer having cationic and anionic properties.

[0263] Although the mechanism by which the remarkable effect of the present invention, such as the effect of enhancing the inhibitory effect of nucleic acid amplification by sandwiching nucleic acid, is achieved by using an amphiphilic copolymer containing a cationic structural unit (1) having the above-mentioned specific structure and an anionic structural unit (2) in a molar ratio of the cationic structural unit (1) / anionic structural unit (2) within the above-mentioned specific range is unknown, the cationic structural unit (1) having a specific structure stabilizes the binding of sandwiching nucleic acid and DNA by its strong cationic charge, but on the other hand, the strong cationic charge may inhibit the double-stranded formation of DNA or the denaturation to a single strand. It is presumed that by appropriately adjusting the cationic charge possessed by the cationic structural unit (1), the function of stabilizing the binding of sandwiching nucleic acid and DNA is expressed by inhibiting the double-stranded formation of DNA or the denaturation to a single strand by suppressing the inhibition of the double-stranded formation of DNA or the denaturation to a single strand by the structural unit (2) having an anionic charge relative to the cationic structural unit (1) having such a specific structure.

[0264] As described above, in the amphoteric copolymer, the cationic constituent unit (1) is preferably the constituent unit (1-1), and the anionic constituent unit (2) may be the constituent unit (2-1). Since the inhibitory effect of nucleic acid amplification by sandwiched nucleic acid can be sufficiently enhanced even when the content of the target base sequence having a variation relative to the standard base sequence in the sample is low, it is particularly preferable to use an amphoteric copolymer having the constituent unit (1-1) as the cationic constituent unit (1) and the constituent unit (2-1) as the anionic constituent unit (2).

[0265] [Other constituent units (3)]

[0266] The amphoteric copolymer may have other structural units in addition to the above-mentioned cationic structural units (1) and anionic structural units (2).

[0267] Examples of other structural units include a nonionic structural unit (3-1) described below and a cationic structural unit (3-2) having a structure not corresponding to the cationic structural unit (1), that is, not having an amino group.

[0268] From the viewpoint of adjusting the distance between the cationic structural unit (1) and the anionic structural unit (2), the amphoteric copolymer preferably further contains a nonionic structural unit (3-1).

[0269] [Nonionic structural unit (3-1)]

[0270] The nonionic constituent unit (3-1) in the present embodiment is a constituent unit derived from a nonionic monomer that can be copolymerized with the cationic constituent unit (1) and the anionic constituent unit (2), and there is no particular limitation other than this. Preferably, a constituent unit is used that is derived from a methacrylate monomer, an acrylate monomer, a methacrylamide monomer, an acrylamide monomer, sulfur dioxide, etc. More specifically, there can be mentioned constituent units derived from methyl methacrylate, ethyl methacrylate, butyl methacrylate, methyl acrylate, ethyl acrylate, butyl acrylate, methacrylamide, N-methylmethacrylamide, dimethylmethacrylamide, N-(3-dimethylaminopropyl)methacrylamide, acrylamide, dimethylacrylamide, hydroxyethylacrylamide, dimethylaminopropylacrylamide, dimethylaminopropylacrylamide methyl chloride quaternary salt, acryloylmorpholine, isopropylacrylamide, 4-t-butylcyclohexylacrylate, or sulfur dioxide. Particularly preferably, a constituent unit is used that is derived from acrylamide or methacrylamide.

[0271] The nonionic structural unit (3-1) can be introduced into the amphoteric copolymer usually by using a nonionic monomer as a monomer.

[0272] When the amphoteric copolymer has a nonionic constituent unit (3-1), the content of the nonionic constituent unit (3-1) is not particularly limited. In addition, the appropriate amount varies depending on the type of the nonionic constituent unit (3-1). The molar ratio of the nonionic constituent unit (3-1) to the anionic constituent unit (2) is preferably nonionic constituent unit (3-1) / anionic constituent unit (2) = 0.1 / 1 to 1 / 1, more preferably 0.2 / 1 to 0.8 / 1, more preferably 0.3 / 1 to 0.7 / 1, and particularly preferably 0.4 / 1 to 0.6 / 1.

[0273] When the nonionic structural unit (3-1) is derived from a methacrylate monomer, an acrylate monomer, a methacrylamide monomer, or an acrylamide monomer, the above ratio is preferably 0.1 / 1 to 1 / 1, more preferably 0.2 / 1 to 0.8 / 1, more preferably 0.3 / 1 to 0.7 / 1, and particularly preferably 0.4 / 1 to 0.6 / 1.

[0274] When the nonionic structural unit (3-1) is derived from sulfur dioxide, the above ratio is preferably 0.1 / 1 to 1 / 1, particularly preferably 0.2 / 1 to 1 / 1.

[0275] The amphoteric copolymer has a cationic structural unit (1) and an anionic structural unit (2), and may be composed only of the cationic structural unit (1) and the anionic structural unit (2), and may optionally have other structural units in addition to the cationic structural unit (1) and the anionic structural unit (2). Examples of the other structural units include the nonionic structural unit (3-1) described later, and the cationic structural unit (3-2) having a structure that does not correspond to the cationic structural unit (1) having the above-specified structure.

[0276] The total ratio of the cationic structural units (1) and the anionic structural units (2) in the total structural units of the amphoteric copolymer is not particularly limited, but is usually 67 mol% or more, preferably 75 to 100 mol%, more preferably 80 to 100 mol%, and particularly preferably 90 to 100 mol%.

[0277] The molar ratio of the cationic structural unit (1) to the anionic structural unit (2) in the amphoteric copolymer (cationic structural unit (1) / anionic structural unit (2)) is in the range of 0.13 to 1.62.

[0278] When the molar ratio of cationic structural unit (1) / anionic structural unit (2) in the amphoteric copolymer is 0.13 or more, the inhibitory effect of nucleic acid amplification by the nucleic acid sandwich can be enhanced without impairing the function of the cationic structural unit (1) to stabilize the binding between nucleic acid and DNA.

[0279] The molar ratio of the cationic structural unit (1) / the anionic structural unit (2) in the amphoteric copolymer is preferably 0.20 or more, more preferably 0.25 or more, more preferably 0.37 or more, particularly preferably 0.45 or more, and most preferably 0.50 or more.

[0280] When the molar ratio of the cationic structural unit (1) / anionic structural unit (2) in the amphoteric copolymer is 1.62 or less, the cationic structural unit (1) can suppress the double-stranded DNA formation or denaturation into a single strand, thereby expressing the function of stabilizing the binding between nucleic acid and DNA.

[0281] The molar ratio of the cationic structural unit (1) / anionic structural unit (2) in the amphoteric copolymer is preferably 1.30 or less, more preferably 1.25 or less, more preferably 1.13 or less, particularly preferably 1.05 or less, and most preferably 1.00 or less.

[0282] The molar ratio of the cationic structural unit (1) / the anionic structural unit (2) in the amphoteric copolymer is preferably in the range of 0.25 to 1.25, particularly preferably in the range of 0.50 to 1.00.

[0283] The molar ratio of the cationic constituent unit (1) to the anionic constituent unit (2) in the amphoteric copolymer can be determined by reprecipitating the amphoteric copolymer with an organic solvent such as isopropyl alcohol or acetone, and analyzing the reprecipitate using a Perkin Elmer 2400II CHNS / O fully automatic elemental analyzer or an apparatus of equivalent performance in an appropriate mode corresponding to the structure of the above constituent unit, when the structures of the cationic constituent unit (1) and the anionic constituent unit (2) are known. Furthermore, the measurement can be carried out by using helium gas as a carrier gas, measuring a solid sample in a tin capsule, dropping the sample in a combustion tube, and burning the sample in a pure oxygen gas at a combustion temperature of 1800°C or above, detecting each measurement component by a head-on chromatography method using a separation column and a thermal conductivity detector, and quantitatively determining the content of each element using a correction factor. In addition, when the structures of the cationic constituent units (1) and the anionic constituent units (2) in the amphoteric copolymer are unknown, the structures of the respective constituent units are determined by a known method using 1H-NMR or 13C-NMR before the measurement using the above-mentioned elemental analysis device. In addition, it can also be calculated from the amount of each monomer supplied in the production (copolymerization) of the amphoteric copolymer and the amount of each monomer remaining without collecting the amphoteric copolymer. Furthermore, since the ratio (molar ratio) of the constituent units derived from each monomer in the amphoteric copolymer is roughly consistent with the feed composition (molar ratio) of each constituent unit, it is convenient to treat the monomer mixing ratio as the ratio (molar ratio) of the constituent units in this specification.

[0284] The molar ratio of the cationic constituent unit (1) / anionic constituent unit (2) in the amphoteric copolymer can be appropriately adjusted by selecting and adjusting the types and amounts of the monomers supplied in the production (copolymerization) of the amphoteric copolymer, in particular, the monomers from which the cationic constituent unit (1) is derived and the monomers from which the anionic constituent unit (2) is derived, the production (copolymerization) conditions, such as the type and amount of the catalyst, the copolymerization temperature or time, and the like.

[0285] [Method for producing amphoteric copolymer]

[0286] There are no particular restrictions on the method for producing the amphoteric copolymer, and the amphoteric copolymer can be produced by a method known in the prior art. For example, the amphoteric copolymer can be produced by copolymerizing a cationic monomer having a structure corresponding to the cationic constituent unit (1), an anionic monomer having a structure corresponding to the anionic constituent unit (2), and a nonionic monomer having a structure corresponding to the nonionic constituent unit (3) as desired, and other monomers.

[0287] The solvent used when copolymerizing the cationic monomer having a structure corresponding to the cationic constituent unit (1) and the anionic monomer having a structure corresponding to the anionic constituent unit (2) is not particularly limited, and may be an aqueous solvent or an organic solvent such as an alcohol, ether, sulfoxide, amide, etc., preferably an aqueous solvent.

[0288] The monomer concentration when copolymerizing the cationic monomer of the structure corresponding to the cationic constituent unit (1) and the anionic monomer of the structure corresponding to the anionic constituent unit (2) varies depending on the type of monomer and the type of solvent for copolymerization. In the case of an aqueous solvent, it is usually 10 to 75% by mass. This copolymerization reaction is usually a free radical polymerization reaction and is carried out in the presence of a free radical polymerization catalyst. The type of free radical polymerization catalyst is not particularly limited. Preferred examples thereof include peroxides such as t-butyl hydroperoxide, persulfates such as ammonium persulfate, sodium persulfate, potassium persulfate, and water-soluble azo compounds such as azobis and diazo.

[0289] The amount of the radical polymerization catalyst added is generally 0.1 to 20 mol%, preferably 1.0 to 10 mol%, relative to the total monomers. The polymerization temperature is generally 0 to 100° C., preferably 5 to 80° C., and the polymerization time is generally 1 to 150 hours, preferably 5 to 100 hours. The polymerization atmosphere is such that polymerization does not cause a major problem in the air, and the polymerization may also be carried out in an atmosphere of an inert gas such as nitrogen.

[0290]

Nucleic acid amplification reaction

[0291] In the method according to the present embodiment, a nucleic acid amplification reaction is performed using a nucleic acid in a sample as a template using a sandwich nucleic acid and an amphoteric copolymer.

[0292] The nucleic acid amplification method is not particularly limited, and examples thereof include real-time PCR, digital PCR, conventional PCR, PCR methods such as RT-PCR, LAMP, ICAN, NASBA, LCR, SDA, TRC, and TMA. From the perspective of the versatility and simplicity of the method, the nucleic acid amplification method is preferably the PCR method, and from the perspective of easy quantification of the nucleic acid amplification product, the real-time PCR method is more preferred.

[0293] The composition of the reaction solution for nucleic acid amplification varies somewhat depending on the nucleic acid amplification method used. Generally, in addition to the above-mentioned sandwich nucleic acid and amphoteric copolymer, a primer set, deoxynucleoside triphosphates as substrates (for example, dATP, dTTP, dCTP and dGTP: hereinafter collectively referred to as dNTP) and a nucleic acid synthetase (for example, DNA polymerase) are contained in the buffer. Depending on the situation, magnesium ions may also be contained as a cofactor for the nucleic acid synthetase (for example, contained in the reaction solution at a concentration of 1 to 6 mM).

[0294] When a nucleic acid amplification method such as real-time PCR is used that simultaneously performs nucleic acid amplification and detection of the amplified nucleic acid, appropriate detection reagents such as intercalators, fluorescent labeled probes, and circulating probes are also contained in the nucleic acid amplification reaction solution.

[0295] The primer set may be capable of amplifying a region containing the target base sequence by a nucleic acid amplification method, and is usually designed to hybridize with a designated region adjacent to the region to be amplified. The primer sequence may also contain a sequence that hybridizes with a portion of the target base sequence.

[0296] Primers can be composed of nucleic acids such as DNA and RNA. The concentration of primers is usually selected in the range of 20nM to 2μM in the reaction solution. The length of the primer is usually 5 to 40mer, preferably 12 to 35mer, more preferably 14 to 30mer, and more preferably 15 to 25mer. The distance between primers, that is, the region to be amplified is usually 50 to 5000 bases, preferably 100 to 2000 bases. The design of primers can be carried out according to the manual, or appropriate software for primer design can be used. As such software, for example, Primer3 software (http: / / frodo.wi.mit.edu) etc. can be cited.

