A method for constructing a non-human mammal model with spontaneous abnormal mood swings and its use

Abstract

The present invention provides a method for constructing a non-human mammal model with spontaneous abnormal mood swings and its use. Specifically, the present invention provides a NEK4 gene expression cassette, a construct containing the NEK4 gene expression cassette, or an expression vector. The present invention also provides a method for constructing an animal model, comprising transferring the NEK4 gene into a non-human mammal brain region or neuron to obtain a non-human mammal model with spontaneous abnormal mood swings that overexpresses the NEK4 gene. The animal model of the present invention is an effective animal model of neuropsychiatric diseases, which can be used to study neuropsychiatric diseases such as bipolar disorder, schizophrenia, depression, anxiety, phobia, autism spectrum disorder, and can be used for screening and testing experiments of specific drugs.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine, and in particular, relates to a method for constructing a non-human mammal model with spontaneous abnormal mood fluctuations and its use. Background Art

[0002] Mental illness refers to a large class of diseases in which brain function is disturbed, resulting in varying degrees of damage to mental activities such as cognition, emotion, and behavior, including severe mental illnesses such as schizophrenia, bipolar disorder, and depression. Mental illness not only seriously affects the normal life of patients, but also brings a heavy economic burden to their families and society. At present, genome-wide association studies (GWAS) have provided a large amount of information related to mental illness, creating the possibility of revealing the pathogenesis of mental illness. Single nucleotide polymorphisms (SNPs) across chromosome 3p21.1 are significantly associated with schizophrenia, bipolar disorder, and cognitive function, but their related mechanisms are still rarely reported.

[0003] Bipolar disorder is a serious mental illness that affects more than 1% of the world's population and is one of the leading causes of disability worldwide. Bipolar patients experience mood swings between mania (or hypomania) and depression, which is the most typical symptom of bipolar disorder. When the patient is in a hypomanic state (at least 4 days), he or she will be in high spirits, have increased physical activity, less sleep, and active thinking, but this hypomanic state generally does not have a significant impact on normal life. When the patient is in a manic period (at least 7 days), his or her mood reaches its peak, showing extreme activity, increased self-confidence, high mood and violent reactions, impulsiveness and irritability, a sense of omnipotence, and reduced sleep time. Mania can also develop to a more extreme level with psychotic symptoms, at which time the patient will experience disorientation (misperception of one's own condition or environment), association disorder (confusion of speech and thinking patterns), and auditory hallucinations. When the patient is in a depressive phase (lasting 2 weeks), the patient will lack confidence, have low self-esteem, low mood, reduced social skills, and decreased energy.

[0004] At present, animal models for bipolar disorder are mainly established by controlling genetic risk genes (such as SHANK2 / 3, ANK3, HOMER1), environmental stimulation or drug treatment, and abnormalities in the growth, number and shape of dendritic spines are often observed in these models, suggesting the potential role of synaptic function in the occurrence of bipolar disorder. However, it is worth noting that a potential limitation of bipolar disorder research is that most model animals only show manic, anxious or depressive behaviors during the experiment, and it is difficult to simulate the most important clinical symptom of bipolar disorder, that is, the patient's mood can switch between mania (hypomania) and depression. This shortcoming also greatly limits the application of these models in the analysis of the pathological mechanism of bipolar disorder and the screening of potential drugs.

[0005] Therefore, there is an urgent need in the art to develop a new non-human mammal model that can effectively simulate spontaneous abnormal mood swings. Summary of the invention

[0006] The purpose of the present invention is to provide a NEK4 gene expression cassette, a construct or an expression vector containing the NEK4 gene expression cassette, and a non-human mammal model that effectively simulates spontaneous abnormal mood swings. The animal model can simulate a clinical non-human mammal model of spontaneous abnormal mood swings, and can be widely used in the screening and evaluation of therapeutic techniques for treating diseases related to spontaneous abnormal mood swings and drugs.

[0007] In a first aspect of the present invention, there is provided a use of a NEK4 gene expression cassette, a construct containing the NEK4 gene expression cassette or an expression vector for preparing a preparation for constructing a non-human mammal model with spontaneous abnormal mood swings.

