Bacillus amyloliquefaciens 13-3 and its application

Abstract

The present invention discloses a strain of Bacillus amyloliquefaciens 13‑3 and its application, and belongs to the field of microbial technology. The present invention discloses a strain of Bacillus amyloliquefaciens 13‑3, and its deposit number is CGMCC No.21630. The Bacillus amyloliquefaciens 13‑3 disclosed by the present invention has the ability to produce protease and iron carrier, and can also grow normally on a plate containing 14% salt. The plate confrontation experiment found that 13‑3 has a good antagonistic effect on a variety of pathogens, especially Gloeosporium anthracnose and rubber alternaria. At the same time, the volatile gas of the 13‑3 strain also has a good antagonistic effect on the microspore pseudodisk multi-hairy spore that causes nut diseases. Compared with the current use of chemical synthetic fungicides for prevention and control, since Bacillus amyloliquefaciens 13‑3 comes from the natural environment, it has the advantages of high efficiency, low toxicity, and no pollution to the environment, and has a large biocontrol potential in the prevention and control of Gloeosporium anthracnose and microspore pseudodisk multi-hairy spores.

Description

Technical Field

[0001] The present invention relates to the field of microbial technology, and more specifically to a strain of Bacillus amyloliquefaciens 13-3 and application thereof. Background Art

[0002] Anthracnose fungi are a class of globally distributed plant pathogens, especially in tropical and subtropical areas, causing anthracnose to occur before or after the harvest of various crops such as cereals, fruits and vegetables, resulting in great economic losses. Rubber tree planting is mainly distributed in Hainan, Guangdong, Guangxi, Fujian, Yunnan and other regions, and the warm and humid climate is very suitable for the survival and reproduction of various pathogenic microorganisms, resulting in a wide variety of rubber tree diseases. At present, the diseases of domestic known harm rubber trees are up to more than 90 kinds, and among them, the Anthracnose pathogen is one of the main diseases in rubber production. The rubber tree anthracnose pathogens are Colletotrichum gloeosporioides and C.acutatum, belonging to the subphylum Ascomycota, the class Coelosporales, the order Melanosporales, the family Melanosporaceae, and the genus Anthracnose. Anthracnose of rubber trees harms rubber seedlings, young trees in the field and rubber trees in harvest, infecting multiple parts of the body including young leaves, petioles, young shoots and fruits, causing young leaves to fall off, young shoots to wither and fruit to rot. In severe cases, it causes repeated leaf shedding and young shoot withering of rubber trees, delaying the harvesting time.

[0003] Macadamia nuts, also known as macadamia nuts and Australian walnuts, are recognized as precious edible dried fruits and woody oils in the world, and are known as the "king of nuts". my country's macadamia industry started late and only developed rapidly in 2008. At present, orchards that were planted earlier are gradually entering the high-yield period. As the orchards are planted for a longer time, the occurrence of diseases and insect pests is becoming more and more serious, and the species are also constantly changing and increasing. Pestalotiopsis microspora is an asexual endophytic fungus genus of Ascomycetes and is a well-known plant pathogen variety. In Yunnan macadamia planting bases, macadamia leaf blight and leaf fall caused by Pestalotiopsis microspora are often found, causing the tree to gradually decline and the orchard to reduce production.

[0004] At present, the prevention and control of anthracnose and microsporus pseudodiscus hirsutosporium leaf blight mainly adopts chemical pesticides, such as 2.5% chlorothalonil smoke agent, 3% carbendazim smoke agent, 70% methyl thiophanate wettable powder, 80% mancozeb wettable powder, prochloraz, copper rosinate, etc. However, chemical control has problems such as pesticide residues, impact on human health, soil and water resource pollution, pathogenic bacteria resistance, and reduced control effect.

[0005] The country advocates the plant protection policy of "prevention first, integrated prevention and control". It is a significant task to screen biological resources with antagonistic effects from the natural environment, which are highly efficient, non-toxic, harmless and pollution-free.

[0006] In recent years, the research hotspot of plant disease prevention and control is biological control, among which biocontrol Bacillus is the dominant biological population in the soil and plant rhizosphere, has a strong disease prevention and growth promotion effect, and is an important microbial source of biological pesticide bacteria. For example, Liang Yanqiong found that Bacillus subtilis Czk1 has a good inhibitory effect on rubber red root pathogens. Tu Min disclosed a strain of Bacillus Velezii SF305 that has an antagonistic effect on rubber tree red root pathogens. However, there are no relevant reports internationally on the prevention and control of anthracnose and microsporum polysporus leaf blight by live bacterial preparations of Bacillus amyloliquefaciens and its volatile substances.