[0297] The concentration of dNTP is usually selected from dATP, dTTP, dCTP and dGTP, and the concentration of each in the reaction solution is 100 to 400 μM. As nucleic acid synthetase, for example, DNA polymerase, RNA polymerase, reverse transcriptase, etc. can be cited, as long as the enzyme with suitable properties is used corresponding to the nucleic acid amplification method used. For example, when it is a PCR method, TaqDNA polymerase, PfuDNA polymerase, and various heat-resistant DNA polymerases developed by various companies associated with Bioscience are preferably used.

[0298] The buffer preferably has the optimum pH and the optimum salt concentration of the DNA polymerase used. The nucleic acid amplification method may also contain ribonuclease H (RNase H) or reverse transcriptase (RT) etc. Furthermore, since various test kits are commercially available for each nucleic acid amplification method, the nucleic acid amplification reaction solution may also be used with a test kit attached to such a commercially available test kit.

[0299] The concentration of the nucleic acid that serves as a template for the nucleic acid amplification reaction, i.e., the "nucleic acid in the sample", in the reaction solution is usually set to 0.3 ng to 3 μg per 100 μl of reaction solution. However, an excessive amount of nucleic acid that serves as a template increases the frequency of nonspecific amplification, so it is preferably suppressed to less than 0.5 μg per 100 μl of reaction solution.

[0300] As the amount of the sandwich nucleic acid in the reaction solution, it is preferred to select an amount corresponding to the amount of the nucleic acid having the target base sequence estimated to have a mutation relative to the amount of the nucleic acid having the standard base sequence (e.g., wild-type nucleic acid) in the sample, so that when the target base sequence has a mutation, the amplification of the nucleic acid having the standard base sequence is sufficiently suppressed and the nucleic acid containing the target base sequence having a mutation is preferentially amplified. Since the wild-type nucleic acid is usually the majority relative to the mutant nucleic acid in the sample, it is preferably 10 nM to 1 μM, more preferably 20 nM to 500 nM, and particularly preferably 50 nM to 200 nM.

[0301] The concentration of the amphoteric copolymer in the reaction solution is preferably selected to have no adverse effect on the nucleic acid amplification reaction and to be suitable for enhancing the selective inhibitory effect of the nucleic acid amplification reaction by the nucleic acid. The concentration of the amphoteric copolymer in the reaction solution also varies depending on the type of polymer, but is usually 0.001 to 0.500 mass %, preferably 0.010 to 0.300 mass %, more preferably 0.020 to 0.150 mass %, and particularly preferably 0.025 to 0.100 mass %.

[0302] When the above-mentioned sandwich nucleic acid and amphoteric copolymer are used to carry out a nucleic acid amplification reaction using the nucleic acid in the sample as a template, the sandwich nucleic acid strongly binds to the nucleic acid having the standard base sequence, inhibiting the annealing of the primer and / or the extension of the primer during the amplification reaction, and the coexisting amphoteric copolymer enhances this inhibitory effect. On the one hand, since the binding force of the sandwich nucleic acid is greatly reduced for the base sequence having a variation relative to the standard base sequence, the annealing and the extension of the primer are hardly inhibited and the normal nucleic acid amplification reaction occurs. In addition, the amphoteric copolymer itself does not inhibit the nucleic acid amplification reaction. As a result, due to the method of this embodiment, even if the nucleic acid having a variation in the nucleic acid in the sample is a trace amount (for example, less than 0.1% or less than 0.05%, especially less than 0.02%), the nucleic acid having the standard base sequence is dominant, and the amplification of the nucleic acid having the standard base sequence is selectively inhibited, and the nucleic acid having a variation is preferentially amplified, so that the detection of the nucleic acid having a variation contained in an extremely trace amount becomes possible.

[0303] In the method of this embodiment, the presence of a mutation is detected by utilizing the characteristics of the nucleic acid amplification reaction described above. That is, since the amplification of a nucleic acid having a standard base sequence is selectively suppressed, when the target base sequence has a mutation relative to the standard base sequence, the region containing the target base sequence is preferentially amplified. As a result, differences occur in the speed of the nucleic acid amplification reaction, the amount of the reaction product, etc. depending on the presence or absence of the mutation, and these are utilized in the detection of the mutation.

[0304] In this embodiment, the detection of the variation includes a method for detecting the final product of the amplification reaction and a method for confirming the amplification over time during the amplification reaction. For example, the variation can be detected based on the total amount of the obtained nucleic acid amplification product, the number of amplification cycles of the nucleic acid amplification reaction until the total amount of the nucleic acid amplification product reaches a threshold value, the amount of the nucleic acid having the variation in the nucleic acid amplification product, or the number of amplification cycles of the nucleic acid amplification reaction until the amount of the nucleic acid having the variation in the nucleic acid amplification product reaches a threshold value. In particular, from the perspective of the simplicity of implementation or the breadth of the scope of application, the method of detecting the variation based on the number of amplification cycles of the nucleic acid amplification reaction until the total amount of the nucleic acid amplification product reaches a threshold value is preferred.

[0305] In addition, accurate and highly sensitive detection can be performed by confirming the base sequence of the amplification product by direct sequencing, etc. However, as demonstrated in the examples described below, the method of the present invention can accurately and highly sensitively detect mutations without relying on sequence determination.

[0306] As methods for detecting mutations based on the total amount of nucleic acid amplification products, for example, there are methods in which the solution after the amplification reaction is deproteinized with a phenol-chloroform (1:1) solution, the aqueous layer is purified directly or after ethanol precipitation using an appropriate purification kit, and the absorbance of the purified solution at a wavelength of 260 nm is measured using an absorptiophotometer; a method in which the amplification product is developed by electrophoresis using agarose gel or polyacrylamide gel, and then detected by Southern hybridization using an appropriate probe; a method in which detection is performed by chromatographic hybridization using gold nanoparticles; a method in which the turbidity of a solution of the amplified nucleic acid is measured; a method in which the 5' end of the amplification primer is fluorescently labeled in advance, and after the amplification reaction, the fluorescence is collected on an imaging plate after electrophoresis using agarose gel or polyacrylamide gel, and detected using an appropriate detection device, etc.

[0307] As a method for detecting a mutation based on the number of amplification cycles of a nucleic acid amplification reaction until the total amount of nucleic acid amplification products reaches a threshold value, real-time PCR methods such as the intercalator method, the TaqManTM probe method, and the cycle probe method can be cited. Furthermore, the above threshold value can be automatically detected by a real-time PCR device (for example, Step One Plus Real-Time PCR System (manufactured by Thermo Fisher Scientific)).

[0308] The intercalator method is a method using an intercalator fluorescent dye (sometimes also referred to as an intercalator). An intercalator is a reagent that specifically binds to the base pairs of a double-stranded nucleic acid and fluoresces when irradiated with excitation light. The amount of the primer extension product can be known based on the detection of the fluorescence intensity derived from the intercalator. In the present embodiment, by real-time monitoring of this fluorescence intensity, the number of amplification cycles of the nucleic acid amplification reaction until the total amount of the nucleic acid amplification product reaches a threshold value can be known. In the present embodiment, any intercalator commonly used in this field can be used, for example, SYBRTM Green I (Molecular Probe Company), ethidium bromide, fluorene, etc. can be cited.

[0309] The TaqManTM probe method is a method for highly sensitive and quantitative detection of a trace amount of nucleic acid of a target by real-time PCR using an oligonucleotide probe that is hybridized to a specific region of a target nucleic acid and is labeled with a fluorescent group (reporter) at one end (usually, the 5' end) and the other end (usually, the 3' end) with an extinction group. The probe, under normal conditions, suppresses the fluorescence of the reporter by the extinction group. In a state where this fluorescent probe is completely hybridized with the detection region, PCR is performed from its outside using a DNA polymerase. An extension reaction by a DNA polymerase is performed, and the fluorescent probe is hydrolyzed by its exonuclease activity, and the reporter dye is freed and fluoresces. In this embodiment, by real-time monitoring of this fluorescence intensity, the number of amplification cycles of the nucleic acid amplification reaction until the total amount of nucleic acid amplification products reaches a threshold value can be known.

[0310] The cyclic probe method is a highly sensitive detection method that is a combination of a chimeric probe composed of RNA and DNA and RNase H. The probe is labeled with a fluorescent substance (reporter) on one side of the RNA portion and a fluorescence extinguishing substance (quencher) on the other side. This probe does not fluoresce due to quenching in the Imtakt state, but after forming a hybrid with an amplification product complementary to the sequence, the RNA portion is cut off by RNase H, and it becomes strongly fluorescent. In this embodiment, the total amount of nucleic acid amplification products can be known by measuring this fluorescence intensity, and the number of amplification cycles of the nucleic acid amplification reaction until the total amount of nucleic acid amplification products reaches a threshold value can be known by real-time monitoring of the fluorescence intensity.

[0311] This method allows very highly specific detection that can recognize a one-base difference without causing cleavage by RNase H if there is a mismatch near the RNA of the circulating probe. The circulating probe can also be obtained by commissioning the design and synthesis of the circulating probe to an appropriate manufacturer.

[0312] Examples of methods for detecting mutations based on the amount of nucleic acid having base mutations in nucleic acid amplification products include Sanger sequencing and melting curve segmentation.

[0313] As a method for detecting a mutation based on the number of amplification cycles of the nucleic acid amplification reaction until the amount of nucleic acid having a base mutation in the nucleic acid amplification product reaches a threshold value, the above-mentioned real-time PCR method can be applied using a probe that specifically binds to the nucleic acid having a base mutation.

[0314] [2. Kit for detecting mutations in a target base sequence]

[0315] In other embodiments, the present invention provides a kit for implementing the method for detecting a variation in the above-mentioned target base sequence. The kit according to this embodiment comprises:

[0316] A nucleic acid having a base sequence complementary to a standard base sequence and containing at least one non-natural nucleic acid residue,

[0317] An amphoteric copolymer comprising a cationic structural unit (1) containing an amino group in the structure and an anionic structural unit (2), wherein the molar ratio of the cationic structural unit (1) to the anionic structural unit (2) (cationic structural unit (1) / anionic structural unit (2)) is in the range of 0.13 to 1.62,

[0318] In some cases, a primer set capable of amplifying a region containing a target base sequence by a nucleic acid amplification method, and

[0319] Other reagents used to carry out nucleic acid amplification reactions, if necessary.

[0320] The details of the nucleic acid, the amphoteric copolymer, and the primer set are as described in the method for detecting a variation in a target base sequence, and the preferred embodiments and specific examples are also the same as those of the method.

[0321] As other reagents for implementing nucleic acid amplification reaction, nucleoside triphosphates, nucleic acid synthetase, and amplification reaction buffer can be mentioned. Nucleoside triphosphates can contain substrates (dNTP, rNTP, etc.) corresponding to nucleic acid synthetase. Nucleic acid synthetase is an enzyme corresponding to the nucleic acid amplification method as the object of the kit, and DNA polymerase, RNA polymerase, reverse transcriptase, etc. can be mentioned. As the buffer for amplification reaction, for example, Tris buffer, phosphate buffer, Veronal buffer, borate buffer, Good buffer, etc., can be mentioned when implementing a common nucleic acid amplification reaction or hybridization reaction, and its pH is not particularly limited, and is usually preferably in the range of 5 to 9.

[0322] In addition, the kit according to this embodiment may contain reagents for detecting the above-mentioned nucleic acid amplification reaction product, for example, intercalators, fluorescently labeled probes, cycling probes, etc. used for real-time PCR.

[0323] In addition, other components generally used in nucleic acid amplification reaction reagents such as stabilizers and preservatives may be contained.

[0324] Furthermore, the primer set and other reagents used to perform the nucleic acid amplification reaction are necessary for performing the nucleic acid amplification reaction and may not be included in the kit. In addition, reagents for detecting nucleic acid amplification reaction products or other components such as stabilizers and preservatives are optional components in the nucleic acid amplification reaction and may not be included in the kit.

[0325] [3. Method for inhibiting amplification of a nucleic acid having a specified target base sequence in a nucleic acid amplification reaction]

[0326] Furthermore, in another embodiment, the present invention provides a method for inhibiting the amplification of a nucleic acid having a specified target base sequence. In this method, a nucleic acid amplification reaction using the above nucleic acid as a template is carried out using the following substances:

[0327] A nucleic acid having a base sequence complementary to a target base sequence, comprising a non-natural nucleic acid of at least one residue, and

[0328] An amphoteric copolymer comprising a cationic structural unit (1) containing an amino group in its structure and an anionic structural unit (2), wherein the molar ratio of the cationic structural unit (1) to the anionic structural unit (2) (cationic structural unit (1) / anionic structural unit (2)) is in the range of 0.13 to 1.62.