[0008] In another preferred embodiment, the expression vector is a viral vector.

[0009] In another preferred embodiment, the viral vector is selected from adenovirus, adeno-associated virus, lentivirus, or a combination thereof.

[0010] In another preferred embodiment, the preparation is an intracranial injection preparation.

[0011] In another preferred embodiment, the preparation is a gene editing reagent, and the gene editing reagent comprises a NEK4 gene expression cassette containing HA homology arms at both ends.

[0012] In another preferred embodiment, the gene editing reagent further comprises Cas9 protein or its encoding nucleic acid and sgRNA.

[0013] In another preferred embodiment, the gene editing reagent is used to integrate the NEK4 gene expression cassette into the genome of mice.

[0014] In another preferred embodiment, the integration site is the H11 safe insertion site.

[0015] In another preferred embodiment, the NEK4 gene in the non-human mammal model is overexpressed in brain regions and / or neurons.

[0016] In another preferred embodiment, the NEK4 gene is an exogenous NEK4 gene.

[0017] In another preferred embodiment, the gene expression cassette comprises a promoter, a NEK4 gene and a terminator connected in sequence.

[0018] In another preferred embodiment, the non-human mammal model with spontaneous abnormal mood swings has one or more characteristics selected from the following group compared with wild-type control animals:

[0019] 1) decreased open-field activity levels during the day and / or normal or increased open-field activity levels at night;

[0020] 2) decreased desire to explore novel environments during the day and / or increased desire to explore novel environments at night;

[0021] 3) no manic-like behavior or reduced manic-like behavior during the day, and / or increased manic-like behavior at night;

[0022] 4) decreased mania during the day and / or increased mania at night;

[0023] 5) increased anxiety-like behaviors during the day and / or no or decreased anxiety-like behaviors at night;

[0024] 6) Increased anxiety during the day and / or decreased anxiety at night.

[0025] In another preferred embodiment, the non-human mammal model is used as an animal model for studying neuropsychiatric diseases, including bipolar disorder, schizophrenia, depression, anxiety, phobia, and autism spectrum disorder.

[0026] In the second aspect of the present invention, a method for constructing a non-human mammal model that spontaneously experiences abnormal mood swings is provided, comprising the steps of: (a) transferring a NEK4 gene expression cassette, a construct containing the NEK4 gene expression cassette, or an expression vector into the brain region or neurons of a non-human mammal, thereby obtaining a non-human mammal model that spontaneously experiences abnormal mood swings and overexpresses the NEK4 gene.

[0027] In another preferred embodiment, in step (a), the NEK4 gene is treated with a viral vector or conditionally knocked in by CRISPR / Cas9 technology and then transferred into the brain region or neurons of a non-human mammal to obtain a non-human mammal model that overexpresses the NEK4 gene and spontaneously develops abnormal mood swings.

[0028] In another preferred embodiment, the viral vector is selected from adenovirus, adeno-associated virus, lentivirus, or a combination thereof.

[0029] In another preferred embodiment, the method for processing the viral vector comprises the following steps:

[0030] (a) constructing a NEK4-adeno-associated virus expression vector and packaging a NEK4-adeno-associated virus;

[0031] (b) injecting the NEK4-adeno-associated virus obtained in step (a) into the dorsal hippocampus of a non-human mammal to obtain an animal model in which the dorsal hippocampus overexpresses the NEK4 gene.

[0032] In another preferred embodiment, the method further comprises: step (b): determining the abnormal emotional fluctuation state of the non-human mammal model through animal behavior.

[0033] In another preferred embodiment, the non-human mammal is a rodent or a non-human primate, preferably including mice, rats, rabbits, and monkeys.

[0034] In another preferred embodiment, the method of conditional knock-in treatment using CRISPR / Cas9 technology comprises:

[0035] (1) Using CRISPR / Cas9 technology, sgRNA targeting the H11 site, a targeting vector containing CAG-LSL-NEK4-HA-polyA and a sequence homologous to the H11 site, and Cas9 protein were introduced into the fertilized eggs of non-human mammals to obtain engineered fertilized eggs;

[0036] (2) transplanting the engineered fertilized egg into a female individual of the non-human mammal to give birth to an F0 generation individual; hybridizing the F0 generation individual for at least one generation to obtain NEK4- flox / flox animal;

[0037] (3) Using Camk2a-Cre animals and the NEK4- flox / flox Animal hybridization was used to obtain a non-human mammal model that conditionally overexpressed the NEK4 gene in forebrain pyramidal neurons.

