Sulfonylurea-tolerant brassica napus mutant genes and uses
By introducing the MYC-2 resource from Chinese cabbage into the ALS3 gene of Brassica napus, three nucleotide mutation sites were discovered and screened, solving the problem of limited germplasm for ALS-resistant rapeseed and enabling efficient screening and breeding of sulfonylurea-resistant rapeseed, thus adapting to mechanized rapeseed production.
Patent Information
- Application Number
- CN202610160548.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-02-04
- Publication Date
- 2026-06-05
AI Technical Summary
In domestic rapeseed production, the sources of ALS-tolerant herbicides are limited, the genetic base is not rich, and resistance is easily lost, making it difficult to promote and apply foreign rapeseed ALS-tolerant herbicide resources that are protected by patents.
Herbicide-tolerant resources from Chinese rapeseed MYC-2 were introduced into the ALS3 gene of Brassica napus. Through interspecific hybridization and molecular identification, three nucleotide mutation sites were identified and screened, encoding proteins with the same function and conferring tolerance to sulfonylurea herbicides. Homozygous mutant lines were screened by PCR amplification and sequencing using specific primers.
It provides new genetic resources, broadens the genetic background of Brassica napus, improves breeding efficiency, obtains new rapeseed germplasm with strong tolerance to sulfonylurea herbicides, reduces weeding costs and labor intensity, and adapts to mechanized and large-scale production.
Smart Images

Figure CN122146727A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of plant molecular breeding, specifically to the mutant gene of sulfonylurea herbicide tolerance in Brassica napus and its application. Background Technology
[0002] Rapeseed is one of the world's most important oilseed crops, and my country is one of the world's major rapeseed producers. The widespread use of chemical herbicides in rapeseed fields has played a significant role in controlling weeds, promoting crop yield, mechanizing production, and improving planting efficiency. Acetyllactone synthase (ALS), also known as acetylhydroxy acid synthase, is an important target enzyme for a class of currently developed highly efficient herbicides. These herbicides are collectively referred to as ALS-based herbicides or ALS inhibitor herbicides. ALS-based herbicides have advantages such as high selectivity, broad weed control spectrum, low dosage, low toxicity to mammals, and short soil residual period, and are widely used in production. Currently, herbicides developed targeting acetyllactone synthase (ALS) include five major categories: sulfonylureas (SU), imidazolinones (IMI), triazole pyrimidines (TP), pyrimidine salicylates (PB), and sulfonamides (SCT). Among them, sulfonylurea (SU) herbicides are widely used in production due to their high safety, low cost, and short soil residual period. Currently, ALS-tolerant herbicides used in rapeseed production abroad are protected by patents, making their widespread application in China difficult. The ALS-tolerant herbicides promoted and used in domestic rapeseed production are mainly new herbicide-resistant Brassica napus germplasm created by the Jiangsu Academy of Agricultural Sciences using EMS mutagenesis of germinating seeds and herbicide-directed screening technology. These germplasm features mutations at amino acid 197, amino acid 559, and amino acid 556 of the BnALS1 and BnALS3 genes. However, this approach carries risks such as a single source of resistant germplasm, limited genetic diversity, and the potential for loss of resistance.
[0003] Currently, ALS-tolerant herbicide resources used in rapeseed production abroad are protected by patents, making them difficult to promote and apply domestically. The ALS-tolerant herbicide germplasm widely used in domestic rapeseed production is mainly new herbicide-resistant Brassica napus germplasm created through EMS mutagenesis, which suffers from problems such as a single source of resistant germplasm and a limited genetic base. Therefore, developing new sulfonylurea-tolerant herbicide gene resources is of great significance for rapeseed breeding. Summary of the Invention
[0004] To address the above problems, this invention provides a mutant gene for rapeseed tolerant to sulfonylurea herbicides.
[0005] Specifically, the mutated gene is a mutation in the nucleotide sequence of the acetolactate synthase gene ALS3 in Brassica napus.
[0006] Specifically, the BnALS3 gene contains three new nucleotide mutation sites that cause it to change from being intolerant to sulfonylurea (SU) herbicides to being tolerant.