[0007] Therefore, providing a Bacillus amyloliquefaciens 13-3 and its application is an urgent problem to be solved by those skilled in the art. Summary of the invention

[0008] In view of this, the present invention provides a strain of Bacillus amyloliquefaciens 13-3 and its application, which are used to inhibit the pathogenic bacteria of the imperfect fungi: rubber anthracnose and Microsporum hirsutum, and are used to prevent and control rubber anthracnose and Microsporum hirsutum leaf blight of nuts.

[0009] In order to achieve the above object, the present invention adopts the following technical solution:

[0010] A strain of Bacillus amyloliquefaciens 13-3, with a deposit number of CGMCCNo.21630, has been deposited in the General Microbiology Center of China Culture Collection Administration, referred to as CGMCC, located at the Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing. The deposit date is January 15, 2021, and the classification name is Bacillus amyloliquefaciens.

[0011] Further, the strain of Bacillus amyloliquefaciens 13-3 is used in inhibiting Colletotrichum mascutatum, Colletotrichum gloeosporioides, Corynespora cassiicola, Phellinus noxius, Pestalotiopsis microspora, Phytophthora heveae, Calonectria pentaseptata, Fusarium solani, Diaporthe passifloricola, Colletotrichum siamense, Colletotrichum alienum, Alternaria alternate, and Alternaria heveae.

[0012] Furthermore, the volatile substances produced by the strain Bacillus amyloliquefaciens 13-3 are used in inhibiting Pestalotiopsis microspora, Colletotrichum alienum, Diaporthepassifloricola, Colletotrichum siamense, and Fusarium solani.

[0013] Furthermore, the strain of Bacillus amyloliquefaciens 13-3 is used in producing siderophores.

[0014] Furthermore, the strain of Bacillus amyloliquefaciens 13-3 is used in producing protease.

[0015] Furthermore, the strain of Bacillus amyloliquefaciens 13-3 is used in salt tolerance.

[0016] Furthermore, the strain of Bacillus amyloliquefaciens 13-3 is used in chromium resistance.

[0017] Furthermore, the strain of Bacillus amyloliquefaciens 13-3 is used in lead resistance.

[0018] Furthermore, the strain of Bacillus amyloliquefaciens 13-3 is used in zinc resistance.

[0019] Furthermore, a microbial agent contains the strain of Bacillus amyloliquefaciens 13-3.

[0020] Through the above technical scheme, it can be known that compared with the prior art, the present invention discloses a strain of Bacillus amyloliquefaciens 13-3 and its application. The strain 13-3 has an inhibitory effect on 13 tested pathogenic fungi, including Colletotrichum acutatum, Colletotrichum gloeosporioides, Corynespora cassiicola, Phellinus noxius, Pestalotiopsis microspora, Phytophthora heveae, Calonectria pentaseptata, Fusarium solani, Alternaria heveae, Alternaria alternate, Colletotrichumalienum, Colletotrichum siamense, and Diaporthe passifloricola, among which the best inhibitory effect is on Alternaria heveae, Colletotrichum gloeosporioides, and Diaporthe passifloricola, with the inhibition rates being 80.72±2.5%, 78.90±0.65%, and 79.80±4.0%, respectively; and the best inhibitory effect is on Fusarium Solani had the weakest inhibitory effect.

[0021] The volatile substances of strain 13-3 had inhibitory effects on the five tested pathogenic fungi, among which the antagonism against Pestalotiopsis microspora and Diaporthepassifloricola was the strongest, with the inhibition rates of 90.02±0.83% and 88.99±0.20%, respectively.

[0022] Strain 13-3 produces siderophores, proteases, and is salt-tolerant and resistant to heavy metals (lead, zinc, and chromium). BRIEF DESCRIPTION OF THE DRAWINGS

[0023] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying creative work.

[0024] Figure 1The accompanying figure shows the colony morphology of the strain 13-3 of the present invention in LB solid medium;

[0025] Figure 2 The accompanying drawing shows the antagonistic effect of the strain 13-3 of the present invention on Colletotrichum gloeosporioides;

[0026] Among them, A, control; B, antagonistic effect of strain 13-3;

[0027] Figure 3 The accompanying drawing is a gyrA phylogenetic tree of strain 13-3 of the present invention;

[0028] Figure 4 The accompanying drawing shows the antagonistic effect of strain 13-3 on Pestalotiopsis microspora using the plate confrontation method of the present invention;

[0029] Among them, A, control; B, antagonistic effect of strain 13-3;

[0030] Figure 5 The accompanying drawing shows the antagonistic effect of the volatile substances of the strain 13-3 of the present invention on Pestalotiopsis microspora;

