Acetolactate synthase imals tolerable to high concentration of imazamox, encoding gene and application thereof

Abstract

This invention belongs to the fields of applied environmental microbiology and agricultural biotechnology, and discloses ImALS, an acetyllactone synthase resistant to high concentrations of methoxylamine, its encoding gene, and its applications. Its nucleotide sequence is SEQ ID NO.1, with a full length of 1785 bp, encoding 594 amino acids, and its amino acid sequence is SEQ ID NO.2. ImALS shares less than 58.3% homology with previously reported acetyllactone synthases, thus representing a novel ALS gene. The acetyllactone synthase ImALS provided by this invention exhibits a specific activity of 0.52 mM / mg against sodium pyruvate. ImALS demonstrates strong resistance to the ALS inhibitor methoxylamine herbicide, with a half-maximal inhibitory concentration (IC50) of 1500 μM, indicating that the ImALS gene has significant application potential in methoxylamine-resistant transgenic engineering.

Description

Technical Field

[0001] This invention relates to a herbicide-tolerant protein, its encoding gene and its uses, and particularly to an acetyllactone synthase ImALS that can tolerate high concentrations of methoxyfenozide, its encoding gene and its applications. Background Technology

[0002] Imidazolinone herbicides are a class of acetolactate synthase inhibitors introduced by Cyano Corporation in the early 1980s, following sulfonylurea herbicides. Major varieties include imazamox, imazethapyr, imazapic, and imazaquin. These herbicides are highly active, selective, and broad-spectrum, controlling both annual grasses and broadleaf weeds as well as perennial weeds. Imidazolinone herbicides are rapidly absorbed through the leaves and roots of plants, translocated in the xylem and phloem, and accumulate in the meristematic tissues. They inhibit acetolactate synthase activity, suppressing the synthesis of valine, leucine, and isoleucine, thus causing plant growth arrest and death.

[0003] However, long-term, high-intensity use of imidazolinone herbicides has led to severe herbicide damage. The most fundamental solution to the problem of weed resistance to imidazolinone herbicides is to cultivate corresponding herbicide-resistant crops. Therefore, discovering imidazolinone herbicide resistance genes has significant application value.

[0004] Acetolactate synthase (ALS) is a key enzyme in the biosynthesis of branched-chain amino acids such as valine (Val), leucine (Leu), and isoleucine (Ile) in plants and microorganisms. It catalyzes the formation of acetolactate and CO2 from two pyruvates, or the formation of acetylhydroxybutyrate and CO2 from pyruvate and α-butyrate, ultimately synthesizing Val, Leu, and Ile. Therefore, ALS is a crucial enzyme in the biosynthesis of branched-chain amino acids in organisms. Figure 1 Acetolactate synthase inhibitors, such as imidazolinones, sulfonylureas, triazolamides, pyrimidinesalicylic acids, and sulfonamides, cause plant death by inhibiting ALS activity and blocking branched-chain amino acid synthesis. Therefore, ALS has significant agronomic importance. Currently, research on the interaction mechanisms between ALS and herbicides, the discovery of herbicide-resistant species and genetic resources, and transgenic applications has received widespread attention.