[0329] In the method of this embodiment, "sample" is a sample presumed to contain a nucleic acid that is a target of amplification inhibition, "target base sequence" is a base sequence that is a target of amplification inhibition, and "nucleic acid in the sample" is a nucleic acid that is likely to contain a base sequence that is a target of amplification inhibition. However, these terms do not mean that "nucleic acid in the sample" actually contains a base sequence that is a target of amplification inhibition.

[0330] In addition, the "sandwich nucleic acid" in this embodiment has a base sequence complementary to the "target base sequence", and the presence of such a "sandwich nucleic acid" inhibits the amplification of the nucleic acid having the "target base sequence".

[0331] In this embodiment, by allowing the above-mentioned specific amphiphilic copolymer to coexist with a sandwich nucleic acid having a base sequence complementary to the target base sequence in the nucleic acid amplification reaction, the effect of the sandwich nucleic acid on inhibiting the amplification of the nucleic acid having the target base sequence is enhanced, and the amplification of the nucleic acid can be selectively inhibited even when the nucleic acid having the target base sequence is present in a large amount in the sample.

[0332] The sample and other points of the nucleic acid in the sample are as described in the method for variation in the base sequence of the object to be detected, and the preferred embodiments and specific examples are also the same as the method. In addition, the details of the nucleic acid and the amphoteric copolymer are also as described in the method for variation in the base sequence of the object to be detected, and the preferred embodiments and specific examples are also the same as the method. In addition, the details of the reagents for implementing the nucleic acid amplification reaction and the nucleic acid amplification reaction are also as described in the method for variation in the base sequence of the object to be detected and the kit, and the preferred embodiments and specific examples are also the same as the method and the kit. Of course, in the method of this embodiment, it is not necessary to detect the inhibition of amplification of the nucleic acid having a specified object base sequence, and the necessary steps and reagents for such detection are implemented or used as needed.

[0333] [4. Kit for inhibiting amplification of a nucleic acid having a specified target base sequence in a nucleic acid amplification reaction]

[0334] Furthermore, in another embodiment, the present invention provides a kit for implementing a method for inhibiting the amplification of a nucleic acid having a target base sequence in the above-mentioned nucleic acid amplification reaction. The kit according to this embodiment comprises:

[0335] A nucleic acid having a base sequence complementary to a target base sequence, containing at least one non-natural nucleotide residue, and

[0336] An amphoteric copolymer comprising a cationic structural unit (1) containing an amino group in the structure and an anionic structural unit (2), wherein the molar ratio of the cationic structural unit (1) to the anionic structural unit (2) (cationic structural unit (1) / anionic structural unit (2)) is in the range of 0.13 to 1.62,

[0337] In some cases, a primer set capable of amplifying a region containing a target base sequence by a nucleic acid amplification method, and

[0338] Other reagents used to carry out nucleic acid amplification reactions, if necessary.

[0339] The terms "sample", "target base sequence", "nucleic acid in sample" and "sandwich nucleic acid" in this embodiment have the same meanings as described in the method for inhibiting amplification of a nucleic acid having a target base sequence in a nucleic acid amplification reaction.

[0340] In addition, the sample and other points of the nucleic acid in the sample are as described in the method for detecting the variation in the base sequence of the object, and the preferred embodiments and specific examples are also the same as the method. In addition, the details of the sandwich nucleic acid and the amphiphilic copolymer are also as described in the method for detecting the variation in the base sequence of the object, and the preferred embodiments and specific examples are also the same as the method. In addition, the details of the implementation of the nucleic acid amplification reaction and the reagents for the nucleic acid amplification reaction are also as described in the method and kit for detecting the variation in the base sequence of the object, and the preferred embodiments and specific examples are also the same as the method.

[0341] [5. Nucleic acid amplification inhibition enhancer that enhances the inhibition of nucleic acid amplification by sandwich nucleic acid]

[0342] Furthermore, in another embodiment, the present invention provides a nucleic acid amplification inhibition enhancer that enhances the effect of inhibiting the amplification of a nucleic acid having a base sequence complementary to that of a sandwich nucleic acid in a nucleic acid amplification reaction.

[0343] This reinforcing agent comprises an amphoteric copolymer having a cationic structural unit (1) containing an amino group in its structure and an anionic structural unit (2), wherein the molar ratio of the cationic structural unit (1) to the anionic structural unit (2) (cationic structural unit (1) / anionic structural unit (2)) is in the range of 0.13 to 1.62.

[0344] The "nucleic acid amplification" performed using this enhancer is performed using a "sandwich nucleic acid having a base sequence complementary to the above-mentioned target base sequence and containing a non-natural nucleotide of at least 1 residue", and the terms "sample", "target base sequence", "nucleic acid in the sample" and "sandwich nucleic acid" in this embodiment have the same meaning as described in the method for inhibiting the amplification of a nucleic acid having a target base sequence in a nucleic acid amplification reaction.

[0345] In addition, the "enhancer of the effect of nucleic acid inhibition by intercalation" according to this embodiment contains the above-mentioned amphoteric copolymer, which is also described in the method for detecting a variation in a target base sequence, and the preferred embodiments and specific examples are also the same as those of the method.

[0346] [Example]

[0347] Hereinafter, the present invention will be described in more detail with reference to Examples, but the present invention is not limited to these Examples.

[0348] 【1. Effect of polymer addition on PCR reaction】

[0349] A specific amphoteric copolymer (implemented product) or a polymer or monomer of a comparative product that can be used in the method of the present invention is added to a PCR reaction solution, and the influence on the PCR reaction is confirmed.

[0350] [1-1. Aqueous polymer solution used]

[0351] The polymers or monomers shown in the following table were dissolved in water to prepare a 10 mass % aqueous solution at pH 7.0. In the table, all product names are product names of NITTOBO MEDICAL Co., Ltd. The polymerization conditions of polymers 1 to 18 are as follows.

[0352] Polymer 1: 160.07 g (0.80 mol) of 66.78% by mass diallylamine hydrochloride, 78.45 g (0.80 mol) of anhydrous maleic acid, and 91.86 g of distilled water were added to a 500 mL four-mouth bottle equipped with a thermometer, a stirrer, and a cooling tube, and the internal temperature was raised to 50° C. A 28.5% by mass ammonium persulfate aqueous solution was added only in such a manner that the amount of ammonium persulfate in the aqueous solution was 0.5% by mass relative to the total amount of monomers, and polymerization was started. After 4 hours, an amount of ammonium persulfate to be 0.5% by mass relative to the total amount of monomers was added, after 20 and 26 hours, an amount of ammonium persulfate to be 1.0% by mass relative to the total amount of monomers was added, and after 45 and 51 hours, an amount of ammonium persulfate to be 1.5% by mass relative to the total amount of monomers was added, and the reaction was allowed to proceed for 68 hours.

[0353] Polymer 2: 1.86 kg (19.0 mol) of anhydrous maleic acid and 0.34 kg of distilled water were added to a 20 L four-mouth bottle equipped with a thermometer, a stirrer, and a cooling tube, and 2.11 kg (19.0 mol) of diallylmethylamine was added dropwise under cooling. Thereafter, the internal temperature was raised to 50°C. A 28.5% by mass aqueous solution of ammonium persulfate was added only in an amount of 0.5% by mass relative to the total amount of monomers to start polymerization. After 3, 21, and 25 hours, the above-mentioned aqueous solution of ammonium persulfate was added in an amount of 1.0% by mass relative to the total amount of monomers, and the reaction was further allowed to proceed overnight.

[0354] Polymer 3: 842.93 g of distilled water and 488.34 g (4.98 mol) of anhydrous maleic acid were added to a 3 L four-mouth bottle equipped with a thermometer, a stirrer, and a cooling tube. Thereafter, 342.60 g (6.00 mol) of allylamine was added dropwise while cooling, and the temperature was raised to 65°C. A 28.5% by mass aqueous solution of ammonium persulfate was added only in an amount of 1 mol% of ammonium persulfate relative to the total amount of monomers to start polymerization. After 3 hours, 1 mol% of ammonium persulfate was added relative to the total amount of monomers, and after 24 and 28 hours, 2 mol% of ammonium persulfate was added relative to the total amount of monomers, and the reaction was further allowed to proceed overnight.

[0355] Polymer 4: In a 300 mL four-necked bottle equipped with a thermometer, a stirrer, and a cooling tube, 16.15 g (corresponding to 0.04 mol) of dimethylaminopropylmethacrylamide hydrochloride (solid content concentration 51.2 mass %), 2.93 g (corresponding to 0.04 mol) of acrylamide (solid content concentration 97 mass %), 5.82 g (corresponding to 0.08 mol) of acrylic acid (solid content concentration 99 mass %), and 143.86 g of distilled water were added, and the temperature was raised to 60° C. A 28.5 mass % aqueous solution of ammonium persulfate was added every 2 hours in amounts of 0.25, 0.5, 0.5, and 0.75 mol % of ammonium persulfate, respectively, relative to the total amount of the monomers, and the reaction was continued overnight.

[0356] Polymer 5: In a 300 mL four-necked bottle equipped with a thermometer, a stirrer, and a cooling tube, 20.17 g (equivalent to 0.05 mol) of dimethylaminopropylmethacrylamide hydrochloride (solid content concentration 51.2 mass %), 3.66 g (equivalent to 0.05 mol) of acrylamide (solid content concentration 97 mass %), 8.69 g (equivalent to 0.10 mol) of methacrylic acid (solid content concentration 99 mass %), and 192.43 g of distilled water were added, and the temperature was raised to 60° C. A 28.5 mass % aqueous solution of ammonium persulfate was added every 2 hours in amounts of 0.25, 0.5, 0.5, and 0.75 mol % of ammonium persulfate relative to the total amount of monomers, respectively, and the reaction was continued overnight.

[0357] Polymer 6: 20.43 g (corresponding to 0.1 mol) of diallylamine hydrochloride (solid content concentration 65.40 mass %) and 110.9 g of distilled water were added to a 300 mL four-necked flask equipped with a thermometer, a stirrer, and a cooling tube, and the temperature was raised to 65° C. After adding 28.5 mass % of ammonium persulfate in an amount of 2.0 mol % relative to the total amount of monomers, 30 minutes later, a solution of 7.11 g (corresponding to 0.1 mol) of acrylamide (solid content concentration 97 mass %), 14.56 g (corresponding to 0.2 mol) of acrylic acid (solid content concentration 99 mass %), and 21.15 g of distilled water was added dropwise over 3 hours, and the reaction was continued overnight.

[0358] Polymer 7: In a 300 mL four-necked bottle equipped with a thermometer, a stirrer, and a cooling tube, 29.15 g (equivalent to 0.30 mol) of diallylamine (concentration 100 mass%), 27.86 g (equivalent to 0.24 mol) of fumaric acid (concentration 100 mass%), and 227.45 g of distilled water were added, and the temperature was raised to 50° C. 0.57 g (equivalent to 0.0054 mol) of sodium hypophosphite (concentration 100 mass%) was added, and a 28.5 mass% aqueous solution of ammonium persulfate was added in eight portions so that the ammonium persulfate was 10 mass% relative to the total amount of the monomers, and polymerization was carried out at 50° C.

[0359] Polymer 8: Into a 300 mL four-mouth flask equipped with a thermometer, a stirrer, and a cooling tube, 16.15 g (0.04 mol) of 51.2% N-dimethylaminopropylmethacrylamide hydrochloride, 5.86 g (0.08 mol) of 97.0% acrylamide, 5.82 g (0.08 mol) of 99.0% acrylic acid, and 169.36 g of distilled water were charged, and the internal temperature was raised to 60°C. A 28.5% by mass aqueous solution of ammonium persulfate was added in an amount of 0.25 mol% of ammonium persulfate relative to the total amount of monomers to start polymerization. After 2 and 4 hours, an amount of 0.5 mol% of ammonium persulfate relative to the total amount of monomers was added, and after 6 hours, an amount of 0.75 mol% of ammonium persulfate relative to the total amount of monomers was added, and the reaction was allowed to proceed for 24 hours.

[0360] Polymer 9: Into a 300 mL four-mouth flask equipped with a thermometer, a stirrer, and a cooling tube, 14.13 g (0.035 mol) of 51.2% N-dimethylaminopropylmethacrylamide hydrochloride, 2.56 g (0.035 mol) of 97.0% acrylamide, 10.19 g (0.140 mol) of 99.0% acrylic acid, and 171.23 g of distilled water were charged, and the internal temperature was raised to 60°C. A 28.5% by mass ammonium persulfate aqueous solution was added in an amount such that the ammonium persulfate was 0.25 mol% relative to the total amount of monomers to start polymerization. After 2 and 4 hours, the ammonium persulfate aqueous solution was added in an amount such that the ammonium persulfate was 0.5 mol% relative to the total amount of monomers, and after 6 hours, the ammonium persulfate aqueous solution was added in an amount such that the ammonium persulfate was 0.75 mol% relative to the total amount of monomers, and the reaction was allowed to proceed for 24 hours.

[0361] Polymer 10: In a 300 mL four-necked bottle equipped with a thermometer, a stirrer, and a cooling tube, 18.17 g (equivalent to 0.05 mol) of dimethylaminopropyl methacrylamide hydrochloride (solid content concentration 51.2 mass %) and 74.86 g of distilled water were added, and the temperature was raised to 60° C. A 28.5 mass % aqueous ammonium persulfate solution was added every hour so that the ammonium persulfate was 0.25, 0.5, 0.5, and 0.75 mol % relative to the total amount of the monomers, respectively, and the reaction was continued at 60° C. overnight.