[0007] Specifically, the first mutation site is located at the 312th nucleotide in alanine (Ala), which is encoded by a mutation from T to C. This does not change the encoded amino acid, but the corresponding relative synonymous codon utilization (RSCU) changes from 1.667 in GCU to 0.696 in GCC.
[0008] Specifically, the second mutation site is located at nucleotide 535 of proline (Pro), which encodes amino acid 179. The mutation changes from C to G, and the encoded amino acid changes to alanine (Ala).
[0009] Specifically, the third mutation site is located at nucleotide 816, where a T mutation is changed to a C mutation, located in the intron region of the BnALS3 gene.
[0010] Specifically, the mutant gene was obtained by introducing the MYC-2 acetyllactate synthase gene, a herbicide-tolerant resource material from Brassica rapa, into Brassica napus through interspecific distant hybridization.
[0011] Specifically, the herbicide-tolerant resource material MYC-2 of Brassica rapa is preserved in the rapeseed germplasm resource conservation nursery of the Institute of Crop Sciences, Sichuan Academy of Agricultural Sciences (Sichuan Germplasm Resource Center), and it is tolerant to sulfonylurea herbicides.
[0012] Specifically, the nucleotide sequence encoding the ALS3 gene is shown in BnaA01gNR9.
[0013] Specifically, its coding sequence still encodes the same functional protein DNA sequence, even under the premise of degeneracy of plant genetic codons or base substitution at mutation sites.
[0014] Specifically, the protein is an acetolactate synthase protein whose amino acid sequence is identical to that of the wild-type BnaA01gzs11 BnALS3 protein at position 104, but confers tolerance to sulfonylurea herbicides to rapeseed.
[0015] Specifically, a method for breeding Brassica napus-type rapeseed.
[0016] Includes the following steps: a) Interspecific hybridization: Using MYC-2, a Chinese cabbage-type rapeseed resource material tolerant to sulfonylurea herbicides, as the male parent and N9, a superior inbred line of Brassica napus, as the female parent, hybridization was carried out to obtain allotetraploid F1 generation plants.
[0017] b) Backcrossing and breeding: F1 generation plants were continuously backcrossed with the Brassica napus parent N9. Sulfonylurea herbicides were sprayed on the F1 generation of interspecific distant hybridization between Brassica napus and Brassica napus, backcrossed from BC1F1 to BC6F1 generation and subsequent segregating populations for screening. Individual plants with normal growth and no herbicide damage symptoms were retained for backcrossing and self-pollination once in BC6F1 to obtain the herbicide-tolerant Brassica napus material NR9.
[0018] c) Molecular identification: Genomic DNA of NR9 was extracted, and the ALS3 gene was amplified by PCR and sequenced using specific primers to identify whether there were mutation sites at nucleotides 312, 535 and 816.
[0019] d) Homozygous screening: Through multiple generations of self-crossing and backcrossing, new rapeseed germplasm with homozygous ALS3 gene mutation sites and stable agronomic traits was screened.
[0020] Specifically, in step b, the screening method is as follows: when the rapeseed seedlings are at the 3-5 leaf stage, spray with a sulfonylurea herbicide at a production concentration of 4 times, and investigate the phenotype 21 days later, retaining plants carrying the ALS3 gene mutation site.
[0021] Specifically, in step c, the specific primer pair includes a forward primer and a reverse primer, and the nucleotide sequences obtained by amplification are shown as BnaA01gzs11 and BnaA01GNR9, respectively.
[0022] Specifically, the forward primer sequence is BnALS1F 5'GCACCTGAAAAAACCGACAAGAT3'.
[0023] Specifically, the reverse primer sequence is BnALS1R 5'TCAGTACTTAGTGCGACCATCCCCT3'.
[0024] Specifically, the selected sulfonylurea-tolerant rapeseed NR9 or its derivatives are crossed with herbicide-sensitive rapeseed varieties to produce commercial F1 hybrids tolerant to sulfonylurea herbicides.
[0025] Specifically, the primer pair is capable of specifically amplifying the BNALS3 gene fragment containing the nucleotide mutation sites at positions 312, 535, and 816 as described in claim 1.
[0026] Specifically, the primer pair described above is used to perform PCR amplification on the DNA of the rapeseed sample to be tested, and the presence of nucleotide mutations at positions 312, 535, and 816 as described in claim 1 is detected by sequencing or enzyme digestion analysis.