[0005] Herbicide-resistant transgenic crops are the best way to solve herbicide damage and control weeds. With the development of genetic engineering technology, herbicide-resistant transgenic crops have been successfully developed. A large number of resistance genes or degradation genes against various herbicides have been discovered and used in the construction of herbicide-resistant transgenic crops. In my country, Li Guosheng et al. introduced the sulfonylurea resistance ALS gene from Arabidopsis thaliana into maize, and it has entered the field trial stage. Meanwhile, DuPont's transgenic soybeans and cotton with sulfonylurea resistance ALS have entered the commercial promotion stage. In addition, research has been conducted both domestically and internationally on transferring sulfonylurea degradation or metabolism genes into plants. For example, O'Keefe et al. transferred the cytochrome P-450Su1 gene from the soil bacterium Streptomyles griseolus into tobacco, obtaining herbicide-resistant plants. Since 1982, scholars in Europe and America, such as Bailey and Currie, have been using tissue culture and pollen mutagenesis techniques to breed imidazoline-resistant maize. Currently, the imidazoline-resistant maize varieties they have bred have been commercialized and widely used. Carlos A. Sala et al. developed a sunflower inbred line (named RW-B) from wild sunflower populations that is resistant to imidazolinones and sulfonylureas. To date, there are few reports on the cloning of the ALS gene for resistance to high concentrations of methoxyprobene and its resistance performance; therefore, it is necessary to clone the ALS gene stalk of a highly methoxyprobeneficial herbicide to study its resistance to methoxyprobene. Summary of the Invention

[0006] The purpose of this invention is to provide a novel protein, its encoding gene, and its uses, wherein the protein not only has ALS enzyme activity but also exhibits extremely high resistance to methoxyfenozide.

[0007] The objective of this invention is achieved through the following technical solution:

[0008] An acetolactate synthase ImALS, with the amino acid sequence shown in SEQ ID NO.2.

[0009] The ImALS gene encoding acetyllactone synthase ImALS described in this invention has a preferred nucleotide sequence as shown in SEQ ID NO. 1.

[0010] A recombinant expression vector containing the ImALS encoding gene described in this invention.

[0011] As a preferred embodiment of the present invention, the recombinant expression vector is obtained by inserting the encoding gene ImALS between the Nde I and Xho I sites of pET-29a(+).

[0012] Genetically engineered bacteria containing the ImALS encoding gene.

[0013] As a preferred embodiment of the present invention, the expression strain of the genetically engineered bacteria is Escherichia coli BL21(DE3).

[0014] The application of the acetyl-lactate synthase ImALS described in this invention in the synthesis of branched-chain amino acids Val, Leu, and Ille.

[0015] The application of the ImALS encoding gene described in this invention in transgenic engineering of methicillin-resistant tobacco.

[0016] The application of the ImALS encoding gene described in this invention in the preparation of acetolactate synthase resistant to methoxyfenozide.

[0017] Beneficial effects:

[0018] This invention provides an acetyllactone synthase ImALS that exhibits strong resistance to the ALS inhibitor herbicide methoxymethylene. The specific enzyme activity of ImALS against sodium pyruvate is 0.52 mM / mg, and the half-maximal inhibitory concentration (IC50) against methoxymethylene reaches 1500 μM, indicating that the ImALS gene has great application potential in methoxymethylene-resistant transgenic engineering. Attached image description:

[0019] Figure 1 : The branched-chain amino acid synthesis pathway involving acetolactate synthase (ALS)

[0020] Figure 2 Comparison of ImALS amino acid sequences with the most recently reported homologous E. coli K12 ALS sequence.

[0021] Figure 3 Results of ImALS SSDS-PAGE analysis of exogenously expressed acetolactate synthase: Lane 1: protein marker, Lane 2: crude ImALS enzyme, Lane 3: purified ImALS

[0022] Figure 4 Effects of different concentrations of methoxyimidazolium on ImALS activity

[0023] Figure 5 Effects of 200 g / ha methoxyfenozide foliar spraying on the growth of ImALS transgenic rice containing acetolactate synthase gene Detailed Implementation

[0024] The Escherichia coli high expression vector pET-29a(+) and the expression host Escherichia coli BL21(DE3) were both purchased from Novizan Biotechnology Co., Ltd.