[0362] Polymer 11: 189.16 g of distilled water (an amount to obtain a monomer concentration of 10% by mass) was added to a 300 mL four-necked flask equipped with a thermometer, a stirrer, and a cooling tube, and the temperature was raised to 60° C. A 28.5% by mass aqueous solution of ammonium persulfate was added so that the ammonium persulfate was 3.0% by mass relative to the total amount of the monomers, and then 63.06 g of a 40% by mass aqueous solution of acrylic acid was added dropwise over 3 hours, and the reaction was continued at 60° C. overnight.

[0363] Polymer 12: 10.63 g (0.065 mol) of 57.22% by mass allylamine hydrochloride, 253.02 g (1.235 mol) of 65.22% by mass diallylamine hydrochloride, and 31.35 g of distilled water were added to a 1L four-mouth flask equipped with a thermometer, a stirrer, and a cooling tube, and the temperature was raised to 60°C. A 28.5% by mass ammonium persulfate aqueous solution was added only in an amount such that the ammonium persulfate was 0.25% by mass relative to the total amount of monomers to start polymerization. After 3, 5, and 21 hours, the above-mentioned ammonium persulfate aqueous solution in an amount such that the ammonium persulfate was 0.25% by mass relative to the total amount of monomers was added, and after 23, 25, 27, and 29 hours, the above-mentioned ammonium persulfate aqueous solution in an amount such that the ammonium persulfate was 0.50% by mass relative to the total amount of monomers was added, and the reaction was further carried out overnight.

[0364] Polymer 13: Into a 300 mL four-mouth flask equipped with a thermometer, a stirrer, and a cooling tube, 124.37 g (0.50 mol) of 65.0% diallyldimethylammonium chloride, 4.44 g (0.06 mol) of acrylamide, 0.85 g of sodium hypophosphite, and 84.39 g of distilled water were charged, and the internal temperature was raised to 50°C. A 28.5% by mass ammonium persulfate aqueous solution was added only in an amount such that the ammonium persulfate was 0.2% by mass relative to the total amount of monomers, and polymerization was started. After 4 hours, an amount of ammonium persulfate was added in an amount of 0.3% by mass relative to the total amount of monomers, after 23 hours, an amount of ammonium persulfate was added in an amount of 0.5% by mass relative to the total amount of monomers, and after 28 hours, an amount of ammonium persulfate was added in an amount of 1.0% by mass relative to the total amount of monomers, and the reaction was continued for 48 hours.

[0365] Polymer 14: 209.67 g (1.3 mol) of 58.01% by mass of allylamine hydrochloride and 248.51 g (1.3 mol) of 63.61% by mass of dimethylallylamine hydrochloride were added to a 1L four-mouth flask equipped with a thermometer, a stirrer, and a cooling tube, and the temperature was raised to 60°C. The initiator V-50 (2,2'-azobis(2-methylpropionamidine) dihydrochloride) was added in three portions so that V-50 was 12 mol% relative to the total amount of monomers, and polymerization was performed for 72 hours. Thereafter, a heating decomposition treatment was performed at 60°C for 48 hours. Thereafter, 449.28 g (2.81 mol) of sodium hydroxide at a concentration of 25% by mass was added under cooling at 30°C or less, and the reaction was performed at 40°C for 24 hours. Thereafter, the monomer removal was performed using a distiller (50°C, 3 hours). After the monomer removal, the concentration was adjusted to 15% and desalination by electrodialysis was performed (approximately 3 hours, and ended 1 hour after the conductivity completely dropped).

[0366] Polymer 15: 25.95 g of distilled water, 0.088 mol of diallylmethylamine hydrochloride aqueous solution and 0.011 mol of acrylamide were charged into a 100 ml three-necked flask equipped with a stirrer, a thermometer and a glass stopper, and the temperature was raised to 55° C. A 28.5 mass % aqueous ammonium persulfate solution was added in 7 portions so that the ammonium persulfate was 4.0 mol % relative to the total amount of monomers, and polymerization was carried out at 55° C.

[0367] Polymer 16: 24.71 g of distilled water, 0.06 mol of diallylmethylamine hydrochloride aqueous solution and N-isopropylacrylamide were added to a 100 ml three-necked flask equipped with a stirrer, a thermometer and a glass stopper, and the temperature was raised to 55° C. A 28.5 mass % aqueous ammonium persulfate solution was added in 7 portions so that the ammonium persulfate was 3.25 mol % relative to the total amount of monomers, and polymerization was carried out at 55° C.

[0368] Polymer 17: In a 300 mL four-necked bottle equipped with a thermometer, a stirrer, and a cooling tube, 32.30 g (equivalent to 0.08 mol) of dimethylaminopropylmethacrylamide hydrochloride (solid content concentration 51.2 mass %), 2.93 g (equivalent to 0.04 mol) of acrylamide (solid content concentration 97 mass %), 2.91 g (equivalent to 0.04 mol) of acrylic acid (solid content concentration 99 mass %), and 184.49 g of distilled water were added, and the temperature was raised to 60° C. A 28.5 mass % aqueous solution of ammonium persulfate was added every 2 hours in amounts of 0.25, 0.5, 0.5, and 0.75 mol % of ammonium persulfate relative to the total amount of monomers, respectively, and the reaction was continued overnight.

[0369] Polymer 18: In a 300 mL four-necked flask equipped with a thermometer, a stirrer, and a cooling tube, 32.30 g (corresponding to 0.08 mol) of dimethylaminopropylmethacrylamide hydrochloride (solid content concentration 51.2 mass %), 2.93 g (corresponding to 0.04 mol) of acrylamide (solid content concentration 97 mass %), 3.44 g (corresponding to 0.04 mol) of methacrylic acid (solid content concentration 99 mass %), and 189.55 g of distilled water were added, and the temperature was raised to 60° C. A 28.5 mass % aqueous solution of ammonium persulfate was added every 2 hours in amounts of 0.25, 0.5, 0.5, and 0.75 mol % of ammonium persulfate relative to the total amount of monomers, respectively, and the reaction was continued overnight.

[0370]

Table 1

[0371]

[0372]

[0373] 【1-2. PCR reaction solution】

[0374] Prepare a PCR reaction solution with the composition shown in the following table.

[0375]

Table 2

[0376]

[0377]

[0378] *1 : Contains Tag polymerase (TaKaRa Ex Taq HS), dNTP mixture, Mg 2+ and a fluorescent dye (TB Green). The final concentration in the PCR reaction solution of each polymer aqueous solution is 0.01% by mass.

[0379] 【1-3. Primers and template DNA】

[0380] The sequences of the forward primer and the reverse primer used in the PCR reaction are shown in the following table.

[0381]

Table 3

[0382] Primers sequence Sequence number Forward Primer GCCTGCTGAA AATGACTGAA TATA SEQ ID NO: 1 Reverse primer CAAGATTTAC CTCTATTGTT GGA SEQ ID NO: 2

[0383] Each primer targets the KRAS gene (the base sequence can be confirmed in, for example, NCBI (database name)) and is designed using Primer3 (obtained from http: / / frodo.wi.mit.edu).

[0384] As the template DNA, use the genome extracted from HCC70 cells containing the following base sequence (amplification target sequence).

[0385]

Chemical 27

[0386] GCCTGCTGAA AATGACTGAA TATAAACTTG TGGTAGTTGG AGCTGGTGGC GTAGGCAAGAGTGCCTTGAC GATACAGCTA ATTCAGAATC ATTTTGTGGA CGAATATGAT CCAACAATAG AGGTAAATCTTG (SEQ ID NO: 3)

[0387] Furthermore, in the HCC70 cell genome, the base sequence adjacent to the above base sequence is as follows.

[0388]

Chemical 28

[0389] TGAGTTTGTA TTAAAAGGTA CTGGTGGAGT ATTTGATAGT GTATTAACCT TATGTGTGACATGTTCTAAT ATAGTCACAT TTTCATTATT TTTATTATAA GGCCTGCTGA AAATGACTGA ATATAAACTTGTGGTAGTTG GAGCTGGTGG CGTAGGCAAG AGTGCCTTGA CGATACAGCT AATTCAGAAT CATTTTGTGGACGAATATGA TCCAACAATA GAGGTAAATC TTGTTTTAAT ATGCATATTA CTGGTGCAGG ACCATTCTTTGATACACGAT AAAGGTTTCT CTGACCATTT (SEQ ID NO: 4)

[0390] 【1-4. Real-time PCR system】

[0391] The Step One Plus Real-Time PCR System (Thermo Fisher Scientific) was used.

[0392] 【1-5. PCR reaction】

[0393] 20 μL of the prepared PCR reaction solution was placed in a real-time PCR system, and step (i) described in the following table was performed, and then steps (ii) to (iv) were repeated for 40 cycles.

[0394]

Table 4

[0395] step temperature time i 95℃ 30 seconds ii 95℃ 5 seconds iii 55℃ 30 seconds iv 72℃ 30 seconds v 95℃ 15 seconds vi 60℃ 60 seconds vii 95℃ 15 seconds

[0396] After 40 cycles, proceed to steps (v) to (vii) to terminate the reaction. The fluorescence intensity of the reaction solution is measured in each cycle to monitor the amount of DNA amplification. In addition, after the reaction is completed, the presence or absence of inhibition of the PCR reaction is determined by whether the fluorescence intensity reaches the threshold line. The threshold line is automatically calculated by the above device. Sometimes, when it is necessary to set it lower than usual according to the experiment, it is manually set to a ΔRn value between 0.7 and 1.2 in order to compare with other experiments in the same column.

[0397] 【1-5. Results】

[0398] The success or failure of the PCR reaction is shown in the following table.

[0399]

Table 5

[0400]

[0401]

[0402] ○: Does not inhibit PCR reaction.

[0403] ×: PCR reaction is inhibited.

[0404] In addition, an example of a nucleic acid amplification curve when the PCR reaction is not inhibited (copolymer of diallylmethylamine·maleic acid 1:1 in Example 2) and an example of a nucleic acid amplification curve when the PCR reaction is inhibited (copolymer of diallyldimethylammonium chloride·acrylamide 8:1 in Comparative Example 7) are shown in FIG. Figure 1 .

[0405] As described above, when the polymers of Examples 1 to 9, which are amphoteric copolymers having cationic constituent units and anionic constituent units containing amines in their structures, with the cationic constituent unit / anionic constituent unit ratio being in the range of 0.25 to 1.25, or when the monomers of Comparative Examples 13 or 14 are added, the PCR reaction is not inhibited.

[0406] 【2. Enhancement of the selective amplification inhibition effect of wild-type genes clamped by BNA by polymer】

[0407] The polymers of Examples 1 to 9 and the monomers of Comparative Examples 13 and 14, which were confirmed not to inhibit the PCR reaction in Test 1, were evaluated for their enhancement of the inhibitory effect on the amplification of the wild-type KRAS gene in BNA clamp PCR.

[0408] 【2-1. Polymers or monomers used】

[0409] The polymers used were those of Examples 1 to 9 and the monomers used were those of Comparative Examples 13 and 14. Each polymer or monomer was dissolved in nuclease-free water to prepare an aqueous solution of the polymer or monomer at pH 7.0 and a concentration of 10%.

[0410] The obtained 10% aqueous polymer solution or monomer solution was diluted to a concentration that did not inhibit the PCR reaction based on the results of Test 1. The following table shows the concentration of each aqueous polymer or monomer solution used in this test and the concentration of the polymer or monomer in the reaction solution.

[0411]

Table 6

[0412]

[0413]

[0414] 【2-2. Kit used】

[0415] Use the attachments of the BNA Clamp KRAS Enrichment Kit (RIKEN Genesis) as a kit for detecting mutant KRAS genes. The following describes the details, including the primer set and the BNA clamp, using the kit attachments. Additionally, the reaction conditions for real-time PCR follow the kit protocol.

[0416] 【2-3. Primers, BNA Clamp, and Template DNA】

[0417] Use the forward primer, reverse primer, and BNA clamp shown in the following table.

[0418]

Table 7

[0419] sequence Sequence number Forward Primer CTGAATATAA ACTTGTGGTA GTTGG SEQ ID NO: 5 Reverse primer GTCCTGCACC AGTAATATGC SEQ ID NO: 6 BNA Clip C*C*T*AC*GC*C*AC*C* SEQ ID NO: 7

[0420] *: Represents the base of an artificial nucleotide.

[0421] Additionally, as the template DNA with a standard base sequence, use the genome of HCC70 cells with a wild-type KRAS gene having the following base sequence (amplification target sequence; bases different from the base sequence of SEQ ID NO: 10 described later are underlined and bolded).