[0027] It has the following beneficial effects: (1) Providing new resistance loci: Three nucleotide mutation sites were discovered in the ALS3 gene of Brassica napus in this invention. This combination of mutation sites is different from the germplasm obtained by EMS mutagenesis which is widely used in current production, providing new genetic resources for rapeseed herbicide resistance breeding. Three new nucleotide mutation sites (at positions 312, 535, and 816) were discovered in the ALS3 gene of Brassica napus in this invention. Among them, the mutation at position 312 is a synonymous mutation (silent mutation), the mutation at position 535 is a missense mutation, and the mutation at position 816 is located in the intron region.
[0028] (2) Revealing new resistance mechanisms: The mutation at position 312 involved in this invention belongs to a synonymous mutation. This mutation may affect the translation speed and secondary structure stability of mRNA by changing the relative synonymous codon usage (RSCU) of the codon, and further change the conformation of the ALS enzyme protein, making it tolerant to sulfonylurea herbicides.
[0029] (3) Abundant genetic basis: In this invention, the excellent genes of Brassica rapa were introduced into Brassica napus by using the technique of wide cross between Brassica napus and Brassica rapa, broadening the genetic background of Brassica napus. Compared with the point mutations generated by chemical mutagenesis (EMS), the exogenous excellent genes introduced by sexual hybridization can combine the excellent traits of both parents, significantly broadening the genetic background of Brassica napus and avoiding the common problem of linkage drag in mutagenesis breeding. The herbicide-tolerant material NR9 created not only has strong resistance but also excellent agronomic traits, filling the technical gap in the directional improvement of ALS resistance in Brassica napus by interspecific hybridization using Brassica rapa resources.
[0030] (4) Strong tolerance and efficient screening: Rapeseed materials carrying this mutant gene can tolerate more than 4 times the commonly used production dose of sulfonylurea herbicides at the seedling stage. The molecular identification method provided in this invention can quickly and accurately screen out homozygous mutant single plants, improving the breeding efficiency.
[0031] (5) High application value, facilitating mechanized and simplified cultivation. The new herbicide-tolerant germplasm (NR9) and its derivatives provided in this invention can be directly used to prepare commercial F1 hybrid seeds. This enables the safe and efficient use of ALS inhibitor herbicides in rapeseed fields for "one-spray killing" or post-seedling treatment, effectively controlling gramineous and broad-leaved weeds. It greatly reduces the weeding cost and labor intensity of rapeseed production, and is very suitable for the urgent needs of mechanized, large-scale and simplified production in rapeseed production areas in China. Brief Description of the Drawings
[0032] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the structures shown in these drawings without creative effort.
[0033] Figure 1 This is a growth comparison diagram of sulfonylurea-resistant plants and non-sulfonylurea-resistant plants of Brassica napus containing the mutant gene for sulfonylurea herbicides. Figure 2 This is a growth diagram of a sulfonylurea-resistant plant containing a mutant gene for sulfonylurea-resistant rapeseed according to the present invention. Figure 3 This is a growth diagram of plants that are not resistant to sulfonylurea herbicides. Figure 4 This is the sequencing map of nucleotide 312 of the mutant gene of sulfonylurea herbicide-tolerant rapeseed in the present invention; Figure 5 This is a sequence comparison diagram of the 312th nucleotide of the sulfonylurea-resistant herbicide gene and the non-sulfonylurea-resistant herbicide gene in the F2 population of the sulfonylurea-resistant mutant gene of Brassica napus of this invention. Figure 6 This is the sequencing map of nucleotide 535 of the sulfonylurea herbicide-tolerant mutant gene in Brassica napus of this invention. Figure 7 This is a sequence comparison diagram of the 535th nucleotide of the sulfonylurea-resistant herbicide gene and the non-sulfonylurea-resistant herbicide gene in the F2 population of the sulfonylurea-resistant mutant gene of Brassica napus of this invention. Figure 8 This is the sequencing map of the 816th nucleotide of the sulfonylurea herbicide-tolerant mutant gene in Brassica napus of this invention; Figure 9 This is a sequence comparison diagram of the 816th nucleotide of the sulfonylurea-resistant herbicide gene and the non-sulfonylurea-resistant herbicide gene in the F2 population of the sulfonylurea-resistant mutant gene of Brassica napus of this invention. Detailed Implementation
[0034] It should be understood that the specific embodiments described herein are for illustrative purposes only and are not intended to limit the scope of the invention.