[0038] In another preferred embodiment, the non-human mammal model is used to screen or identify substances (therapeutic agents) that can alleviate or treat neuropsychiatric diseases.

[0039] In a third aspect of the present invention, a non-human mammal model with spontaneous abnormal mood swings is provided, wherein the non-human mammal model overexpresses exogenous NEK4 protein in neurons or specific brain regions.

[0040] In another preferred embodiment, the exogenous NEK4 protein is selected from the following group: human NEK4 protein, mouse NEK4 protein, or a combination thereof.

[0041] In another preferred embodiment, the experimental animal of the non-human mammal model with spontaneous abnormal mood swings is prepared by the method described in the second aspect of the present invention or by using the preparation of the use described in the first aspect of the present invention.

[0042] In the fourth aspect of the present invention, there is provided a use of a non-human mammal model prepared by the method described in the second aspect of the present invention or a non-human mammal model described in the third aspect of the present invention, which can be used for screening to identify potential therapeutic agents for treating or alleviating diseases associated with spontaneous abnormal mood swings.

[0043] In another preferred embodiment, the screening comprises the steps of: administering the candidate substance to the non-human mammal model to evaluate the effect of the candidate substance on the symptoms of spontaneously occurring abnormal mood swings; and optionally, killing the non-human mammal model.

[0044] In a fifth aspect of the present invention, a method for screening or identifying a potential therapeutic agent for treating or alleviating a disease associated with spontaneous abnormal mood swings is provided, comprising the following steps:

[0045] (1) In the experimental group, the candidate substance is applied to the non-human mammal model described in the third aspect of the present invention; in the control group, the same experimental conditions are used but a solvent not containing the candidate substance is applied;

[0046] (2) performing behavioral analysis on the behavior of the animal model and comparing it with that of the control group,

[0047] Among them, if the behaviors characterizing the spontaneous occurrence of abnormal mood swings-related diseases in the animal model administered with the candidate substance are improved compared with the control group, it indicates that the candidate substance can be used as a potential therapeutic agent for the spontaneous occurrence of abnormal mood swings-related diseases.

[0048] In another preferred embodiment, the behavioral analysis is selected from the following group: locomotor activity, open field test, elevated plus maze test, forced swimming or a combination thereof.

[0049] In another preferred embodiment, in step (2), when behavioral analysis shows that the symptoms of spontaneous abnormal mood swings are significantly improved, it indicates that the candidate substance can be used as a potential therapeutic agent for diseases related to spontaneous abnormal mood swings.

[0050] In another preferred embodiment, the significant refers to a statistically significant difference.

[0051] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features specifically described below (such as embodiments) can be combined with each other to form a new or preferred technical solution. Due to space limitations, they will not be described one by one here. BRIEF DESCRIPTION OF THE DRAWINGS

[0052] Figure 1The association analysis diagram of the chromosome 3p21.1 region and the genetic risk of bipolar disorder is shown. Figure A shows that the chromosome 3p21.1 region contains more than 20 genes, among which NEK4 is identified as a risk gene for bipolar disorder; Figure B shows that the relationship between SNPs spanning the chromosome region 3p21.1 (hg19chr3:52300000–53300000) and the risk of bipolar disorder is further analyzed in detail using the GWAS data of PGC3. Among them, rs2336147, rs7622851 and rs2276824 all showed association with the disease at the whole genome level (rs2336147: P=3.62×10 -13 rs7622851: P = 1.83 × 10 -11 ; rs2276824: P = 1.02 × 10 -10 ).