[0422]

Chemical 29

[0423] CTGAATATAA ACTTGTGGTA GTTGGAGCTG GTG G CGTAGG CAAGAGTGCC TTGACGATACAGCTAATTCA GAATCATTTT GTGGACGAAT ATGATCCAAC AATAGAGGTA AATCTTGTTT TAATATGCATATTACTGGTG CAGGAC (SEQ ID NO: 8)

[0424] Furthermore, in the HCC70 cell genome, the above base sequence and the adjacent base sequence are as follows (bases different from the base sequence of SEQ ID NO: 11 described later are underlined and bolded).

[0425]

Chemical 30

[0426] TGAGTTTGTA TTAAAAGGTA CTGGTGGAGT ATTTGATAGT GTATTAACCT TATGTGTGACATGTTCTAAT ATAGTCACAT TTTCATTATT TTTATTATAA GGCCTGCTGA AAATGACTGA ATATAAACTTGTGGTAGTTG GAGCTGGTG G CGTAGGCAAG AGTGCCTTGA CGATACAGCT AATTCAGAAT CATTTTGTGGACGAATATGA TCCAACAATA GAGGTAAATC TTGTTTTAAT ATGCATATTA CTGGTGCAGG ACCATTCTTTGATACACGAT AAAGGTTTCT CTGACCATTT (SEQ ID NO: 9)

[0427] On the other hand, as a template DNA having a mutation relative to the standard base sequence, the genome of MDA-MB-231 cells having a mutant KRAS gene having the following base sequence (sequence to be amplified; bases different from the base sequence of SEQ ID NO: 8 are indicated by underlined boldface letters) was used.

[0428]

Chemistry 31

[0429] CTGAATATAA ACTTGTGGTA GTTGGAGCTG GTG A CGTAGG CAAGAGTGCC TTGACGATACAGCTAATTCA GAATCATTTT GTGGACGAAT ATGATCCAAC AATAGAGGTA AATCTTGTTT TAATATGCATATTACTGGTG CAGGAC (SEQ ID NO: 10)

[0430] In the genome of MDA-MB-231 cells, the above base sequence and the base sequence adjacent thereto are as follows (bases different from the base sequence of the above-mentioned SEQ ID NO: 9 are indicated by underlined boldface characters).

[0431]

Chemistry 32

[0432] TGAGTTTGTA TTAAAAGGTA CTGGTGGAGT ATTTGATAGT GTATTAACCT TATGTGTGACATGTTCTAAT ATAGTCACAT TTTCATTATT TTTATTATAA GGCCTGCTGA AAATGACTGA ATATAAACTTGTGGTAGTTG GAGCTGGTG A CGTAGGCAAG AGTGCCTTGA CGATACAGCT AATTCAGAAT CATTTTGTGGACGAATATGA TCCAACAATA GAGGTAAATC TTGTTTTAAT ATGCATATTA CTGGTGCAGG ACCATTCTTTGATACACGAT AAAGGTTTCT CTGACCATTT (SEQ ID NO: 11)

[0433] 【2-4. BNA clamp PCR reaction solution】

[0434] Reaction solutions 1 to 4 having the compositions shown in the following table were prepared. In reaction solution 1 or reaction solution 2, the concentration of the polymer or monomer was 0.025% by mass. In reaction solution 1 or reaction solution 2, the concentration of the polymer or monomer was as shown in Table 6 above.

[0435] [Table 8: Reaction solution 1 (polymer or monomer + 、BNA clip + )】

[0436]

[0437] *1 :Contains Tag polymerase (TaKaRa Ex Taq HS), dNTP mixture, Mg 2+ and fluorescent dye (TB Green).

[0438] [Table 9: Reaction solution 2 (polymer or monomer + 、BNA clip - )】

[0439]

[0440]

[0441] *1 :Contains Tag polymerase (TaKaRa Ex Taq HS), dNTP mixture, Mg 2+ and fluorescent dye (TB Green).

[0442] [Table 10: Reaction solution 3 (polymer or monomer - 、BNA clip + )】

[0443]

[0444] *1 :Contains Tag polymerase (TaKaRa Ex Taq HS), dNTP mixture, Mg 2+ and fluorescent dye (TB Green).

[0445] [Table 11: Reaction solution 4 (polymer or monomer - 、BNA clip - )】

[0446]

[0447] *1 :Contains Tag polymerase (TaKaRa Ex Taq HS), dNTP mixture, Mg 2+ and fluorescent dye (TB Green).

[0448] 【2-5. Real-time PCR system】

[0449] The Step One Plus Real-Time PCR System (Thermo Fisher Scientific) was used.

[0450] 【2-6. PCR reaction】

[0451] 20 μL of each reaction solution was weighed into a PCR tube, and the PCR tube was placed in a real-time PCR system. After performing step (i) described in the following table, steps (ii) to (iv) were repeated for 50 cycles. After 50 cycles, steps (v) to (vii) were performed to terminate the reaction. The fluorescence intensity of the reaction solution was measured in each cycle to monitor the amount of DNA amplification and obtain the proliferation curve of each reaction solution.

[0452]

Table 12

[0453] step temperature time i 95℃ 30 seconds ii 95℃ 5 seconds iii 58℃ 30 seconds iv 72℃ 30 seconds v 95℃ 15 seconds vi 60℃ 60 seconds vii 95℃ 15 seconds

[0454] [2-7. Calculation of ΔCt(WT) and ΔCt(Variant) when a polymer is added or not added, calculation of ΔΔCt when a polymer is added or not added, and calculation of ΔΔΔCt]

[0455] The above-mentioned PCR reaction was carried out using reaction solution 1 (polymer added, BNA clamp added), reaction solution 2 (polymer added, BNA clamp not added), reaction solution 3 (polymer not added, BNA clamp added) and reaction solution 4 (polymer not added, BNA clamp not added) as template DNA, and the wild-type KRAS gene or the mutant KRAS gene was used to obtain an amplification curve, and the respective Ct values ​​were obtained from the amplification curve of each condition according to the set threshold line (in most experimental distinctions, the threshold line is automatically calculated by the device. Sometimes, when it is necessary to set it lower than usual according to the experiment, in order to compare with other experiments in the same column, the ΔRn value is manually set to between 0.7 and 1.2).

[0456] Next, ΔCt(WT) and ΔCt(variant) in the case where no polymer was added were calculated from the following formula.

[0457]

Number 1

[0458] ΔCt(WT) when no polymer was added = Ct(WT) when reaction solution 3 (no polymer was added, BNA clamp was added) - Ct(WT) when reaction solution 4 (no polymer was added, BNA clamp was not added)

[0459]

Number 2

[0460] ΔCt (variant) when no polymer was added = Ct (variant) when reaction solution 3 (no polymer was added, BNA clamp was added) - Ct (variant) when reaction solution 4 (no polymer was added, BNA clamp was not added)

[0461] Furthermore, in order to confirm non-specific amplification in the intercalator-free method, ΔΔCt in the case where no polymer was added was calculated according to the following formula.

[0462]

Number 3

[0463] ΔΔCt when no polymer is added = ΔCt when no polymer is added (WT) - ΔCt when no polymer is added (variant)

[0464] When ΔΔCt>0 in the case where no polymer was added, it was understood that it was nonspecific amplification in the non-intercalator method.

[0465] Next, ΔCt(WT) and ΔCt(variant) in the case of adding a polymer were calculated from the following formulas. Furthermore, ΔΔCt in the case of adding a polymer was calculated in order to confirm non-specific amplification in the intercalator-free method.

[0466]

Number 4

[0467] ΔCt(WT) when polymer was added = Ct(WT) when reaction solution 1 (polymer added, BNA clamp added) - Ct(WT) when reaction solution 2 (polymer added, BNA clamp not added)

[0468]

Number 5

[0469] ΔCt (variant) in the case of polymer addition = Ct (variant) in the case of reaction solution 1 (polymer addition, BNA clamp addition) - Ct (variant) in the case of reaction solution 2 (polymer addition, BNA clamp not added)

[0470]

Number 6

[0471] ΔΔCt of the case where the polymer was added = ΔCt of the case where the polymer was added (WT) - ΔCt of the case where the polymer was added (variant)

[0472] When ΔΔCt>0 in the case of adding a polymer, it is understood that it is nonspecific amplification in the method without an intercalator.

[0473] Finally, ΔΔΔCt was calculated from the following formula as an index for evaluating the enhancement of the effect of selectively suppressing the amplification of the wild-type gene clamped by the BNA by the addition of the polymer.

[0474]

Number 7

[0475] ΔΔΔCt = ΔΔCt when polymer was added - ΔΔCt when polymer was not added

[0476] Even considering the fluctuation of the results that may occur in the experiment, when using a variation detection method that uses the amplification cycle number of the wild-type gene as a benchmark, such as the intercalator method, when ΔΔΔCt≥1.00, it can be evaluated that the selective amplification inhibition effect of the wild-type gene clamped by BNA is sufficiently enhanced. In addition, when using a variation detection method that uses the amplification cycle number of the wild-type gene as a benchmark, such as the intercalator method, when ΔΔΔCt≥3.20, it can be evaluated that the selective amplification inhibition effect of the wild-type gene clamped by BNA is significantly enhanced. Furthermore, ΔΔΔCt=3.20 is the benchmark for an approximately 10-fold increase in sensitivity.

[0477] 【2-8. Results】

[0478] Next, the test results are comprehensively displayed.

[0479]

Table 13

[0480]

[0481] A: ΔΔΔCt is above 3.20,

[0482] B: ΔΔΔCt is greater than 1.00 and less than 3.20,

[0483] C: ΔΔΔCt less than 1.00

[0484] The above test results show that the addition of the polymers of Examples 1 to 9 does not inhibit the amplification of the mutant gene, and the selective amplification inhibitory effect of the wild-type gene sandwiched by BNA is enhanced. In addition, it is shown that the polymers of Examples 1, 2, 4 to 9 (amphoteric copolymers with secondary or tertiary amino groups in cationic constituent units) and the polymer of Example 3 (amphoteric copolymers with primary amino groups in cationic constituent units) have a greater enhancement effect on the inhibitory effect of nucleic acid amplification by sandwiched nucleic acids. A coordinate diagram of an example of enhancing the selective amplification inhibitory effect of wild-type genes is shown in FIG2.

[0485] 【3. Higher sensitivity of PCR by BNA-addition to polymer】

[0486] Using the polymers of Examples 1, 2, 4, and 6, which were confirmed to enhance the selective amplification inhibition effect of the wild-type gene by the BNA clamp in the above-mentioned test, an experiment was conducted to test the high sensitivity of the BNA clamp PCR.

[0487] 【3-1. Use of polymer】

[0488] The polymers used were those of Examples 1, 2, 4 and 6. The concentration of each polymer solution and the final concentration in the PCR reaction solution are shown in the table below.

[0489]

Table 14

[0490]

[0491] 【3-2. Kit used】

[0492] The same accessories of the kit as in Experiment 2 were used.

[0493] 【3-3. Template DNA】

[0494] As the template DNA having the standard base sequence, the genome of HCC70 cells having the wild-type KRAS gene having the base sequence of SEQ ID NO: 8 was used. In addition, as the template DNA having a mutation relative to the standard base sequence, the genome of MDA-MB-231 cells having the mutant KRAS gene having the base sequence of SEQ ID NO: 10 was used.

[0495] In this experiment, the total amount of template DNA was adjusted to 50 ng in 2.0 μL, and the mass % of template DNA of the mutant gene in the total template DNA was adjusted to be as shown in the table below. The template DNA of the wild-type gene and the template DNA of the mutant gene were mixed, and the resulting template DNA mixtures and the template DNA of the wild-type gene were used in the PCR reaction.

[0496]

Table 15

[0497] Variant ratio Variant copy number 10% variant (5ng) <![CDATA[1.65×10 3 Number of copies]]> 1% variant (0.5ng) <![CDATA[1.65×10 2 Number of copies]]> 0.1% variant (0.05ng) 1.65×10 copies 0.01% variant (0.005ng) 1.65 copies

[0498] 【3-4. Primers and BNA clamp】

[0499] The same primers and BNA clamps as in Experiment 2 were used.

[0500] 【3-5. BNA clamp PCR reaction solution】

[0501] Reaction solutions 1 and 2 having the compositions shown in the following table were prepared. In the reaction solution 1, the concentration of the polymer was as shown in Table 14 above.

[0502] [Table 16: Reaction solution 1 (polymer + 、BNA clip + )】

[0503] Element content <![CDATA[PCR Buffer TB Green Premix Dimer Eraser *1 (Made by Takara Biotech)]]> 10.0μL 10 μM forward primer (Riken Genesis) 0.6μL 10 μM reverse primer (Riken Genesis) 0.6μL ROX dye (produced by Takara Bio) 0.4μL 10 μM BNA clamp (Riken Genesis) 0.2μL <![CDATA[50 ng / μL template DNA (WT *2 or WT and variants *3 mixture *4 )]]> 2.0μL 0.1 mass% polymer aqueous solution 2.0μL Nuclease-free water (Thermo Fisher Scientific) 4.2μL

[0504] *1 :Contains Tag polymerase (TaKaRa Ex Taq HS), dNTP mixture, Mg 2+ and fluorescent dye (TBGreen).

[0505] *2 :Genomic DNA of HCC70 cells

[0506] *3 : Genomic DNA of MDA-MB-231 cells

[0507] *4 : The entire mixture contains 50 ng / μL of template DNA in 2.0 μL.