[0031] Among them, A, control; B, antagonistic effect of volatile gases of strain 13-3;

[0032] Figure 6 The accompanying figure shows the identification of the siderophore production ability of the strain 13-3 of the present invention;

[0033] Figure 7 The accompanying figure shows the protease production ability identification of the strain 13-3 of the present invention. DETAILED DESCRIPTION

[0034] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0035] Colletotrichum acutatum, Colletotrichum gloeosporioides, Corynespora cassiicola, Phellinus noxius, Pestalotiopsis microspora, Phytophthora heveae, Calonectria pentaseptata, Fusarium solani, Diaporthe passifloricola, Colletotrichum siamense, Colletotrichum alienum, Alternaria alternate, and Alternaria heveae are all preserved by the Plant Protection and Microbial Utilization Research Center of Yunnan Institute of Tropical Crops Sciences. Bacteria Genomic DNA Kit: Beijing Kangwei Century Company; PCR primers: Beijing Liuhe BGI Gene Technology Co., Ltd.; glucose, yeast extract, trypsin and other analytical reagents, Sangon Biotechnology Co., Ltd.; PCR instrument: Applied Biosystems; electrophoresis instrument, Beijing Liuyi Biotechnology Co., Ltd.; constant temperature incubator, Shanghai Boxun Industrial Co., Ltd.

[0036] Example 1 Isolation and screening of antagonistic bacteria

[0037] (1) Sample source

[0038] Rhizosphere soil samples were collected from rubber tree planting areas in Jinghong City, Xishuangbanna Prefecture, Yunnan Province. Using the five-point sampling method, the surface soil was removed and soil with a depth of about 5-20 cm was put into sterile self-sealing bags and brought back to the laboratory and refrigerated at 4°C for later use.

[0039] (2) Culture medium

[0040] LB liquid medium: 5 g yeast powder, 10 g tryptone, 10 g NaCl, and distilled water to 1 L.

[0041] PDA liquid culture medium: 200 g potatoes, 20 g glucose, distilled water to 1 L.

[0042] LB and PDA solid culture media are corresponding liquid culture media with 2% agar added.

[0043] (3) Isolation of antagonistic bacteria

[0044] The collected soil samples were sieved through a 100-mesh sieve. Weigh 1 g of the sieved soil sample, add 1 L of sterile water, shake at 28°C and 180 r / min for 30 min, and dilute to a concentration of 10 -3 -10 -8 g / L, mix thoroughly. Take 1 mL of the dilution and add it to the LB solid medium cooled to 50°C, shake it gently, and culture it at 37°C for 12 hours. Pick different types of colonies and streak them on new plates for purification and culture.

[0045] (4) Initial screening of antagonistic bacteria

[0046] Use a 5mm diameter puncher to punch holes in the activated Colletotrichum gloeosporioides plate, take a bacterial block and inoculate it in the center of a new PDA plate, inoculate different test strains around it, and culture at 28℃ for 4 days. Select the colonies that can inhibit the growth of pathogens, streak them, preserve them, and record them by number.

[0047] (5) Rescreening of antagonistic bacteria

[0048] The plate confrontation method was used to determine the antibacterial efficiency of antagonistic bacteria. Use a 5mm diameter puncher to punch holes in the activated Colletotrichum gloeosporioides plate, take the pathogen block and place it in the center of a new PDA plate. Inoculate at equal distances around the bacterial block to obtain the strain with antagonistic effect. Use the culture dish inoculated with pathogens as a control. Repeat 3 times, adjust the incubator temperature to 28°C, place the plate in the incubator for 4 days, and then take out and measure the diameter of the pathogen. Evaluate the strength of the antagonistic effect of antagonistic bacteria on pathogens by measuring the growth inhibition rate of indicator bacteria. The antagonistic bacteria with the best inhibitory effect was named 13-3, mixed with 20% glycerol and stored at -20°C. The colony morphology of strain 13-3 on LB solid culture medium is shown in Figure 1 , the antagonistic effect on Colletotrichum gloeosporioides is shown in Figure 2 .

[0049] Example 2 Identification of antagonistic bacteria

[0050] (1) Colony morphology: The antagonistic bacterium 13-3 was streaked onto LB solid medium and cultured in a constant temperature incubator at 30°C for 1 day. The colony morphology was light milky yellow, translucent, nearly circular, and had a flat and smooth surface.

[0051] (2) Biochemical indexes: Physiological and biochemical indexes of antagonistic bacteria 13-3 were measured with reference to the methods of the "Common Bacteria System Identification Manual" and the "Bergey Bacteria Identification Manual". The results showed that the antagonistic bacteria 13-3 screened by the present invention was negative in the methyl red test and positive in the VP test; it could produce catalase and starch hydrolase; reduce nitrate and hydrolyze gelatin; it could utilize citrate; and the denitrification reaction was positive.