[0025] Example 1. Screening and isolation of highly resistant strains and identification of their ALS gene

[0026] 1.1 Screening and isolation of highly resistant strains

[0027] Soil samples were collected from rice paddies where methoxyfenozide had been applied for a long period. 5g of soil was added to 100mL of sterile water and incubated at 30℃ with shaking at 150rpm for 30min. After incubation, the samples were removed and allowed to stand for 5min. 1ml of the culture solution was diluted and plated onto a basal salt medium containing 1000mg / L methoxyfenozide (1.0g NH4NO3, 1.0g NaCl, 1.5g K2HPO4, 0.5g KH2PO4, 0.2g MgSO4·7H2O, 5.0g glucose, pH 7.0). Single colonies that could grow on the methoxyfenozide basal salt plate were repeatedly streaked for purification, resulting in a bacterial strain named JK-1, which was then used for further research.

[0028] 1.2 16S rRNA gene sequence analysis of resistant strains

[0029] The 16S rRNA gene fragment of strain JK-1 was amplified by PCR using universal primers 27F (5-AGAGTTTGATCCTGGCTCAG-3) and 1492R (5-GGTTACCTTGTTACGACTT-3). The amplified fragment was sequenced and compared with the EzBioCloud database (www.ezbiocloud.net). The results showed that the 16S rRNA gene sequence of this bacterium had 99% homology with Variovorax soli, and the bacterium was preliminarily identified as Variovorax sp.

[0030] 1.3. Cloning of the ALS gene in methoxyfenozide-resistant strains

[0031] A draft genome sequence of strain JK-1 was performed, and the genome was annotated using RAST (Rapid Annotation with Subsystem Technology). A suspected ALS gene, named ImALS, was identified in the genome. Its nucleotide sequence is SEQ ID NO.1, 1785 bp in size, and expresses 594 amino acids. ImALS was compared with reported ALS amino acid sequences. The results showed that ImALS had very low similarity to reported ALS, with the highest similarity being only 57.59% with the ALS sequence of Escherichiacoli K-12. The sequence alignment results of ImALS and the ALS sequence of Escherichiacoli K-12 are shown below. Figure 2 As shown, there are 243 differences in amino acids.

[0032] Example 2: High-efficiency expression of the acetyllactate synthase gene ImALS in BL21(pET-29a(+))

[0033] 2.1 Synthesis and Amplification of the ImALS Gene

[0034] The nucleotide sequence (1785 bp) of the ImALS gene was synthesized by a commissioned biotechnology company, as shown in SEQ ID NO.1 of the sequence listing, which encodes the ImALS protein (594 amino acids), as shown in SEQ ID NO.2 of the sequence listing. The synthesized ImALS was cloned into the pUC57 vector, and the recombinant vector was named pUC-ImALS, which was then transformed into Escherichia coli DH5α.

[0035] With forward primer: 5'- CTTTAAGAAGGAGATATACAT ATGGAAATCTCCAAGGCGGA-3' and reverse primer: 5'- CTGGGTTCCGAAGATCTTTG Using GAGGTCCTCGGACCCCATCAG-3' as primers (underlined are homologous arms), the ImALS gene was amplified by PCR using pUC-ImALS as a template.

[0036] PCR amplification system:

[0037]

[0038] PCR amplification procedure:

[0039] a. Denature at 95℃ for 3 minutes;

[0040] b. Denaturation at 95℃ for 15 seconds, annealing at 58℃ for 15 seconds, extension at 72℃ for 30 seconds, for 30 cycles;

[0041] c. Extend at 72℃ for 10 minutes, then cool to room temperature.

[0042] PCR products were purified and recovered using a gel purification kit. For specific methods, please refer to the kit instructions.

[0043] 2.2 Double digestion and purification of plasmid pET-29a(+)

[0044] The vector pET-29a(+) was double-digested with Nde I and Xho I. The digestion system is as follows:

[0045]

[0046] After the reaction, the enzyme-digested plasmid fragments were purified using a gel extraction kit.