[0508] [Table 17: Reaction solution 2 (polymer - 、BNA clip + )】

[0509] Element content <![CDATA[PCR Buffer TB Green Premix Dimer Eraser *1 (Made by Takara Biotech)]]> 10.0μL 10 μM forward primer (Riken Genesis) 0.6μL 10 μM reverse primer (Riken Genesis) 0.6μL ROX dye (produced by Takara Bio) 0.4μL 10 μM BNA clamp (Riken Genesis) 0.2μL <![CDATA[50 ng / μL template DNA (WT *2 or WT and variants *3 mixture *4 )]]> 2.0μL Polymer aqueous solution 0μL Nuclease-free water (Thermo Fisher Scientific) <![CDATA[6.2μL *2 ]]>

[0510] *1 :Contains Tag polymerase (TaKaRa Ex Taq HS), dNTP mixture, Mg 2+and fluorescent dye (TB Green).

[0511] *2 :Genomic DNA of HCC70 cells

[0512] *3 : Genomic DNA of MDA-MB-231 cells

[0513] *4 : The entire mixture contains 50 ng / μL of template DNA in 2.0 μL.

[0514] 【3-6. Real-time PCR system and PCR reaction】

[0515] The PCR reaction was carried out under the same conditions as in Experiment 2 using the same real-time PCR system as in Experiment 2.

[0516] [3-7. Determination of δCt (variant 10% to 0.01%) when a polymer is added or not added, and calculation of δδCt (variant 10% to 0.01%) when a polymer is added or not added]

[0517] Reaction solution 1 (polymer added, BNA clamp added) and reaction solution 2 (polymer not added, BNA clamp added) were subjected to the above-mentioned PCR reaction using template DNA or a mixture of each template DNA to obtain an amplification curve. Ct (variant 10% to 0%) was determined from the amplification curve of each condition in the same manner as in Experiment 2. As shown in the table below, Ct (variant 10% to 0.01%) of each mutant gene template concentration was subtracted from Ct (variant 0%, WT) to calculate δCt (variant 10% to 0.01%) for each case with or without polymer addition.

[0518] [Table 18: Calculation formula of δCt (variant 10% to 0.01%) when no polymer is added]

[0519] Variants 10％ 1％ 0.10％ 0.01％ 0％ Ct ① ② ③ ④ ⑤ δCt ⑤-① ⑤-② ⑤-③ ⑤-④

[0520] [Table 19: Calculation formula of δCt (variant 10% to 0.01%) when polymer is added]

[0521] Variants 10％ 1％ 0.10％ 0.01％ 0％ Ct A B C D E δCt EA EB EC ED

[0522] Finally, δδCt (variant 10% to 0.01%) was calculated by subtracting δCt (variant 10% to 0.01%) when no polymer was added from δCt (variant 10% to 0.01%) when the polymer was added.

[0523] When using a variant detection method such as the intercalator method that uses the amplification cycle number of the wild-type gene as a benchmark, the case of δδCt>0 indicates that the variant gene is specifically detected by adding a polymer, and the amplification curve of the variant gene is distinguished from the amplification curve of the wild-type gene (reference: Patent Document 11).

[0524] 【3-8. Results】

[0525] The test results are shown in the following table and Figure 3. In the case where the polymer with a variant ratio of 0.01% was not added, the δCt was -0.68.

[0526]

Table 20

[0527]

[0528] A: δδCt is above 3.20,

[0529] B: δδCt is greater than 1.00 and less than 3.20

[0530] The results of this experiment show that when the polymer is not added, the variant ratio is 0.01% by mass, resulting in δCt less than 0, and the amplification curve of the mutant gene cannot be distinguished from the amplification curve of the wild-type gene. When the polymer of Example 1, 2, 4 or 6 is added, the amplification curve of the mutant gene can be distinguished from the amplification curve of the wild-type gene even at a variant ratio of 0.01% by mass. In addition, it is shown that, in particular, when the polymer of Example 2 is added (the cationic structural unit is a structural unit having a structure represented by the above-mentioned general formula (Ia) or general formula (Ib), and the anionic structural unit is an amphoteric copolymer represented by the above-mentioned general formula (II-a)), the effect of enhancing the inhibitory effect of nucleic acid amplification by the sandwich nucleic acid becomes particularly large under the condition of a variant ratio of 0.1% or less. In addition, in this experiment, although the reaction solution without BNA sandwich addition was not tested, the results of Experiment 2 show that in the reaction solution without BNA sandwich addition, there is no nonspecific amplification regardless of the presence or absence of polymer addition.

[0531] [4. Possibility of adaptation to mutant genes other than KRAS 1 (Enhancement of the selective amplification inhibitory effect of wild-type genes sandwiched by BNA by polymer)]

[0532] 【4-1. Polymers used】

[0533] The polymers used in Experiment 2 were the polymers of Examples 1, 2, 4, 6 and 7. The concentrations of the polymer solutions and the polymer concentrations in the PCR reaction solutions are shown in the following table.

[0534]

Table 21

[0535]

[0536] 【4-2. Kit Used】

[0537] Use the accessories of the BNA clamp BRAF Enrichment Kit (RIKEN Genesis) as a kit for detecting the mutant BRAF gene. The detailed content is described below. The primer set and the BNA clamp use the kit accessories. In addition, the reaction conditions for real-time PCR follow the kit procedure.

[0538] 【4-3. Template DNA】

[0539] As the template DNA with the standard base sequence, use the genome of HCC70 cells with the wild-type BRAF gene having the following base sequence (the bases different from the base sequence of SEQ ID NO: 13 described later are underlined and bolded).

[0540]

Chemical 33

[0541] ATAGAAATTA GATCTCTTAC CTAAACTCTT CATAATGCTT GCTCTGATAG GAAAATGAGATCTACTGTTT TCCTTTACTT ACTACACCTC AGATATATTT CTTCATGAAG ACCTCACAGT AAAAATAGGTGATTTTGGTC TAGCTACAG T GAAATCTCGA TGGAGTGGGT CCCATCAGTT TGAACAGTTG TCTGGATCCATTTTGTGGAT GGTAAGAATT GAGGCTATTT TTCCACTGAT TAAATTTTTG GCCCTGAGAT GCTGCTGAGTTACTAGAAAG TCATTGAAGG TCTCAACTAT(SEQ ID NO: 12)

[0542] Furthermore, note that the above sequence contains base sequences other than the amplification target sequence.

[0543] On the other hand, as the template DNA with a mutation relative to the standard base sequence, use the genome of DU4475 cells with the mutant BRAF gene having the following base sequence (the bases different from the base sequence of SEQ ID NO: 12 described above are underlined and bolded).

[0544]

Chemical 34

[0545] ATAGAAATTA GATCTCTTAC CTAAACTCTT CATAATGCTT GCTCTGATAG GAAAATGAGATCTACTGTTT TCCTTTACTT ACTACACCTC AGATATATTT CTTCATGAAG ACCTCACAGT AAAAATAGGTGATTTTGGTC TAGCTACAG A GAAATCTCGA TGGAGTGGGT CCCATCAGTT TGAACAGTTG TCTGGATCCATTTTGTGGAT GGTAAGAATT GAGGCTATTT TTCCACTGAT TAAATTTTTG GCCCTGAGAT GCTGCTGAGTTACTAGAAAG TCATTGAAGG TCTCAACTAT (SEQ ID NO: 13)

[0546] Furthermore, it should be noted that the above sequence includes base sequences other than the sequence to be amplified.

[0547] 【4-4. BNA clamp PCR reaction solution】

[0548] Reaction solutions 1 to 4 having the compositions shown in the following table were prepared. In addition, in reaction solution 1 or reaction solution 2, the concentration of the polymer was as shown in Table 21 above.

[0549] [Table 22: Reaction solution 1 (polymer + 、BNA clip + )】

[0550]

[0551] *1 :Contains Tag polymerase (TaKaRa Ex Taq HS), dNTP mixture, Mg 2+ and fluorescent dye (TB Green).

[0552] [Table 23: Reaction solution 2 (polymer +, BNA clamp -)]

[0553]

[0554]

[0555] *1 :Contains Tag polymerase (TaKaRa Ex Taq HS), dNTP mixture, Mg 2+ and fluorescent dye (TB Green).

[0556] [Table 24: Reaction solution 3 (polymer - 、BNA clip + )】

[0557]

[0558] *1 :Contains Tag polymerase (TaKaRa Ex Taq HS), dNTP mixture, Mg 2+ and fluorescent dye (TB Green).

[0559] [Table 25: Reaction solution 4 (polymer - 、BNA clip - )】

[0560]

[0561] *1 :Contains Tag polymerase (TaKaRa Ex Taq HS), dNTP mixture, Mg 2+ and fluorescent dye (TB Green).

[0562] 【4-5. Real-time PCR system and PCR reaction】

[0563] The PCR reaction was carried out in the same manner as in Experiment 2 using the same system as in Experiment 2.

[0564] [4-6. Calculation of ΔCt(WT) and ΔCt(Variant) when a polymer is added or not added, calculation of ΔΔCt when a polymer is added or not added, and calculation of ΔΔΔCt]

[0565] The same procedure as in Test 2 was carried out.

[0566] 【4-7. Results】

[0567] Next, the test results are comprehensively displayed.

[0568]

Table 26

[0569]

[0570] As described above, all polymers enhanced the selective amplification inhibitory effect of the wild-type gene clamped by BNA in the same manner as the KRAS gene. It was found that the amplification inhibitory effect was greater than ΔΔΔCt=3.2, which is the standard for a 10-fold increase in sensitivity.

[0571] 【5. Confirmation of high sensitivity of BNA-clamp PCR using plasmid DNA and sequence analysis of PCR products】

[0572] 【5-1. Polymers used】

[0573] The same polymers as those used in Experiment 3 (the polymers of Examples 1, 2, 4, and 6) were used. The concentrations of each polymer solution and the concentrations in the PCR reaction solution are shown in the following table.

[0574]

Table 27

[0575]

[0576] 【5-2. Kits Used】

[0577] The accessories of the same kit as that used in Experiment 2 were used.

[0578] 【5-3. Template DNA】

[0579] The template DNA used was Figure 4 the KRAS WT / mutant plasmid DNA shown in Figure 4 . The content ratio (mutation ratio) of the mutant DNA in the template DNA was set to 0.01%. Furthermore,

[0580]

Chemical Formula 35

[0581] CATTATTTTT ATTATAAGGC CTGCTGAAAA TGACTGAATA TAAACTTGTG GTAGTTGGAGCTGGTG G CGT AGGCAAGAGT GCCTTGACGA TACAGCTAAT TCAGAATCAT TTTGTGGACG AATATGATCCAACAATAGAG GTAAATCTTG TTTTAATATG CATATTACTG GTGCAGGACC ATTCTTTGAT ACACGATAAAGGTTTCAAGC TT(SEQ ID NO: 14)

[0582]

Chemical Formula 36

[0583] CATTATTTTT ATTATAAGGC CTGCTGAAAA TGACTGAATA TAAACTTGTG GTAGTTGGAGCTGGTG ACGT AGGCAAGAGT GCCTTGACGA TACAGCTAAT TCAGAATCAT TTTGTGGACG AATATGATCCAACAATAGAG GTAAATCTTG TTTTAATATG CATATTACTG GTGCAGGACC ATTCTTTGAT ACACGATAAAGGTTTCAAGC TT (SEQ ID NO: 15)

[0584] 【5-4. Primers and BNA clamp】

[0585] The same primers and BNA clamps as in Experiment 2 were used.

[0586] 【5-5. BNA clamp PCR reaction solution】

[0587] Reaction solutions 1 and 2 having the compositions shown in the following table were prepared.

[0588] [Table 28: Reaction solution 1 (polymer + 、BNA clip + )】

[0589] Element content <![CDATA[PCR Buffer TB Green Premix Dimer Eraser *1 (Made by Takara Biotech)]]> 10.0μL 10 μM forward primer (Riken Genesis) 0.6μL 10 μM reverse primer (Riken Genesis) 0.6μL ROX dye (produced by Takara Bio) 0.4μL 10 μM BNA clamp (Riken Genesis) 0.2μL 250ng / μL salmon sperm DNA 0.2μL <![CDATA[Templated DNA *2 > 2.0μL Polymer aqueous solution 2.0μL Nuclease-free water (Thermo Fisher Scientific) 4.0μL

[0590] *1 :Contains Tag polymerase (TaKaRa Ex Taq HS), dNTP mixture, Mg 2+ and fluorescent dye (TB Green).

[0591] *2 : 50 copies of KRAS variant plasmid DNA and (5×10 5 -50) copies of KRAS WT plasmid DNA (variant ratio: 0.01%).