[0035] The following detailed description of the implementation method of the present invention is in conjunction with the accompanying drawings. The description only covers some embodiments and not all embodiments. For clarity, representations and descriptions unrelated to the present invention have been omitted from the drawings and description.
[0036] To provide a clearer understanding of the technical features, objectives, and beneficial effects of this invention, the following detailed description of the technical solution is provided. Obviously, the described embodiments are only a portion of the embodiments of this invention, not all of them, and should not be construed as limiting the scope of implementation of this invention. Based on the embodiments of this invention, all other embodiments obtained by those skilled in the art without inventive effort are within the protection scope of this invention. Example
[0037] This embodiment provides a mutant gene for sulfonylurea herbicides tolerance in Brassica napus.
[0038] In this embodiment, the mutated gene is a mutation in the nucleotide sequence of the acetolactate synthase gene ALS3 in Brassica napus.
[0039] In this embodiment, there are three new nucleotide mutation sites on the BnALS3 gene, which cause it to change from being intolerant to sulfonylurea (SU) herbicides to being tolerant.
[0040] In this embodiment, the first mutation site is located at the 312th nucleotide in the amino acid alanine (Ala), which is encoded by a mutation from T to C. The encoded amino acid is not changed, but the corresponding relative synonymous codon utilization (RSCU) changes from 1.667 in GCU to 0.696 in GCC.
[0041] In this embodiment, the second mutation site is located at nucleotide 535 of the amino acid proline (Pro), which is mutated from C to G, and the encoded amino acid is mutated to alanine (Ala).
[0042] In this embodiment, the third mutation site is located at nucleotide 816, where a T mutation is changed to a C mutation, and it is located in the intron region of the gene.
[0043] In this embodiment, the mutant gene was obtained by introducing the MYC-2 acetyllactate synthase gene, a herbicide-tolerant resource material from Chinese cabbage rape, into Chinese cabbage rape through interspecific distant hybridization.
[0044] In this embodiment, the herbicide-tolerant rapeseed resource material MYC-2 of the Chinese cabbage type is preserved in the rapeseed germplasm resource conservation nursery of the Institute of Crop Sciences, Sichuan Academy of Agricultural Sciences (Sichuan Germplasm Resource Center), and it is tolerant to sulfonylurea herbicides.
[0045] In this embodiment, the nucleotide sequence encoding the ALS3 gene is shown as BnaA01gNR9.
[0046] In this embodiment, the coding sequence still encodes the DNA sequence of the same functional protein, even under the premise of degeneracy of the plant genetic codon or base substitution at mutation sites.
[0047] In this embodiment, the protein is a mutant protein with acetolactate synthase activity, and its sequence has been mutated at amino acid positions 104, 179 and 816 compared to the wild-type BnaA01gzs11 BnALS3 sequence. Example
[0048] This embodiment provides a method for breeding Brassica napus.
[0049] Includes the following steps: a) Interspecific hybridization: Using MYC-2, a Chinese cabbage-type rapeseed resource material tolerant to sulfonylurea herbicides, as the male parent and N9, a superior inbred line of Brassica napus, as the female parent, hybridization was carried out to obtain allotetraploid F1 generation plants.
[0050] b) Backcrossing and breeding: F1 generation plants were continuously backcrossed with the Brassica napus parent N9. Sulfonylurea herbicides were sprayed on the F1 generation of interspecific distant hybridization between Brassica napus and Brassica napus, backcrossed from BC1F1 to BC6F1 generation and subsequent segregating populations for screening. Individual plants with normal growth and no herbicide damage symptoms were retained for backcrossing and self-pollination once in BC6F1 to obtain the herbicide-tolerant Brassica napus material NR9.
[0051] c) Molecular identification: Genomic DNA of NR9 was extracted, and the ALS3 gene was amplified by PCR and sequenced using specific primers to identify the presence of mutation sites at nucleotides 312, 535 and 816.