[0053] Figure 2 The results of the analysis of expression quantitative trait loci (eQTL) for three SNPs (rs2336147, rs7622851 and rs2276824) using RNA-seq data of hippocampal samples in the second phase of BrainSeq data set (n=371) are shown. Among them, Figure A shows the eQTL association results of the NEK4 gene with rs7622851, rs2336147 and rs2276824); Figure B shows the eQTL association results of the GNL3 gene with rs7622851, rs2336147 and rs2276824; Figure C shows the eQTL association results of the GLYCTK gene with rs7622851, rs2336147 and rs2276824 , where GG represents an individual whose SNP is G allele on both homologous chromosomes; CG represents an individual whose SNP is C and G allele on both homologous chromosomes; CC represents an individual whose SNP is C allele on both homologous chromosomes; CT represents an individual whose SNP is C and T allele on both homologous chromosomes; TT represents an individual whose SNP is T allele on both homologous chromosomes; GC represents an individual whose SNP is G and C allele on both homologous chromosomes.

[0054] Figure 3 The results of the differential expression analysis of bipolar disorder cases and controls for the hippocampus dataset are shown. Figure A shows the changes in NEK4 mRNA expression levels in the bipolar disorder case group and the control group; Figure B shows the changes in GNL3 mRNA expression levels in the bipolar disorder case group and the control group; Figure C shows the changes in GLYCTK mRNA expression levels in the bipolar disorder case group and the control group; where case represents the bipolar disorder case group and control represents the control group.

[0055] Figure 4 The schematic diagram of the NEK4-adeno-associated virus (AAV) injection scheme and the behavioral development scheme is shown. Among them, Figure A shows the NEK4-AAV virus injection site and fluorescence expression schematic diagram of the mouse dorsal hippocampus; Figure B shows the time scheme for behavioral detection of NEK4-AAV virus-injected mice, in which, as the age of the mice increases, NEK4-AAV virus injection (AAV injection) is performed on 7-8 week-old mice, Open Field experiment is performed on 11-week-old mice, Elevated Plus Maze experiment is performed on 12-week-old mice, Forced Swimming experiment is performed on 13-week-old mice, and Biorhythm detection is performed on 15-week-old mice; Among them, +Day1 represents the corresponding behavioral test carried out during the day on the first day of the corresponding age; +Night4 represents the corresponding behavioral test carried out at night on the fourth day of the corresponding age.

[0056] Figure 5 The figure shows the result of diurnal fluctuation of emotional behavior of mice caused by adeno-associated virus (AAV)-mediated NEK4 overexpression in the hippocampus in the open field test. Among them, Figure A shows the total movement distance of mice (mm); Figure B shows the time the mice stayed in the central area of ​​the open field (s); Figure C shows the time the mice stayed in the corner area of ​​the open field (s); the left side (white background) in Figures A, B and C represents the results of the open field test carried out during the day, and the right side (gray background) represents the results of the open field test carried out at night; Control represents the control group, and NEK4 OE represents the NEK4 overexpression group.

[0057] Figure 6 The figure shows the diurnal fluctuations of emotional behavior of mice caused by adeno-associated virus (AAV)-mediated NEK4 overexpression in the hippocampus in the elevated plus maze test. Figure A shows the total distance traveled by mice in all areas of the elevated plus maze (mm); Figure B shows the time mice stayed in the open arm (s); Figure C shows the movement distance of mice in the open arm (mm); the left side (white background) in Figures A, B, and C represents the results of the elevated plus maze test conducted during the day, and the right side (gray background) represents the results of the elevated plus maze test conducted at night; Control represents the control group, and NEK4 OE represents the NEK4 overexpression group.

[0058] Figure 7The figure shows the diurnal fluctuations in emotional behavior of mice caused by adeno-associated virus (AAV)-mediated overexpression of NEK4 in the hippocampus in the forced swimming test; immobility time represents the immobility time of mice (s), the left side (white background) represents the results of the forced swimming test conducted during the day, and the right side (gray background) represents the results of the forced swimming test conducted at night; Control represents the control group, and NEK4 OE represents the NEK4 overexpression group.

[0059] Figure 8 The free activity results of NEK4 overexpressing mice obtained in Example 1 were monitored for 3 consecutive days using the small animal metabolic and behavioral phenotyping system. The left side (white background) in the figure represents the free activity distance (m) monitored during the day (8:00 to 20:00), and the right side (gray background) represents the free activity distance (m) monitored from 20:00 to 7:00 in the evening; Control represents the control group, and NEK4 OE represents the NEK4 overexpression group.