[0592] [Table 29: Reaction solution 2 (polymer - 、BNA clip + )】

[0593] Element content <![CDATA[PCR Buffer TB Green Premix Dimer Eraser *1 (Made by Takara Biotech)]]> 10.0μL 10 μM forward primer (Riken Genesis) 0.6μL 10 μM reverse primer (Riken Genesis) 0.6μL ROX dye (produced by Takara Bio) 0.4μL 10 μM BNA clamp (Riken Genesis) 0.2μL 250ng / μL salmon sperm DNA 0.2μL <![CDATA[Templated DNA *2 > 2.0μL Polymer aqueous solution 0μL Nuclease-free water (Thermo Fisher Scientific) 6.0μL

[0594] *1 :Contains Tag polymerase (TaKaRa Ex Taq HS), dNTP mixture, Mg 2+ and fluorescent dye (TB Green).

[0595] *2 : In 2.0 μL, 50 copies of KRAS variant plasmid DNA and (5×10 5-50) copies of KRAS WT plasmid DNA (variant ratio: 0.01%).

[0596] 【5-6. Real-time PCR system and PCR reaction】

[0597] The PCR reaction was carried out under the same conditions as in Experiment 2 using the same P real-time PCR system as in Experiment 2.

[0598] [5-7. Determination of δCt(WT) and δCt(Variant) when a polymer is added or not added, and calculation of δδCt when a polymer is added or not added]

[0599] The same procedure as in Test 3 was carried out.

[0600] 【5-8. Sequence analysis of PCR products】

[0601] The PCR products obtained from the PCR reaction were commissioned to Fasmac for sequence analysis using direct sequencing ( Figure 6 ).

[0602] 【5-9. Results】

[0603] 【5-9-1. Study on improving the sensitivity of BNA-clamp PCR】

[0604] The test results are shown in the following table and FIG5 .

[0605]

Table 30

[0606]

[0607] A: δδCt is above 3.20,

[0608] B: δδCt is greater than 1.00 and less than 3.20

[0609] The results of this test showed that when no polymer was added, the variant ratio was 0.01%, and it was difficult to detect the mutant gene. When the polymer of Example 1, 2, 4 or 6 was added, the mutant gene could be reliably detected even at a variant ratio of 0.01%.

[0610] 【5-9-1. Sequence analysis of PCR products】

[0611] like Figure 6 As shown, at a variant ratio of 0.01%, mutations can be detected even when no polymer is added. As can be understood from the peak of the base surrounded by the dotted frame, as a whole, the PCR product when the polymer is added has a significantly higher mutation content, achieving significantly higher sensitivity than when the polymer is not added.

Claims

1. A method for detecting a variation in a target base sequence of a nucleic acid in a sample relative to a standard base sequence for a non-diagnostic purpose, the method comprising performing a nucleic acid amplification reaction using the nucleic acid in the sample as a template using the following substances: A nucleic acid comprising a base sequence complementary to the standard base sequence, a non-natural nucleotide containing at least one residue, and Amphoteric copolymers, It has a cationic structural unit (1) containing an amino group and an anionic structural unit (2). The molar ratio of the cationic constituent unit (1) to the anionic constituent unit (2) is in the range of 0.13 to 1.62, At least a part of the cationic structural unit (1) is a structural unit (1-1), (1-3) or (1-4) having a structure represented by the following general formula (Ia), (Ib), (Ie) or (If) or a structure of an acid addition salt thereof: In the formula, R 1 represents a hydrogen atom, an alkyl group having 1 to 10 carbon atoms which may have a hydroxyl group, a cycloalkyl group having 5 to 10 carbon atoms, or an aralkyl group having 7 to 10 carbon atoms, In the formula, R 4 and R 5 each independently represents a hydrogen atom, an alkyl group having 1 to 12 carbon atoms which may have a hydroxyl group, an aralkyl group having 7 to 12 carbon atoms, or a cycloalkyl group having 5 to 6 carbon atoms, or In the formula, R 6 represents a hydrogen atom or a methyl group, R 7 and R 8 each independently represents a hydrogen atom or an alkyl group having 1 to 4 carbon atoms, n is an integer from 2 to 4, and At least a part of the anionic structural unit (2) is a structural unit (2-1), (2-2) or (2-4) having a structure represented by the following general formula (II-a), (II-b) or (II-d): In the formula, R 9 represents hydrogen or methyl, Y each independently represents hydrogen, Na, K, NH4, 1 / 2Ca, 1 / 2Mg, 1 / 2Fe, 1 / 3Al, or 1 / 3Fe, In the formula, Y each independently represents hydrogen, Na, K, NH4, 1 / 2Ca, 1 / 2Mg, 1 / 2Fe, 1 / 3Al, or 1 / 3Fe, or In the formula, R 10 represents hydrogen or methyl, Y is each independently hydrogen, Na, K, NH4, 1 / 2Ca, 1 / 2Mg, 1 / 2Fe, 1 / 3Al or 1 / 3Fe, The presence of the variation is determined based on the total amount of nucleic acid amplification products obtained by the nucleic acid amplification reaction, the number of amplification cycles of the nucleic acid amplification reaction until the total amount of the nucleic acid amplification products reaches a threshold value, the amount of nucleic acid having the variation in the nucleic acid amplification products, or the number of amplification cycles of the nucleic acid amplification reaction until the amount of nucleic acid having the variation in the nucleic acid amplification products reaches a threshold value. 2 . The method according to claim 1 , wherein the cationic structural unit (1) is selected from the group consisting of structural unit (1-1) and structural unit (1-4). 3 . The method according to claim 1 , wherein the anionic structural unit (2) is selected from the group consisting of structural unit (2-1) and structural unit (2-4).

4. The method according to claim 1, wherein the amphoteric copolymer further comprises a nonionic structural unit (3) derived from a methacrylamide-based monomer or an acrylamide-based monomer.

5. The method of claim 1, wherein in the amphoteric copolymer, At least a part of the cationic structural unit (1) is a structural unit (1-1) having a structure represented by the general formula (Ia) or the general formula (Ib) or a structure which is an acid addition salt thereof: In the formula, R 1 represents a hydrogen atom, an alkyl group having 1 to 10 carbon atoms which may have a hydroxyl group, a cycloalkyl group having 5 to 10 carbon atoms, or an aralkyl group having 7 to 10 carbon atoms, At least a part of the anionic structural unit (2) is a structural unit (2-1) represented by the general formula (II-a): In the formula, R 9 is hydrogen or methyl, Y is independently hydrogen, Na, K, NH4, 1 / 2Ca, 1 / 2Mg, 1 / 2Fe, 1 / 3Al or 1 / 3Fe for each bonded carboxyl group. The method of claim 1 , wherein the non-natural nucleotide is a BNA.

7. The method of claim 1, wherein the nucleic acid amplification is performed using real-time PCR.

8. The method of claim 1, wherein the nucleic acid is genomic DNA.

9. The method according to any one of claims 1 to 8, wherein a nucleic acid amplification reaction using a nucleic acid having the standard base sequence as a template is further performed. When the number of amplification cycles of the nucleic acid amplification reaction until the total amount of the nucleic acid amplification product reaches a threshold when the nucleic acid in the sample is used as a template is smaller than the number of amplification cycles of the nucleic acid amplification reaction until the total amount of the nucleic acid amplification product reaches a threshold when the nucleic acid having the standard base sequence is used as a template, it is determined that the variation exists in the target base sequence of the nucleic acid in the sample.

10. A kit for detecting a variation in a target base sequence of a nucleic acid in a sample relative to a standard base sequence, comprising: A nucleic acid having a base sequence complementary to the standard base sequence, containing at least one non-natural nucleotide residue, and Amphoteric copolymers, It has a cationic structural unit (1) containing an amino group and an anionic structural unit (2). The molar ratio of the cationic constituent unit (1) to the anionic constituent unit (2) is in the range of 0.13 to 1.62, At least a part of the cationic structural unit (1) is a structural unit (1-1), (1-3) or (1-4) having a structure represented by the following general formula (Ia), (Ib), (Ie) or (If) or a structure of an acid addition salt thereof: In the formula, R 1 represents a hydrogen atom, an alkyl group having 1 to 10 carbon atoms which may have a hydroxyl group, a cycloalkyl group having 5 to 10 carbon atoms, or an aralkyl group having 7 to 10 carbon atoms, In the formula, R 4 and R 5 each independently represents a hydrogen atom, an alkyl group having 1 to 12 carbon atoms which may have a hydroxyl group, an aralkyl group having 7 to 12 carbon atoms, or a cycloalkyl group having 5 to 6 carbon atoms, or In the formula, R 6 represents a hydrogen atom or a methyl group, R 7 and R 8 each independently represents a hydrogen atom or an alkyl group having 1 to 4 carbon atoms, n is an integer from 2 to 4, and At least a part of the anionic structural unit (2) is a structural unit (2-1), (2-2) or (2-4) having a structure represented by the following general formula (II-a), (II-b) or (II-d): In the formula, R 9 represents hydrogen or methyl, Y each independently represents hydrogen, Na, K, NH4, 1 / 2Ca, 1 / 2Mg, 1 / 2Fe, 1 / 3Al, or 1 / 3Fe, In the formula, Y each independently represents hydrogen, Na, K, NH4, 1 / 2Ca, 1 / 2Mg, 1 / 2Fe, 1 / 3Al, or 1 / 3Fe, or In the formula, R 10 represents hydrogen or methyl, Y is each independently hydrogen, Na, K, NH4, 1 / 2Ca, 1 / 2Mg, 1 / 2Fe, 1 / 3Al or 1 / 3Fe. 11 . The kit according to claim 10 , wherein the cationic constitutional unit (1) is selected from the constitutional unit (1-1) and the constitutional unit (1-4). 12 . The kit according to claim 10 , wherein the anionic constitutional unit (2) is selected from the constitutional unit (2-1) and the constitutional unit (2-4).

13. The kit according to claim 10, wherein the amphoteric copolymer further comprises a nonionic structural unit (3) derived from a methacrylamide-based monomer or an acrylamide-based monomer.

14. The kit of claim 10, wherein in the amphiphilic copolymer, At least a part of the cationic structural unit (1) is a structural unit (1-1) having a structure represented by the general formula (Ia) or the general formula (Ib) or a structure which is an acid addition salt thereof: In the formula, R 1 represents a hydrogen atom, an alkyl group having 1 to 10 carbon atoms which may have a hydroxyl group, a cycloalkyl group having 5 to 10 carbon atoms, or an aralkyl group having 7 to 10 carbon atoms, At least a part of the anionic structural unit (2) is a structural unit (2-1) represented by the general formula (II-a): In the formula, R 9 is hydrogen or methyl, Y is independently hydrogen, Na, K, NH4, 1 / 2Ca, 1 / 2Mg, 1 / 2Fe, 1 / 3Al or 1 / 3Fe for each bonded carboxyl group.

15. The kit according to any one of claims 10 to 14, wherein the non-natural nucleotide is BNA.

16. A method for inhibiting amplification of a nucleic acid in a sample having a specified target base sequence in a nucleic acid amplification reaction, wherein the nucleic acid amplification reaction is carried out using the nucleic acid in the sample as a template using the following substances: A nucleic acid having a base sequence complementary to the target base sequence, containing at least one non-natural nucleotide residue, and Amphoteric copolymers, It has a cationic structural unit (1) containing an amino group and an anionic structural unit (2). The molar ratio of the cationic constituent unit (1) to the anionic constituent unit (2) is in the range of 0.13 to 1.62, At least a part of the cationic structural unit (1) is a structural unit (1-1), (1-3) or (1-4) having a structure represented by the following general formula (Ia), (Ib), (Ie) or (If) or a structure of an acid addition salt thereof: In the formula, R 1 represents a hydrogen atom, an alkyl group having 1 to 10 carbon atoms which may have a hydroxyl group, a cycloalkyl group having 5 to 10 carbon atoms, or an aralkyl group having 7 to 10 carbon atoms, In the formula, R 4 and R 5 each independently represents a hydrogen atom, an alkyl group having 1 to 12 carbon atoms which may have a hydroxyl group, an aralkyl group having 7 to 12 carbon atoms, or a cycloalkyl group having 5 to 6 carbon atoms, or In the formula, R 6 represents a hydrogen atom or a methyl group, R 7 and R 8 each independently represents a hydrogen atom or an alkyl group having 1 to 4 carbon atoms, n is an integer from 2 to 4, and At least a part of the anionic structural unit (2) is a structural unit (2-1), (2-2) or (2-4) having a structure represented by the following general formula (II-a), (II-b) or (II-d): In the formula, R 9 represents hydrogen or methyl, Y each independently represents hydrogen, Na, K, NH4, 1 / 2Ca, 1 / 2Mg, 1 / 2Fe, 1 / 3Al, or 1 / 3Fe, In the formula, Y each independently represents hydrogen, Na, K, NH4, 1 / 2Ca, 1 / 2Mg, 1 / 2Fe, 1 / 3Al, or 1 / 3Fe, or In the formula, R 10 represents hydrogen or methyl, Y is each independently hydrogen, Na, K, NH4, 1 / 2Ca, 1 / 2Mg, 1 / 2Fe, 1 / 3Al or 1 / 3Fe.

17. The method according to claim 16, wherein the cationic structural unit (1) is selected from the group consisting of structural unit (1-1) and structural unit (1-4).

18. The method according to claim 16, wherein the anionic constitutional unit (2) is selected from constitutional unit (2-1) and constitutional unit (2-4).