[0052] (3) 16S rDNA gene identification and gyrA gene analysis

[0053] The 13-3 strain was cultured in LB liquid medium at 30°C and 180 rpm to the logarithmic growth phase, and the cells were collected by centrifugation at 10,000 rpm for 5 min. The bacterial genomic DNA was extracted using a kit, and primers 27F and 1492R were selected for 16S r DNA amplification; primers gyrA-F and gyrA-R were used for gyrA gene amplification.

[0054] The specific primer sequences are as follows:

[0055] 27F: 5'-AGAGTTTGATCCTGGCTCAG-3'; SEQ ID NO.1;

[0056] 1492R: 5'-GGTTACCTTGTTACGACCCTT-3'; SEQ ID NO.2;

[0057] gyrA-F: 5'-CAGTCAGGAAATGCGTACGTCCTT-3'; SEQ ID NO.3;

[0058] gyrA-R: 5'-CAAGGTAATGCTCCAGGCATTGCT-3'; SEQ ID NO. 4.

[0059] PCR reaction system: 2×EsTaq MasterMix 25μL, genomic DNA 2μL, 27F / 1492R primers (10μmol / L) 1μL each, add ddH2O to 50μL. PCR reaction conditions: 95℃ denaturation 5min; 95℃ 30s, 55℃ 30s, 72℃ 2min, 35 cycles; 72℃ 10min (gyrA gene amplification conditions are the same as above; primers are gyrA-F / gyrA-R). PCR products were purified and sequenced. The sequencing results were compared with the BLASTn program in the GenBank database. Multiple sequence alignment and phylogenetic analysis were performed using MEGA 7.0 software to determine the taxonomic status of the strain. The phylogenetic tree was constructed using the Neighbor-Joining method, and the Bootstrap was set to 1000.

[0060] The species of strain 13-3 was identified using 16S rDNA, and the sequencing result is shown in SEQ ID NO.5.

[0061]

[0062] The full length of the 16SrDNA sequence of the strain is 1450 bp, and the homology with the 16SrDNA sequence of Bacillus amyloliquefaciens B3 (accession number MH521169.1) reaches 99.66%.

[0063] The gyrA gene was used to identify the species of strain 13-3, and the sequencing result is shown in SEQ ID NO.6.

[0064] GCCAGCAGGTTGATTCCGAAAGACGTCTGCAGGGCCGTTTGTTTGTACAGGTTATTCAAAATGACGTGAGCATTGGCGTCACGGCGGATCTCAATGACGATTCTCATTCCGTTACGGTCGGATTCGTCTCGCAGGTCGGTAATTCCTTCGATTTTTTTGTCTCGGACAAGATCTGCGATTTTTTCAATTAATCTCGCTTTGTTCACCTGATAAGGAAGTTCCGTAACAATAATTCTTTCTTTTCCTGATGATGTCTCTTCGATTTCAGCCTTAGCCCGGATTGTGATTGATCCCCGTCCGGATTCATATGCCTTGCGGATGCCGCTCCGGCCCAAAATCTGACCAGCAGTCGGAAAATCCGGGCCCGGGATGTATTCCATCAGCTCCTGGTTTGTAATCTCGGGATTCTCACTTACGGCAAGCACGCCTTCAATGACTTCTCCAAGCTGATGCGGAGGAATGTTTGTCGCCATTCCGACCGCAATACCGGCAGCCCCGTTTACGAGCAGATTCGGAAATCTCGATGGCATGACGGCAGGCTCTCTTTCTGAACCGTCATAGTTATCTTGATAGTCAATCGTGTCTTTCGTAATGTCACGCAGAATTTCCATTGCGATTTTTGACATTCTCGCTTCTGTGTAACGCATCGCGGCCGCTGAGTCGCCGTCAACCGAACCGAAGTTGCCGTGTCCGTCAACAAGCATGTAGCGGTAGTTAAAATCCTGCGCCATTCTGACCATTGATTCGTAAACCGCTGAGTCACCGTGCGGATGGTACTTACCGATAACTTCACCGACGATACGGGCAGACTTTTTATATGGTTTGTCACTGGTCATGCCTAAATCATTCATTGCGTACAAAATCCGTCTGTGAACCGGCTTCAGACCGTCACGCACATCCGGAAGCGCCCGGGA;SEQ ID NO.6。

[0065] The full length of the gyrA sequence of strain 13-3 is 914 bp. Due to the close relationship between species within the genus Bacillus, the 16S rDNA gene alone cannot be used to analyze the evolutionary relationship between species of the genus Bacillus. In recent years, it has been reported that the gyrA gene can be used to distinguish the differences between species of Bacillus subtilis. The gyrA sequence of strain 13-3 and 15 strains of Bacillus sp. was used to construct an evolutionary tree. It was found that strain 13-3 and gyrA sequences from 9 strains of Bacillus amyloliquefaciens, including Y2, XL, UCMB5113, and FZB42, were clustered together ( Figure 3 ), indicating that they are very closely related and belong to the same genus Bacillus amyloliquefaciens.