[0052] d) Homozygous screening: Through multiple generations of self-crossing and backcrossing, new rapeseed germplasm with homozygous ALS3 gene mutation sites and stable agronomic traits was screened.
[0053] In this embodiment, the specific screening method in step b is as follows: when the rapeseed seedlings are at the 3-5 leaf stage, a sulfonylurea herbicide with a production concentration of 4 times is sprayed, and the phenotype is investigated 21 days later, and plants carrying the ALS3 gene mutation site are retained.
[0054] In this embodiment, in step c, the specific primer pair includes a forward primer and a reverse primer. The forward primer is BnALS1F 5'GCACCTGAAAAAACCGACAAGAT3', and the reverse primer is BnALS1R 5'TCAGTACTTAGTGCGACCATCCCCT3'. The ALS3 sequences obtained by amplification are shown as BnaA01gzs11 and BnaA01GNR9, respectively. Example
[0055] In this embodiment, the selected sulfonylurea-tolerant rapeseed NR9 or its derivatives are hybridized with herbicide-sensitive rapeseed varieties to produce commercial F1 hybrids tolerant to sulfonylurea herbicides.
[0056] In this embodiment, the primer pair is capable of specifically amplifying the BnALS3 gene fragment containing the nucleotide mutation sites at positions 312, 535, and 816 as described in claim 1.
[0057] In this embodiment, the forward primer in the primer pair is BnALS1F 5'GCACCTGAAAAAACCGACAAGAT3', and the reverse primer is BnALS1R 5'TCAGTACTTAGTGCGACCATCCCCT3'. The amplified BnALS3 sequence is shown as BnaA01gzs11 and BnaA01GNR9.
[0058] In this embodiment, the primer pair described above is used to perform PCR amplification on the DNA of the rapeseed sample to be tested, and the presence of nucleotide mutations at positions 312, 535, and 816 as described in claim 1 is detected by sequencing analysis. Example
[0059] This embodiment provides a method for finding the mutant gene site of sulfonylurea herbicide tolerance in Brassica napus.
[0060] In this embodiment, the offspring of backcrossing and self-pollination were sprayed with a 4-fold dilution of bensulfuron-methyl at the 3-4 leaf stage. After 3 weeks, plants without phytotoxicity were retained and backcrossed or self-pollinated again.
[0061] In this embodiment, mutation sites were identified by comparing NR9-resistant with the intolerant parental material NO.1. 300 F2 generation plants were collected, and leaves were sequenced at the 3-4 leaf stage. Simultaneously, a 4-fold dilution of bensulfuron-methyl was applied. After 3 weeks, resistance was observed and recorded, with a resistant:intolerant ratio of 3:1. Mutations at the aforementioned three sites were identified by comparing the sequencing results of resistant and intolerant plants.
[0062] The above description is merely a preferred embodiment of the present invention. It should be understood that the present invention is not limited to the forms disclosed herein and should not be construed as excluding other embodiments. It can be used in various other combinations, modifications, and environments, and can be altered within the scope of the concept described herein through the above teachings or related technologies or knowledge. Modifications and variations made by those skilled in the art that do not depart from the spirit and scope of the present invention should be within the protection scope of the appended claims.
Claims
1. A novel site-mutated gene for tolerance to sulfonylurea herbicides in Brassica napus, characterized by: The mutated gene is a nucleotide sequence mutation in the acetolactate synthase gene BnALS3 of Brassica napus. Three new nucleotide mutation sites exist in the BnALS3 gene, causing it to change from intolerant to sulfonylurea (SU) herbicides: the first mutation site is located at nucleotide 312 of the amino acid alanine (Ala), encoding the 104th amino acid, where a T mutation is changed to a C mutation. This does not change the encoded amino acid, but the corresponding relative synonymous codon utilization (RSCU) changes from 1.667 in GCU to 0.696 in GCC. The second mutation site is located at nucleotide 535 of the amino acid proline (Pro), encoding the 179th amino acid, where a C mutation is changed to a G mutation, resulting in the encoded amino acid alanine (Ala). The third mutation site is located at nucleotide 816, where a T mutation is changed to a C mutation, and this mutation is located in an intron region.