[0047] 2.3 Construction of expression vector pET-Imals and screening of positive transformants

[0048] The double-digested pET-29a(+) fragment and the ImALS target gene fragment (1782 bp, stop codon removed) were cloned using a homologous recombination one-step cloning kit. Homologous recombination was performed according to the instructions of the One Step Cloning Kit. The homologous recombination system is as follows (20 μL):

[0049]

[0050] Take one tube (100 μL) of E. coli BL21(DE3) competent cells from -80℃, thaw on ice, add 10 μL of homologous recombinant product (volume not exceeding 10% of competent cells), gently rotate the tube to mix, and incubate on ice for 30 min. Gently place the centrifuge tube in a 42℃ water bath for 60 s for heat shock, then return the centrifuge tube to ice for 5 min. Add 500 μL of LB medium, place the centrifuge tube in a 37℃ shaker at 150 rpm for 60 min to recover, and express the plasmid-encoded antibiotic resistance gene. Centrifuge at 5,000 rpm for 2 min, discard part of the supernatant, leaving about 200 μL. Mix the bacterial cells by pipetting, and spread 100 μL of the mixture evenly onto an LB agar plate containing 100 mg / L kanamycin. Incubate overnight at 37°C. Pick single colonies that have grown, and sequence them to verify that the target gene is ligated into the vector and has 6 His-tags at the end. Add this transformant BL21(ImALS) to 25% glycerol and store at -80°C for later use.

[0051] 2.4 Expression and purification of ImALS

[0052] BL21 (ImALS) was cultured in 100 mL of LB liquid medium at 37°C and 150 rpm on a shaker until the OD at 600 nm reached between 0.4 and 0.6. IPTG was then added to a concentration of 0.05 mM, and the culture was induced at 16°C for 10 hours. The bacterial cells were collected by centrifugation of 100 mL of the culture, washed twice with PBS (50 mM, pH 7.4), resuspended in 10 mL of PBS buffer, and sonicated (AutoScience, UH-650 Ultrasonic processor, 30% intensity) for 5-10 minutes. The cells were then centrifuged at 12000 rpm for 30 minutes, and the supernatant was collected. 2+ ImALS was purified using an ion affinity chromatography column, and the purity and size of the purified enzyme were detected by SDS-PAGE electrophoresis. Figure 3 The results showed that the purified protein appeared as a single band on the SDS-PAGE electrophoresis pattern, with a size of approximately 65 kDa, consistent with the predicted theory.

[0053] 2.5 ImALS Enzyme Activity Assay

[0054] The method used in this experiment to determine the activity of acetolactate synthase was an indirect colorimetric method. The acetolactate synthase product, acetolactate, undergoes deacetylation to generate 3-hydroxybutyric acid, which then reacts with creatine and naphthol to form a pink complex. The absorbance of this complex was measured at 525 nm. The reaction system consisted of 1.0 ml of enzyme reaction solution containing 20 mmol / L sodium pyruvate, 0.5 mmol / L MgCl2, 0.5 mmol / L TPP (thiamine pyrophosphate), 10 μmol / L LFAD (flavin adenine dinucleotide), pH 7.0, 50 mmol / L K2HPO4-KH2PO4 buffer, and an appropriate amount of purified ImALS protein. The enzyme reaction was carried out in the dark at 35°C for 1 h, and the reaction was terminated with 0.1 ml of 3 mol / L H2SO4 followed by decarboxylation at 60°C for 15 min. Then, 0.5 ml of 0.5% creatine and 0.5 ml of 5% α-naphthol solution (dissolved in 2.5 mol / L NaOH solution) were added, and the mixture was incubated at 60℃ for 15 min. The colorimetric value was measured at 525 nm. The results showed that the purified ImALS protein possessed ALS catalytic activity, and the specific enzyme activity of ImALS to sodium pyruvate was 0.52 mM / mg.