[0066] Based on the sequence analysis, morphological characteristics, cultural characteristics, physiological and chemical characteristics of the strain 13-3 and the Manual of Systematic Identification of Common Bacteria, it was determined that the strain belonged to Bacillus amyloliquefaciens and was named Bacillus amyloliquefaciens 13-3.

[0067] Example 3 Effects of different fermentation media on the production of antibacterial active substances by 13-3

[0068] This embodiment involves 10 kinds of culture media: LB liquid culture medium, sucrose culture medium, PDA culture medium, soybean powder culture medium, pigment growth-promoting culture medium, KMB-1 liquid culture medium, beef extract peptone culture medium, fermentation culture medium, TB culture medium and KMB culture medium. The specific formulas are as follows:

[0069] PDA culture medium: 200 g potatoes, 20 g glucose, distilled water to 1 L.

[0070] Sucrose medium: sucrose 3g, NaCl 2.5g, peptone 10g, pH 7.5, distilled water to 1L.

[0071] LB liquid culture medium: 5 g yeast powder, 10 g NaCl, 10 g tryptone, and distilled water to 1 L.

[0072] Soybean powder culture medium: 65g soybean powder, 16g corn steep liquor, 12g glucose, 22ml anhydrous ethanol, and distilled water to 1L.

[0073] Pigment-promoting medium: 22 g tryptone, 20 g glucose, 5 g potassium nitrate, pH 7.5, distilled water to 1 L.

[0074] KMB liquid culture medium: MgSO4·7H2O 1g, K2HPO4 2.5g, acid hydrolyzed casein 5g (McLean C822594), glycerol 15mL, distilled water to 1L, pH natural.

[0075] KMB-1 liquid culture medium: MgSO4·7H2O 1g, K2HPO4 2.5g, acid hydrolyzed casein 5g (Solebol C8221), glycerol 15mL, distilled water to 1L, pH natural.

[0076] Fermentation medium: 42.47 g glycerol, 3.42 g KNO3, 9 g K2HPO4·3H2O, 9 g KH2PO4, 0.75 g MgSO4·7H2O, 1 g NaCl, 1 g KCl, 0.2 g CaCl2, and distilled water to make up to 1 L.

[0077] TB medium: 1.2% (W / V) Tryptone, 2.4% (W / V) Yeast Extract, 0.4% (V / V) Glycerol, 17mM KH2PO4, 72mM K2HPO4·3H2O, and distilled water to 1L.

[0078] Beef extract peptone medium: NaCl 5g, peptone 10g, beef extract 3g, pH 7.2-7.4, distilled water to 1L.

[0079] Preparation of fermentation seed liquid: The strain 13-3 was activated in LB solid culture medium, cultured in an artificial climate box at 30°C for 24 h, a single colony was picked and inoculated into a conical flask (300 mL) filled with LB liquid (100 mL) culture medium, and cultured at 30°C and 180 r / min for 12 h to obtain the fermentation seed liquid.

[0080] Screening of culture medium for antibacterial substances: 100 mL of the above 10 culture mediums for screening 13-3 antibacterial substances were placed in 500 mL Erlenmeyer flasks, and the cultured seed solution was inoculated in the flasks at a 15% inoculation rate. The flasks were placed in a 30°C constant temperature shaking incubator at 180 r / min for 4 days (OD 600 =3.0), the fermentation broth was centrifuged at 8000 r / min for 4 min, the supernatant was aspirated into another sterilized centrifuge tube, and filtered through a 0.22 μm microporous filter membrane to obtain 10 kinds of sterile fermentation filtrates of screening culture media.

[0081] Determination of antibacterial activity: The mycelium growth rate method was used, and Colletotrichum oxysporum was used as the indicator bacteria. After Colletotrichum oxysporum was activated on the PDA plate for 4 days, a 5mm hole puncher was used to make bacterial cakes, which were inoculated into the center of the PDA plate coated with 100μL of sterile fermentation filtrate, and repeated 3 times; after culturing in a 28℃ constant temperature incubator for 4 days, the plates were taken out and the colony diameter was measured by the cross method. Inhibition zone diameter = control pathogen colony diameter - treatment pathogen colony diameter

[0082] The inhibitory effects of the 10 fermentation broths on the mycelium growth of Colletotrichum oxysporum are shown in Table 1.