[0060] Fig. 9 The figure shows the results of the circadian fluctuation of dendritic spine morphology in the dorsal hippocampal CA1 of mice caused by NEK4 overexpression. The left side of Figure A represents the schematic diagram of sparsely labeled neurons in the dorsal hippocampal CA1 region, red fluorescence indicates the injection site of NEK4 overexpression AAV, and green fluorescence indicates that there are sparsely labeled neurons in the CA1 region. Scale bar length: 100 µm; the right side of Figure A is a schematic diagram of the second or third order branches of the sparsely labeled neurons in the apical dendrites of the dorsal hippocampal CA1 region, scale bar length: 5 µm; Control represents the control group, NEK4 OE represents the NEK4 overexpression group; Day represents daytime; Night represents night; Figure B shows the effect of NEK4 overexpression on the circadian fluctuation of the morphology of dendritic spines of each subtype in the apical dendrites of neurons, where the criteria for judging the subtype of dendritic spines are as follows: if a dendritic spine has a head and a neck and the width of the head is greater than 0.6 µm, it is classified as a mushroom dendritic spine (Mushroom), otherwise it is a slender dendritic spine (Thin). When the dendritic spine has no obvious neck and the aspect ratio is <1, it is classified as a stubby dendritic spine (Stubby); Control represents the control group, and NEK4 OE represents the NEK4 overexpression group; Control-day and Control-night represent the control group during the day and night, respectively, and NEK4 OE-day and NEK4 OE-night represent the NEK4 overexpression group during the day and night, respectively; Figure C shows the effect of NEK4 overexpression on the circadian rhythm of the total dendritic spine density of neurons, where the left side (white background) in the figure represents the total dendritic spine density measured during the day, and the right side (gray background) represents the total dendritic spine density measured at night, Control represents the control group, and NEK4 OE represents the NEK4 overexpression group.

[0061] Fig.10 The results of the circadian fluctuation of synaptic formation in the dorsal hippocampal CA1 region of mice caused by NEK4 overexpression are shown. Among them, Figure A shows randomly taken photos of the synapses of the apical dendrites of pyramidal neurons in the dorsal hippocampal CA1 region of mice, where the upper figure represents the synaptic map of the dorsal hippocampal CA1 region of mice during the day, and the lower figure represents the synaptic map of the dorsal hippocampal CA1 region of mice at night. Figure B shows the statistical graph of the number of synapses in Figure A, the left side of the figure represents the number of synapses during the day, and the right side (gray background) represents the number of synapses at night; Control represents the control group, and NEK4 OE represents the NEK4 overexpression group. **P≤0.01, ****P≤0.0001.

[0062] Fig.11 The graph shows the results of lithium treatment improving the circadian rhythm fluctuations of emotional behavior of mice caused by NEK4 overexpression in the open field test and elevated plus maze test. Figure A shows the total movement distance (mm) of mice in the open field test; Figure B shows the distance traveled by mice in the central area of ​​the open field (mm); Figure C shows the time mice stayed in the central area of ​​the open field (s); Figure D shows the time mice stayed in the corner area of ​​the open field (s); Figure E shows the total distance traveled by mice in all areas of the elevated plus maze test (mm); Figure F shows the distance traveled by mice into the open arm of the elevated plus maze (mm); Figure G shows the time mice stayed in the open arm of the elevated plus maze (s); Figure H shows the time mice stayed in the closed arm of the elevated plus maze (s); In each figure, the left side represents the corresponding behavioral results carried out during the day, and the right side (gray background) represents the corresponding behavioral results carried out at night. Control represents the control group not treated with lithium salt, NEK4 OE represents the NEK4 overexpression group not treated with lithium salt, Control-Li represents the control group treated with lithium salt, and NEK4 OE-Li represents the NEK4 overexpression group treated with lithium salt. *P≤0.05, **P≤0.01.