[0055] 2.6 ImALS Resistance Test

[0056] Enzyme reaction solution was prepared, and different concentrations of methoxymethylene tobacco were added to the reaction system to detect ALS resistance, and the IC50 of methoxymethylene tobacco against ImALS was determined. 50 (Hydroxil half-maximal inhibitory concentration (IC50) of the herbicide against ALS). Methoxyfenozide was added to 0.6 mL of enzyme reaction solution at concentrations of 0, 500, 1000, 1500, 2000, 2500, and 3000 μmol, with the remainder made up with 0.4 mL of enzyme solution. The reaction was carried out at 35 °C for 1 h, then terminated with 0.1 mL of 3 mol / L H₂SO₄. Decarboxylation was performed at 60 °C for 15 min. Color development was then performed using 0.5 mL of 0.5% creatine and 0.5 mL of 5% α-naphthol solution (dissolved in 2.5 mol / L NaOH solution), at 60 °C for 15 min, and the concentration was measured at 525 nm. The IC50 of methoxyfenozide against ImALS was finally determined. 50 1500μM ( Figure 4 The results indicate that ImALS can tolerate high concentrations of ALS inhibitor herbicides, thus it has great application potential in transgenic engineering resistant to methicillin.

[0057] Example 3: Construction of the rice expression vector for the acetyllactone synthase gene ImALS and its transformation with Agrobacterium.

[0058] Based on the coding region sequence of the acetyllactate synthase gene ImALS, gene-specific primers with homologous arms of the vector pCUbi1390 added to both ends were designed (forward primer: 5'- ACTAGGTACCTGCAGGTCGACGGATCC ATGGAAATCTCCAAGGCGGAACT-3' and reverse primer: 5'- GACTCCTCTTAGAATTCCCGGGGATCC Using a vector containing the ImALS gene as a template, the DNA sequence containing the coding region of the acetyllactate synthase gene was amplified. The vector was linearized using the restriction enzyme BamHI and ligated with the ImALS fragment to construct the corresponding transgenic vector ImALS-pCUbi1390. After sequencing verification of the transformants, plasmids were extracted and used for further processing.

[0059] 1 μL of the plasmid was added to 100 μL of slowly thawed Agrobacterium strain EHA105 competent cells (Weidi Bio, China) using a heat shock method. The cells were then flash-frozen in liquid nitrogen for 5 min, incubated at 42°C for 5 min, placed on ice for 5 min, and then 500 μL of LB broth was added. The cells were incubated at 28°C with shaking for 3 h. The cells were centrifuged and a portion of the supernatant was removed. Approximately 100 μL of the culture medium was retained to resuspend the cells, and the suspension was evenly spread onto solid LB agar plates containing 50 μg / mL rifampin and 50 μg / mL kanamycin. The plates were incubated upside down at 28°C for approximately 36 h. Single colonies were picked and PCR was performed using ImALS-specific primers (forward primer: 5'-ATGGAAATCTCCAAGGCGGAACT-3' and reverse primer: 5'-TCAGAGGTCCTCGGACCCCA-3') to verify successful vector transfer. To prevent individual colonies from having low infection activity, three single clones of Agrobacterium from each plasmid were selected for Agrobacterium-mediated rice genetic transformation.

[0060] Example 4: Agrobacterium-mediated genetic transformation of rice and identification of transgenic positive plants

[0061] 4.1 Obtaining callus tissue: Select plump and healthy rice varieties, specifically Nipponbare, and remove the husks. Surface sterilize in 70% ethanol for 1 minute, shaking continuously. Then sterilize with 3% sodium hypochlorite containing 1 drop of Tween-20 for 30 minutes, shaking on a shaker. Wash 5 times with sterile distilled water, approximately 2 minutes each time, shaking continuously. Then, use tweezers to remove the washed seeds and place them in a petri dish lined with 5 layers of sterile filter paper. Spread the seeds evenly on the filter paper, then cover with another 5 layers of filter paper to allow the seeds to dry. Place 15 seeds in callus induction solid medium (N6 salt, 4g; inositol, 0.1g; proline, 2.8g; hydrolyzed casein, 0.3g; sucrose, 30g; 2g / mL). 2,4-D, 1 mL; plant gel, 4 g; add deionized water to 1 L; autoclave) so that the endosperm is buried in the culture medium and the embryo is exposed on the surface of the culture medium, so that the scutellum is just in contact with the culture medium; place the culture dish in a 28°C culture room and culture under long-day conditions (16 h light / 8 h dark) for about 4 weeks until a large number of firm, light yellow callus masses grow.