[0083] Table 1 Inhibitory effects of 10 fermentation broths on Colletotrichum oxysporum

[0084]

[0085] The results in Table 1 show that the fermentation broth obtained by culturing 13-3 strain with PDA medium has the highest antibacterial substances.

[0086] Example 4 Determination of the antimicrobial spectrum of antagonistic strain 13-3

[0087] The pathogens include Colletotrichum acutatum, Colletotrichum gloeosporioides, Corynespora cassiicola, Phellinus noxius, Pestalotiopsis microspora, Phytophthora heveae, Calonectria pentaseptata, Fusarium solani, Diaporthepassifloricola, Colletotrichum siamense, Colletotrichum alienum, Alternaria alternate, Alternaria heveae) as the indicator bacteria, the plate confrontation method (PDA plate inoculated with antagonistic bacteria and pathogenic bacteria at the same time) was used, and the treatment inoculated with only indicator bacteria was used as the control, repeated three times, cultured in a 28℃ constant temperature box for 4 days, measured the diameter of the inhibition zone, observed the inhibition and took pictures. The growth inhibition rate of 13-3 strain against different pathogens was measured [inhibition rate (%) = (control group colony growth diameter - treatment group colony growth diameter) / (control group colony growth diameter - inoculated bacteria block diameter) × 100%], and the antibacterial broad-spectrum of antagonistic bacteria was evaluated. The results are shown in Table 2.

[0088] Table 2 Inhibitory effects of strain 13-3 on 13 pathogenic fungi

[0089]

[0090] Note: Different lowercase letters indicate significant differences in the same column of data at the P<0.05 level.

[0091] The results in Table 2 showed that strain 13-3 had inhibitory effects on 13 tested pathogenic fungi, including Colletotrichum acutatum, Colletotrichum gloeosporioides, Corynespora cassiicola, Phellinus noxius, Pestalotiopsis microspora, Phytophthora heveae, Calonectria pentaseptata, Fusarium solani, Alternaria heveae, Alternaria alternate, Colletotrichumalienum, Colletotrichum siamense and Diaporthe passifloricola, among which the best inhibitory effect was on Alternaria heveae, Colletotrichum gloeosporioides and Diaporthepassifloricola, with inhibition rates of 80.72±2.5, 78.90±0.65 and 79.80±4.0%, respectively; the inhibitory effect on Fusarium solani was the weakest. Among them, the antagonistic effect of strain 13-3 on Pestalotiopsis microspora was shown in Figure 4 The results of the antimicrobial spectrum test showed that strain 13-3 had a broad-spectrum antimicrobial activity, and it was speculated that strain 13-3 had good application prospects in the field of biocontrol of imperfect fungi pathogens.

[0092] Example 5 Antagonistic effect of volatile substances of strain 13-3 on plant pathogens

[0093] The double-dish method was used to determine the antagonistic effect of the volatile substances of strain 13-3 on Pseudomonas microsporus, Colletotrichum heteromorphum, Citrus black spot pathogen, Siamese anthracnose, and Fusarium solani. 50 mL of LB liquid culture medium was placed in a 300 mL bottle, inoculated with a single colony of antagonistic bacteria 13-3, and cultured in a constant temperature shaker at 30°C and 180 r / min for 12 h (OD 600 =1), take 100 μL of fermentation liquid and evenly spread it on the LB plate, take a 5 mm diameter bacterial cake of the test strain and place it in the center of the PDA plate, put the LB plate and the PDA plate together, seal the joint with a sealing film, and use the LB plate coated with 100 μL of water as a control, repeat 3 times. After culturing at 28℃ for 4 days, measure the colony diameter of the test pathogen in the control group and the treatment group, and calculate the inhibition rate.

[0094] The double-dish method was used to obtain the antagonistic effects of the volatile substances of strain 13-3 on five plant pathogens. The results are shown in Table 3.

[0095] Table 3 Inhibitory effects of volatile substances of strain 13-3 on five plant pathogens

[0096] Test strains Diameter of inhibition zone (mm) Antibacterial rate (%) Pestalotiopsis microspora 65.89±0.08 <![CDATA[90.02±0.83 a ]]> Citrus Black Spot (Diaporthe passifloricola) 64.87±0.60 <![CDATA[88.99±0.20 a ]]> Colletotrichumsiamense 28.04±4.89 <![CDATA[44.97±0.34 b ]]> Fusarium foetens 18.01±0.75 <![CDATA[31.80±1.35 c ]]> Colletotrichumalienum 27.39±0.21 <![CDATA[44.90±7.80 b ]]>

[0097] Note: Different lowercase letters indicate significant differences in the same column of data at the P<0.05 level.