2. The novel site mutation gene for sulfonylurea-tolerant rapeseed according to claim 1, characterized in that, The mutant gene was obtained by introducing the MYC-2 acetyllactate synthase gene, a herbicide-tolerant resource material from Brassica napus, into Brassica napus through interspecific distant hybridization. The MYC-2 herbicide-tolerant resource material from Brassica napus is preserved in the rapeseed germplasm resource conservation bank of the Institute of Crop Sciences, Sichuan Academy of Agricultural Sciences (Sichuan Germplasm Resource Center), and it is tolerant to sulfonylurea herbicides.
3. The novel site mutation gene for sulfonylurea-tolerant rapeseed according to claim 1, characterized in that, The nucleotide sequence encoding the ALS3 gene is shown in BnaA01gNR9; its coding sequence still encodes the same functional protein DNA sequence, even under the premise of degeneracy of plant genetic codons or base substitution at mutation sites.
4. A protein encoded by the mutant gene according to any one of claims 1-3, characterized in that, The protein is an acetolactate synthase protein with the same amino acid sequence as the wild-type BnaA01gzs11 BnALS3 protein at position 104, but it confers tolerance to sulfonylurea herbicides on rapeseed.
5. The application of the mutant gene according to any one of claims 1-3 in improving the tolerance of plants to sulfonylurea herbicides through gene editing technology, specifically a method for breeding Brassica napus, characterized in that... Includes the following steps: a) Interspecific hybridization: Using MYC-2, a Chinese rapeseed resource material resistant to sulfonylurea herbicides, as the male parent and N9, a superior inbred line of Chinese rapeseed, as the female parent, hybridization was carried out to obtain allotetraploid F1 generation plants; b) Backcrossing and breeding: F1 generation plants were continuously backcrossed with the Brassica napus parent N9. Sulfonylurea herbicides were sprayed on the F1 generation of interspecific distant hybridization between Brassica napus and Brassica napus, backcrossed from BC1F1 to BC6F1 generation and subsequent segregating populations for screening. Individual plants with normal growth and no herbicide damage symptoms were retained for backcrossing and self-pollination once in BC6F1 to obtain the herbicide-tolerant Brassica napus material NR9. c) Molecular identification: Genomic DNA of NR9 was extracted, and the ALS3 gene was amplified by PCR and sequenced using specific primers to identify whether there were mutation sites at nucleotides 312, 535 and 816. d) Homozygous screening: Through multiple generations of self-crossing and backcrossing, new rapeseed germplasm with homozygous ALS3 gene mutation sites and stable agronomic traits was screened.
6. The method for breeding Brassica napus-type rapeseed according to claim 5, characterized in that, In step b, the specific screening method is as follows: when the rapeseed seedlings are at the 3-5 leaf stage, spray with a sulfonylurea herbicide at a production concentration of 4 times, investigate the phenotype 21 days later, and retain plants carrying the ALS3 gene mutation site by combining PCR amplification and sequencing.
7. The method for breeding Brassica napus-type rapeseed according to claim 6, characterized in that, In step c, the specific primer pair includes a forward primer and a reverse primer, and the nucleotide sequences obtained by amplification are shown as BnaA01gzs11 and BnaA01GNR9, respectively.
8. A method for preparing a hybrid of Brassica napus and rapeseed, characterized in that, Using the sulfonylurea-tolerant rapeseed NR9 or its derivatives bred by the method described in any one of claims 5-7, and crossing it with herbicide-sensitive rapeseed varieties, a commercial F1 hybrid variety tolerant to sulfonylurea herbicides is produced.
9. A primer pair for detecting mutation sites in Brassica napus, characterized in that, The primer pair is capable of specifically amplifying the BnALS3 gene fragment containing the nucleotide mutation sites at positions 312, 535, and 816 as described in claim 1; preferably, the nucleotide sequences obtained by the primer pair amplification are shown as BnaA01gzs11 and BnaA01GNR9.
10. A method for detecting mutation sites in Brassica napus, characterized in that, This includes using the primer pair described in claim 9 to perform PCR amplification of the DNA of the rapeseed sample to be tested, and detecting whether the amplification product contains the nucleotide mutation at position 312 and / or position 535 and / or position 816 as described in claim 1 by sequencing or enzyme digestion analysis.