[0062] 4.2 Agrobacterium preparation and co-culture: Three single colonies of Agrobacterium containing the acetyllactate synthase expression vector were collected using sterile toothpicks and inoculated into 20 mL of liquid LB medium containing 50 μg / mL rifampin and 50 μg / mL kanamycin. The culture was shaken and incubated for 36 h. After centrifugation at 5000 rpm for 2 min, the bacterial cells were resuspended in 1 mL of liquid N6 medium (N6 salt, 4 g; inositol, 0.1 g; hydrolyzed casein, 1 g; glucose, 10 g; sucrose, 30 g; 2 g / mL 2,4-D, 1 mL; deionized water added to 1 L; autoclaved; cooled, 1 mL of 100 mM acetylsylgenone was added). The bacterial concentration was measured using a UV spectrophotometer. The Agrobacterium resuspension was then diluted to OD using liquid N6 medium. 600 =0.08; Using tweezers sterilized at 300℃ and cooled, pick up rice callus tissue blocks and immerse them in diluted Agrobacterium solution for 20 minutes; discard the Agrobacterium solution, use sterile tweezers to pick up rice callus blocks, place them in a petri dish lined with 5 layers of sterile filter paper, spread the callus out, and then cover it with another 5 layers of filter paper. Dry the callus for 2 hours; add 500 μL of liquid N6 medium to the co-culture plate, place a piece of sterile filter paper with a diameter similar to that of the petri dish on the surface of the medium, ensuring the liquid evenly wets the filter paper, and then place the dried callus on the co-culture medium lined with filter paper (N6 salt, 4 g; inositol, 0.1 g; hydrolyzed casein, 1 g; glucose, 10 g; sucrose, 30 g; 2 g / mL). 2,4-D, 1 mL; plant gel, 4 g; add deionized water to 1 L; autoclave; after cooling, add 100 mM acetylsuccinone, 1 mL; seal the culture dish containing the callus tissue with breathable tape (3M, USA), then wrap the culture medium with aluminum foil, and co-culture at 25°C in the dark for 3 days.

[0063] 4.3 Screening of positive callus: Using sterile forceps, the co-cultured callus was washed 5 times with sterile water, and then washed once with sterile distilled water containing 500 μg / mL carbenicillin sodium. The callus was placed in a culture dish lined with 5 layers of sterile filter paper, spread out, and then covered with 5 more layers of filter paper to dry. The dried callus was then transferred to recovery medium (N6 salt, 4g; inositol, 0.1g; hydrolyzed casein, 1g; glucose, 10g; sucrose, 30g; 2g / mL). 2,4-D, 1 mL; add deionized water to 1 L; autoclave; after cooling, add 250 mg / mL carbenicillin, 1 mL) and place in a 28°C incubator for 3 days under long-day conditions (16 h light / 8 h dark); use sterile forceps to transfer the recovered callus to a selection medium containing 50 μg / mL hygromycin (N6 salt, 4 g; inositol, 0.1 g; hydrolyzed casein, 1 g; glucose, 10 g; sucrose, 30 g; 2 g / mL 2,4-D, 1 mL; add deionized water to 1 L; autoclave; after cooling, add 200 mg / mL carbenicillin sodium, 1 mL; add 50 mg / mL hygromycin B, 1 mL) and incubate under long-day conditions for 2–4 weeks until new, firm, light yellow callus grows.