[0063] Fig.12The graphs show the results of lithium treatment improving the circadian fluctuations of dendritic spines and synapses in mice caused by NEK4 overexpression. Among them, Figure A shows the effect of NEK4 overexpression in the lithium-treated and untreated groups on the circadian changes in the density of dendritic spines of various subtypes in the apical dendrites of pyramidal neurons in the dorsal hippocampal CA1 region of mice; Figure B shows the effect of NEK4 overexpression in the lithium-treated and untreated groups on the circadian changes in the number of synapse formation in the apical dendrites of pyramidal neurons in the dorsal hippocampal CA1 region of mice; Figure C shows the effect of NEK4 overexpression in the lithium-treated and untreated groups on the circadian changes in the thickness of the postsynaptic density (PSD thickness) of mice; Among them, Control-day represents the lithium-untreated control group during the day, Control-night represents the lithium-untreated control group at night, NEK4 OE-day represents the NEK4 overexpression group that is not treated with lithium during the day, and NEK4 OE-night represents the NEK4 overexpression group that was not treated with lithium salt at night, Control-Li-day represents the control group that was treated with lithium salt during the day, Control-Li-night represents the control group that was treated with lithium salt at night, NEK4OE-Li-day represents the NEK4 overexpression group that was treated with lithium salt during the day, and NEK4 OE-Li-night represents the NEK4 overexpression group that was treated with lithium salt at night. *P≤0.05, **P≤0.01, ****P≤0.0001.

[0064] Fig.13 The results of lithium treatment improving the effect of NEK4 overexpression on GSK3 phosphorylation level are shown in Figure A. Figure A shows that the dorsal hippocampus of control mice and NEK4 overexpression mice were taken during the day (Day) and night (Night) to detect the phosphorylation level of GSK3; the hippocampal tissues of two mice in the same group are numbered 1 and 2, respectively, such as Control-1 and Control-2 represent the hippocampal tissues of mice numbered 1 and 2 in the control group; NEK4 OE-1 and NEK4 OE-2 represent the hippocampal tissues of mice numbered 1 and 2 in the NEK4 overexpression group; Figure B shows that the dorsal hippocampus of lithium-treated and untreated control mice and NEK4 overexpression mice were taken during the day and night to detect the phosphorylation level of GSK3, and the hippocampal tissues of two mice in the same group were mixed together as a sample; the GAPDH at the bottom of the figure is a photo with a shorter exposure time, among which Control represents the control group without lithium treatment, and NEK4 represents the hippocampal tissues of mice in the same group. OE represents the NEK4 overexpression group not treated with lithium salt, Control-Li represents the control group treated with lithium salt, and NEK4OE-Li represents the NEK4 overexpression group treated with lithium salt; among them, P-GSK3α and P-GSK3β represent the phosphorylation of the corresponding S21 and S9 sites of GSK3α and GSK-3β, respectively; GAPDH represents the internal reference.

[0065] Fig.14 The diagram shows the breeding strategy diagram and expression verification result diagram of NEK4 conditional knock-in (NEK4 cKI) mice. Among them, Figure A shows the breeding strategy diagram of NEK4 conditional knock-in (NEK4cKI) mice; among them, NEK4-flox represents male NEK4-flox / flox mice, Camk2a-Cre represents female heterozygous Camk2a-Cre mice, NEK4-overexpression represents mice with NEK4 gene specifically knocked into CA1 pyramidal neurons in the forebrain, especially hippocampus, i.e. NEK4 conditional knock-in (NEK4 cKI) mice; Figure B shows the NEK4 expression verification result diagram in NEK4 conditional knock-in (NEK4 cKI) mice; among them, WT-1 and WT-2 represent wild-type mice numbered 1 and 2, respectively; NEK4 cKI-1 and NEK4 cKI-2 represent NEK4 conditional knock-in mice numbered 1 and 2, respectively.

[0066] Fig.15 The figure shows the diurnal fluctuation results of emotional behavior in NEK4 cKI mice in the open field test. Among them, Figure A represents the total movement distance (mm) of mice in the open field test; Figure B represents the distance (mm) of mice in the central area of ​​the open field; Figure C represents the time (s) of mice staying in the central area of ​​the open field; Figure D represents the time (s) of mice staying in the corner area of ​​the open field; Among them, the left side (white background) of the figure represents the open field test conducted during the day, the right side (gray background) represents the open field test conducted at night, Control represents the control group mice, and NEK4 ckI represents the NEK4 conditional knockout mice.