[0098] The results in Table 3 show that the volatile substances of strain 13-3 have inhibitory effects on the five tested pathogenic fungi, among which the antagonistic effect on Pestalotiopsis microspora and Diaporthe passifloricola is the strongest, with the inhibition rates of 90.02±0.83% and 88.99±0.20%, respectively; the antagonistic effect of the volatile substances of strain 13-3 on Pestalotiopsis microspora is shown in Table 3. Figure 5 .

[0099] Example 6 Functional analysis of antagonistic strains

[0100] CAS detection medium: purchased from Beijing Coolbo Technology Co., Ltd., product number PM0821-1L.

[0101] Protease detection medium: 15.0 g skim milk powder, 15.0 g agar, distilled water to 1 L.

[0102] KMB liquid culture medium: MgSO4·7H2O 1g, K2HPO4 2.5g, acid hydrolyzed casein (McLean C822594) 5g, glycerol 15mL, distilled water to 1L, pH natural.

[0103] CAS detection solution: Dissolve 0.079 g of chrome azuro (CAS) in 50 mL of deionized water, and then add 10 mL of 1 mmol / L FeCl3 (containing 10 mmol / L HCl solution) to prepare solution ①; dissolve 0.069 g of hexadecyltrimethylammonium bromide (CTAB) in 40 mL of deionized water to obtain solution ②; slowly pour solution ① into solution ② along the wall of the beaker, mix well to obtain 100 mL of CAS detection solution.

[0104] 10mmol / L hydrochloric acid: Take 167μl of concentrated hydrochloric acid and slowly add it into 200mL of pure water.

[0105] 1mmol / L FeCl3 solution: Weigh 0.0270g of FeCl3·6H2O and dilute to 100mL with 10mmol / L hydrochloric acid.

[0106] Deferioxamine mesylate solution: Place the standard deferoxamine mesylate in a beaker, add distilled water to dissolve it, prepare a 2 mg / ml solution, and then dilute it according to the concentration required by the experiment.

[0107] (1) Producing siderophores

[0108] Quantitative detection of the ability to produce siderophores: The activated strain 13-3 was inoculated on a CAS test medium plate and cultured at 30°C for 4 days. A clear yellow transparent circle will appear around the colonies that secrete siderophores. After confirming that the bacteria have the ability to produce siderophores, the ability of the strain 13-3 to produce siderophores was quantitatively detected. Detection method: After the strain 13-3 was cultured in LB liquid medium for 12 hours, it was used as the seed solution (OD 600 =1), transferred to KMB liquid medium at a 15% inoculation ratio, and cultured at 30°C, 180 r / min, shaking for 4 days (OD 600 =3.0), the cultured KMB fermentation broth was centrifuged at 4°C and 9500r / min for 10 min, 4 ml of the supernatant was taken into a test tube, and the same volume of CAS detection solution was added, vortexed and mixed, and allowed to stand for 1.5 h, and the OD was measured. 630 The value of nm. KMB liquid culture medium plus test solution was used as a control, and deionized water was used to adjust the value to zero.

[0109] Drawing of standard curve of deferoxamine mesylate: 2 mg / ml deferoxamine mesylate was gradiently diluted into standard solutions of different concentrations: 0 μg / mL, 10 μg / mL, 20 μg / mL, 30 μg / mL, 40 μg / mL, 50 μg / mL, 60 μg / mL, 70 μg / mL, 80 μg / mL, and 90 μg / mL. 3 mL of deferoxamine mesylate standard solution of each concentration was respectively drawn into a test tube, and 3 mL of CAS blue detection solution was added in a 1:1 ratio in sequence. The solution was fully mixed and zeroed with deionized water as reference after 1.5 h. The measured value of 0 μg / mL concentration was determined at 630 nm by a spectrophotometer as Ar, and the absorbance value of each tube was determined as A. The standard curve was drawn with the value of ΔA=Ar-A, and the equation was established. x represents the mass concentration (μg / ml) of deferoxamine mesylate standard solution; y represents the ΔA value; Substitute into the standard curve equation to calculate the concentration of iron carriers in the fermentation broth of the strain (μg / mL).

[0110] Results: The strain 13-3 was inoculated on the CAS test medium plate and cultured at 30℃ for 4 days. It was found that the bacteria could form a yellow transparent circle on the CAS test plate, indicating that the strain 13-3 had the function of secreting siderophore. Figure 6The strain was inoculated into KMB liquid culture medium and cultured at 30°C and 180r / min for 4 days. The culture medium was collected and the siderophore content in the KMB culture medium was determined. A standard curve was drawn and the linear regression equation y=0.0414x-0.1007 was obtained; the coefficient R 2 =0.9955. The results showed that 13-3 produced siderophores in KMB culture medium, and the siderophore concentration was 19.13 μg / ml.