19. The method according to claim 16, wherein the amphoteric copolymer further comprises a nonionic structural unit (3) derived from a methacrylamide-based monomer or an acrylamide-based monomer.

20. The method of claim 16, wherein in the amphiphilic copolymer, At least a part of the cationic structural unit (1) is a structural unit (1-1) having a structure represented by the general formula (Ia) or the general formula (Ib) or a structure which is an acid addition salt thereof: In the formula, R 1 represents a hydrogen atom, an alkyl group having 1 to 10 carbon atoms which may have a hydroxyl group, a cycloalkyl group having 5 to 10 carbon atoms, or an aralkyl group having 7 to 10 carbon atoms, At least a part of the anionic structural unit (2) is a structural unit (2-1) represented by the general formula (II-a): In the formula, R 9 is hydrogen or methyl, Y is independently hydrogen, Na, K, NH4, 1 / 2Ca, 1 / 2Mg, 1 / 2Fe, 1 / 3Al or 1 / 3Fe for each bonded carboxyl group.

21. The method of any one of claims 16 to 20, wherein the non-natural nucleotide is a BNA.

22. A kit for inhibiting amplification of a nucleic acid having a target base sequence in a nucleic acid amplification reaction, comprising: A nucleic acid having a base sequence complementary to the target base sequence, containing at least one non-natural nucleotide residue, and Amphoteric copolymers, It has a cationic structural unit (1) containing an amino group and an anionic structural unit (2). The molar ratio of the cationic constituent unit (1) to the anionic constituent unit (2) is in the range of 0.13 to 1.62, At least a part of the cationic structural unit (1) is a structural unit (1-1), (1-3) or (1-4) having a structure represented by the following general formula (Ia), (Ib), (Ie) or (If) or a structure of an acid addition salt thereof: In the formula, R 1 represents a hydrogen atom, an alkyl group having 1 to 10 carbon atoms which may have a hydroxyl group, a cycloalkyl group having 5 to 10 carbon atoms, or an aralkyl group having 7 to 10 carbon atoms, In the formula, R 4 and R 5 each independently represents a hydrogen atom, an alkyl group having 1 to 12 carbon atoms which may have a hydroxyl group, an aralkyl group having 7 to 12 carbon atoms, or a cycloalkyl group having 5 to 6 carbon atoms, or In the formula, R 6 represents a hydrogen atom or a methyl group, R 7 and R 8 each independently represents a hydrogen atom or an alkyl group having 1 to 4 carbon atoms, n is an integer from 2 to 4, and At least a part of the anionic structural unit (2) is a structural unit (2-1), (2-2) or (2-4) having a structure represented by the following general formula (II-a), (II-b) or (II-d): In the formula, R 9 represents hydrogen or methyl, Y each independently represents hydrogen, Na, K, NH4, 1 / 2Ca, 1 / 2Mg, 1 / 2Fe, 1 / 3Al, or 1 / 3Fe, In the formula, Y each independently represents hydrogen, Na, K, NH4, 1 / 2Ca, 1 / 2Mg, 1 / 2Fe, 1 / 3Al, or 1 / 3Fe, or In the formula, R 10 represents hydrogen or methyl, Y is each independently hydrogen, Na, K, NH4, 1 / 2Ca, 1 / 2Mg, 1 / 2Fe, 1 / 3Al or 1 / 3Fe.

23. The kit according to claim 22, wherein the cationic constitutional unit (1) is selected from the constitutional unit (1-1) and the constitutional unit (1-4).

24. The kit according to claim 22, wherein the anionic constitutional unit (2) is selected from constitutional unit (2-1) and constitutional unit (2-4).

25. The kit according to claim 22, wherein the amphoteric copolymer further comprises a nonionic structural unit (3) derived from a methacrylamide-based monomer or an acrylamide-based monomer.

26. The kit of claim 22, wherein in the amphiphilic copolymer, At least a part of the cationic structural unit (1) is a structural unit (1-1) having a structure represented by the general formula (Ia) or the general formula (Ib) or a structure which is an acid addition salt thereof: In the formula, R 1 represents a hydrogen atom, an alkyl group having 1 to 10 carbon atoms which may have a hydroxyl group, a cycloalkyl group having 5 to 10 carbon atoms, or an aralkyl group having 7 to 10 carbon atoms, At least a part of the anionic structural unit (2) is a structural unit (2-1) represented by the general formula (II-a): In the formula, R 9 is hydrogen or methyl, Y is independently hydrogen, Na, K, NH4, 1 / 2Ca, 1 / 2Mg, 1 / 2Fe, 1 / 3Al or 1 / 3Fe for each bonded carboxyl group.

27. The kit according to any one of claims 22 to 26, wherein the non-natural nucleotide is a BNA.

28. An enhancer for the effect of suppressing nucleic acid amplification of a nucleic acid having a target base sequence by a sandwich nucleic acid, wherein the clamp nucleic acid has a base sequence complementary to the target base sequence and contains at least one non-natural nucleotide residue, The reinforcing agent comprises an amphoteric copolymer, wherein: It has a cationic structural unit (1) containing an amino group in its structure and an anionic structural unit (2), The molar ratio of the cationic constituent unit (1) to the anionic constituent unit (2) is in the range of 0.13 to 1.62, At least a part of the cationic structural unit (1) is a structural unit (1-1), (1-3) or (1-4) having a structure represented by the following general formula (Ia), (Ib), (Ie) or (If) or a structure of an acid addition salt thereof: In the formula, R 1 represents a hydrogen atom, an alkyl group having 1 to 10 carbon atoms which may have a hydroxyl group, a cycloalkyl group having 5 to 10 carbon atoms, or an aralkyl group having 7 to 10 carbon atoms, In the formula, R 4 and R 5 each independently represents a hydrogen atom, an alkyl group having 1 to 12 carbon atoms which may have a hydroxyl group, an aralkyl group having 7 to 12 carbon atoms, or a cycloalkyl group having 5 to 6 carbon atoms, or In the formula, R 6 represents a hydrogen atom or a methyl group, R 7 and R 8 each independently represents a hydrogen atom or an alkyl group having 1 to 4 carbon atoms, n is an integer from 2 to 4, and At least a part of the anionic structural unit (2) is a structural unit (2-1), (2-2) or (2-4) having a structure represented by the following general formula (II-a), (II-b) or (II-d): In the formula, R 9 represents hydrogen or methyl, Y each independently represents hydrogen, Na, K, NH4, 1 / 2Ca, 1 / 2Mg, 1 / 2Fe, 1 / 3Al, or 1 / 3Fe, In the formula, Y each independently represents hydrogen, Na, K, NH4, 1 / 2Ca, 1 / 2Mg, 1 / 2Fe, 1 / 3Al, or 1 / 3Fe, or In the formula, R 10 represents hydrogen or methyl, Y is each independently hydrogen, Na, K, NH4, 1 / 2Ca, 1 / 2Mg, 1 / 2Fe, 1 / 3Al or 1 / 3Fe.

29. The enhancer according to claim 28, wherein the cationic constitutional unit (1) is selected from the constitutional unit (1-1) and the constitutional unit (1-4).

30. The enhancer according to claim 28, wherein the anionic constitutional unit (2) is selected from the constitutional unit (2-1) and the constitutional unit (2-4).

31. The reinforcing agent according to any one of claims 28 to 30, wherein the amphoteric copolymer further comprises a nonionic structural unit (3) derived from a methacrylamide-based monomer or an acrylamide-based monomer.

32. The reinforcing agent of claim 28, wherein in the amphiphilic copolymer, At least a part of the cationic structural unit (1) is a structural unit (1-1) having a structure represented by the general formula (Ia) or the general formula (Ib) or a structure which is an acid addition salt thereof: In the formula, R 1 represents a hydrogen atom, an alkyl group having 1 to 10 carbon atoms which may have a hydroxyl group, a cycloalkyl group having 5 to 10 carbon atoms, or an aralkyl group having 7 to 10 carbon atoms, At least a part of the anionic structural unit (2) is a structural unit (2-1) represented by the general formula (II-a): In the formula, R 9 is hydrogen or methyl, Y is independently hydrogen, Na, K, NH4, 1 / 2Ca, 1 / 2Mg, 1 / 2Fe, 1 / 3Al or 1 / 3Fe for each bonded carboxyl group.

33. Use of the following substances in the manufacture of a kit for detecting a variation in a target base sequence of a nucleic acid in a sample relative to a standard base sequence: A nucleic acid comprising a base sequence complementary to the standard base sequence, a non-natural nucleotide containing at least one residue, and Amphoteric copolymers, It has a cationic structural unit (1) containing an amino group and an anionic structural unit (2). The molar ratio of the cationic constituent unit (1) to the anionic constituent unit (2) is in the range of 0.13 to 1.62, At least a part of the cationic structural unit (1) is a structural unit (1-1), (1-3) or (1-4) having a structure represented by the following general formula (Ia), (Ib), (Ie) or (If) or a structure of an acid addition salt thereof: In the formula, R 1 represents a hydrogen atom, an alkyl group having 1 to 10 carbon atoms which may have a hydroxyl group, a cycloalkyl group having 5 to 10 carbon atoms, or an aralkyl group having 7 to 10 carbon atoms, In the formula, R 4 and R 5 each independently represents a hydrogen atom, an alkyl group having 1 to 12 carbon atoms which may have a hydroxyl group, an aralkyl group having 7 to 12 carbon atoms, or a cycloalkyl group having 5 to 6 carbon atoms, or In the formula, R 6 represents a hydrogen atom or a methyl group, R 7 and R 8 each independently represents a hydrogen atom or an alkyl group having 1 to 4 carbon atoms, n is an integer from 2 to 4, and At least a part of the anionic structural unit (2) is a structural unit (2-1), (2-2) or (2-4) having a structure represented by the following general formula (II-a), (II-b) or (II-d): In the formula, R 9 represents hydrogen or methyl, Y each independently represents hydrogen, Na, K, NH4, 1 / 2Ca, 1 / 2Mg, 1 / 2Fe, 1 / 3Al, or 1 / 3Fe, In the formula, Y each independently represents hydrogen, Na, K, NH4, 1 / 2Ca, 1 / 2Mg, 1 / 2Fe, 1 / 3Al, or 1 / 3Fe, or In the formula, R 10 represents hydrogen or methyl, Y is each independently hydrogen, Na, K, NH4, 1 / 2Ca, 1 / 2Mg, 1 / 2Fe, 1 / 3Al or 1 / 3Fe, Wherein the detection is carried out as follows: using the kit to perform a nucleic acid amplification reaction using the nucleic acid in the sample as a template, and The presence of the variation is determined based on the total amount of nucleic acid amplification products obtained by the nucleic acid amplification reaction, the number of amplification cycles of the nucleic acid amplification reaction until the total amount of the nucleic acid amplification products reaches a threshold value, the amount of nucleic acid having the variation in the nucleic acid amplification products, or the number of amplification cycles of the nucleic acid amplification reaction until the amount of nucleic acid having the variation in the nucleic acid amplification products reaches a threshold value.

34. The use according to claim 33, wherein the cationic structural unit (1) is selected from the structural unit (1-1) and the structural unit (1-4).

35. The use according to claim 33, wherein the anionic structural unit (2) is selected from the structural unit (2-1) and the structural unit (2-4).

36. The use according to claim 33, wherein the amphoteric copolymer further comprises a nonionic structural unit (3) derived from a methacrylamide-based monomer or an acrylamide-based monomer.

37. The use of claim 33, wherein in the amphiphilic copolymer, At least a part of the cationic structural unit (1) is a structural unit (1-1) having a structure represented by the general formula (Ia) or the general formula (Ib) or a structure which is an acid addition salt thereof: In the formula, R 1 represents a hydrogen atom, an alkyl group having 1 to 10 carbon atoms which may have a hydroxyl group, a cycloalkyl group having 5 to 10 carbon atoms, or an aralkyl group having 7 to 10 carbon atoms, At least a part of the anionic structural unit (2) is a structural unit (2-1) represented by the general formula (II-a): In the formula, R 9 is hydrogen or methyl, Y is independently hydrogen, Na, K, NH4, 1 / 2Ca, 1 / 2Mg, 1 / 2Fe, 1 / 3Al or 1 / 3Fe for each bonded carboxyl group.

38. The use of claim 33, wherein the non-natural nucleotide is a BNA.

39. The use of claim 33, wherein the nucleic acid amplification is performed using real-time PCR.

40. The use of claim 33, wherein the nucleic acid is genomic DNA.

41. The use according to any one of claims 33 to 40, wherein the detection further comprises performing a nucleic acid amplification reaction using a nucleic acid having the standard base sequence as a template, and When the number of amplification cycles of the nucleic acid amplification reaction until the total amount of the nucleic acid amplification product reaches a threshold when the nucleic acid in the sample is used as a template is smaller than the number of amplification cycles of the nucleic acid amplification reaction until the total amount of the nucleic acid amplification product reaches a threshold when the nucleic acid having the standard base sequence is used as a template, it is determined that the variation exists in the target base sequence of the nucleic acid in the sample.

Images