[0064] 4.4 Regeneration and Culture of Transgenic Plants: Newly grown hygromycin-resistant callus from the selection medium was transferred to regeneration medium (MS salt, 4.33 g; hydrolyzed casein, 2 g; sorbitol, 30 g; sucrose, 30 g; 2 g / mL 2,4-D, 1 mL; deionized water added to 1 L; autoclaved; cooled, 200 mg / mL carbenicillin sodium, 1 mL; 50 mg / mL hygromycin B, 1 mL; 1 mg / mL NAA, 20 μL; 1 mg / mL NAA, 20 μL) On Kinetin (2 mL), cultured under long-day conditions (16 h light / 8 h dark) for 2–4 weeks until green seedlings emerge; use sterile forceps to remove the green seedlings and place them on solid 1 / 2 MS medium containing 25 μg / mL hygromycin until the seedlings grow to 5–8 cm; remove the seedlings, wash them, and place them in clean water, then incubate them in a 28°C incubator under long-day conditions for 3–5 days; transplant the transgenic seedlings into soil and plant them in a 32°C greenhouse under long-day conditions.

[0065] When the transgenic plants reach the 4-5 leaf stage, DNA is extracted from the surviving transgenic seedlings using a plant DNA extraction kit (Kangwei Century, China). PCR verification is then performed using ImALS gene-specific primers (forward primer: 5'-ATGGAAATCTCCAAGGCGGAACT-3' and reverse primer: 5'-TCAGAGGTCCTCGGACCCCA-3'). Plants that amplify the target band are considered transgenic positive plants.

[0066] Example 5: Herbicide treatment of transgenic plants expressing acetolactate synthase ImALS and wild-type rice

[0067] Ten to fifteen transgenic positive single plants of acetolactate synthase transgenic rice were selected and planted in the soil, while wild-type rice was planted simultaneously. When the seedlings reached the 3-leaf stage, DNA was extracted from each single plant as a template and amplified and verified using ImALS gene-specific primers (forward primer: 5'-ATGGAAATCTCCAAGGCGGAACT-3' and reverse primer: 5'-TCAGAGGTCCTCGGACCCCA-3'). Based on the Mendelian segregation ratio of 1:3 (plants without the target band: plants with the target band), transgenic lines containing a single copy insertion were selected and retained for further planting until the 4-5 leaf stage.

[0068] Transgenic rice and wild-type rice containing the acetolactate synthase gene were treated with 200 g / ha of methoxyimidazolium. Foliar spraying was performed on the rice using a pneumatic sprayer (GARDENA, Germany), ensuring even distribution of droplets across the leaf surface. After two weeks of cultivation in a 28℃ long-day environment, the growth of the plants was observed, and representative individual plants from independent lines were photographed and recorded. Figure 5 ).

[0069] Figure 5 The results showed that wild-type rice plants exhibited yellowing leaves, indicating significant herbicide damage; however, transgenic plants with acetolactate synthase ImALS did not show obvious herbicide damage. This indicates that acetolactate synthase ImALS can confer significant glufosinate resistance to transgenic rice.

[0070] Although specific embodiments of the invention have been described in detail, those skilled in the art will understand that various modifications and substitutions can be made to those details based on all the teachings disclosed, and these are all within the scope of protection of the invention. The full scope of the invention is given by the appended claims and any equivalents thereof.

Claims

1. A gene encoding an acetyllactate synthase ImALS ImALS Application in the transgenic engineering of methoxyprotea-resistant rice, wherein the transgenic engineering is the preparation of transgenic rice expressing the aforementioned acetyllactate synthase ImALS, characterized in that... The gene ImALS The nucleotide sequence is shown in SEQ ID NO.

1.

2. A gene encoding an acetyllactate synthase, ImALS. ImALS The application of this herbicide in the preparation of methoxyprotein-resistant acetolactate synthase, wherein the methoxyprotein-resistant acetolactate synthase is prepared by transgenic rice expressing acetolactate synthase ImALS, is characterized in that... The gene ImALS The nucleotide sequence is shown in SEQ ID NO.1.

Images