[0111] (2) Protease production

[0112] The protease detection medium was prepared according to the formula and sterilized and poured into a plate. The strain 13-3 was inoculated into the protease detection medium and cultured at 30°C. After 4 days, whether a transparent circle appeared around the strain was observed to determine whether the bacteria produced protease.

[0113] Results: The strain was inoculated on a protease detection plate and cultured at 30℃ for 4 days. It was found that the bacteria could form a transparent circle on the detection plate, indicating that the bacteria had the ability to produce protease. Figure 7 .

[0114] (3) Salt tolerance

[0115] LB solid culture media with salt concentration gradients of 5%, 8%, 10%, 12%, 14%, 16%, 18%, and 20% were prepared respectively, and poured into plates after high-pressure sterilization. After solidification, a single colony of 13-3 bacteria cultured was picked up with a toothpick and streaked on the plate for culture. After sealing film, it was placed in a 30°C incubator for inversion culture. After 2 days, whether there were bacterial colonies growing, so as to determine the maximum salt tolerance value of the bacterial strain.

[0116] Results: After the bacteria were cultured on LB medium with different salt contents for 2 days, it was observed that strain 13-3 could grow normally on plates containing 5%, 8%, 10%, 12%, and 14% salt, but could not grow on plates containing 16%, 18%, and 20% salt.

[0117] (4) Tolerance to heavy metals chromium and lead

[0118] LB solid culture medium with a chromium gradient of 200-3000 mg / L, a zinc gradient of 200-1000 mg / L, and a lead gradient of 200-2800 mg / L was prepared, and poured onto a plate after high-pressure sterilization. After solidification, a single colony of strain 13-3 was picked up with a toothpick and streaked on the plate for culture. After sealing with a sealing film, the plate was placed in an incubator at 30°C for inversion and cultured. After 2 days, whether any bacterial colonies grew was observed to determine the maximum tolerance value of strain 13-3. The results are shown in Table 4.

[0119] Table 4 Growth status of strain 13-3 at different heavy metal ion concentrations

[0120]

[0121]

[0122] Note: +: normal growth; -: no growth.

[0123] The results in Table 4 show that after being cultured on plates with different concentrations of chromium and lead for 2 days, strain 13-3 grew normally on plates containing 200mg / L-2800mg / L of chromium, and grew slightly weaker on plates containing 3000mg / L. 13-3 grew normally on plates containing 200mg / L-2500mg / L of lead, but could not grow when the concentration reached 2800mg / L. 13-3 grew normally on plates containing 200-800mg / L of zinc, but could not grow when the concentration reached 1000mg / L.

[0124] The above description of the disclosed embodiments enables those skilled in the art to implement or use the present invention. Various modifications to these embodiments will be apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments shown herein, but rather to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. A strain of Bacillus amyloliquefaciens 13-3, characterized in that: Its deposit number is CGMCC No.21630.

2. Use of the Bacillus amyloliquefaciens 13-3 according to claim 1 in inhibiting Colletotrichum mascutatum, Colletotrichum gloeosporioides, Corynespora cassiicola, Phellinus noxius, Pestalotiopsis microspora, Phytophthora heveae, Calonectria pentaseptata, Fusarium solani, Diaporthe passifloricola, Colletotrichum siamense, Colletotrichum alienum, Alternaria alternate, and Alternaria heveae.

3. Use of the volatile substances produced by the Bacillus amyloliquefaciens 13-3 according to claim 1 in inhibiting Pestalotiopsis microspora, Colletotrichum alienum, Diaporthepassifloricola, Colletotrichum siamense, and Fusarium solani.

4. Use of the Bacillus amyloliquefaciens 13-3 according to claim 1 in producing siderophores.

5. Use of the Bacillus amyloliquefaciens 13-3 according to claim 1 in producing protease.

6. Use of the Bacillus amyloliquefaciens 13-3 according to claim 1 in salt tolerance.

7. Use of the Bacillus amyloliquefaciens 13-3 according to claim 1 in chromium resistance.

8. Use of the Bacillus amyloliquefaciens 13-3 according to claim 1 in lead resistance.

9. Use of the Bacillus amyloliquefaciens 13-3 according to claim 1 in zinc resistance.

10. A microbial agent, characterized in that: Contains the Bacillus amyloliquefaciens 13-3 according to claim 1.

Images