[0067] Fig.16 The graph shows the diurnal fluctuation results of emotional behavior of NEK4 cKI mice in the elevated plus maze test. Among them, Figure A shows the total movement distance (mm) of mice in all areas of the elevated plus maze test; Figure B shows the distance (mm) that mice enter the open arm in the elevated plus maze; Figure C shows the time (s) that mice stay in the open arm of the elevated plus maze; Figure D shows the time (s) that mice stay in the closed arm of the elevated plus maze.

[0068] Fig.17 The figure shows the diurnal fluctuation results of emotional behavior in NEK4cKI mice in the forced swimming test. The left side of the figure (white background) represents the forced swimming test conducted during the day, the right side (gray background) represents the forced swimming test conducted at night, Control represents the control group mice, and NEK4 ckI represents the NEK4 conditional knockout mice. DETAILED DESCRIPTION

[0069] After extensive and in-depth research, the inventors have established an animal model that can simulate the circadian rhythmic mood swings of patients with bipolar disorder, which can be used as an animal model of spontaneous abnormal mood swings for studying the pathogenesis of bipolar disorder and screening new drugs. It is a mouse or other non-human mammal with overexpressed NEK4 gene. The animal model of the present invention is an effective animal model of spontaneous abnormal mood swings, which can be used to study neuropsychiatric diseases such as bipolar disorder, schizophrenia, depression, anxiety, phobia, autism spectrum disorder, and can be used for screening and testing experiments of specific drugs.

[0070] the term

[0071] As used herein, the terms "NEK4" and "STK2" are used interchangeably and both refer to the NEK4 gene or protein component.

[0072] As used herein, the terms "a model mouse with spontaneous abnormal mood swings", "a non-human mammal model with spontaneous abnormal mood swings", "animal model", and "a bipolar disorder model" are used interchangeably and refer to the non-human mammal model with spontaneous abnormal mood swings described in the first aspect of the present invention.

[0073] NEK4 gene and its protein

[0074] NEK4 is a member of the NIMA kinase (NEKs) family. There are 11 NIMA kinases in the human body, namely NEK1-11. These 11 kinases have highly similar kinase domains at the N-terminus, but the regulatory domains at the C-terminus are significantly different in length and composition. This kinase family is another kinase family related to mitosis besides the Polo and Aurora kinase families, but the cell biological functions of NIMA kinases are still less studied, especially in the field of neurobiology. The NIMA kinase family is a serine / threonine kinase, so NEK4 was first named in the form of a kinase, called STK2. According to the single-cell data in The Human Protein Atlas database (https: / / www.proteinatlas.org / ), NEK4 is widely expressed in various human tissues. In addition to spermatogonia, NEK4 is highly expressed in excitatory neurons, inhibitory neurons, and ciliated cells. In cells, NEK4 protein is mainly present in the cytoplasm.

[0075] NEK4 exists in many different species, especially in mammals, with high homology, and is basically 700-800 amino acids in length (Table A, Table B). The human NEK4 gene (ENST00000233027.10) is located at Chromosome 3:52,708,444-52,770,940 in the human genome, with a total length of 62597 bp.

[0076] Table A: NEK4 gene and protein

[0077]

[0078] Table B: Homology of some NEK4 proteins

[0079]

[0080] Studies have shown that the heritability of bipolar disorder is higher than 80%. Thanks to the development of technology, multiple risk gene loci for bipolar disorder have been identified in the European population through genome-wide association studies (GWAS). Among them, the chromosome 3p21.1 region is a hot region identified by GWAS studies. In GWAS studies of mental illness, this region has been identified many times as being significantly associated with mental illness, such as Figure 1 As shown in A, this region contains more than 20 genes, among which NEK4 has been repeatedly identified as a risk gene for bipolar disorder in GWAS studies. The researchers found that NEK4 was significantly associated with bipolar disorder through a new epigenetic element-based whole transcriptome association study (ETWAS). In addition, my work published in Molecular Psychiatry in 2019 also identified NEK4 as an important candidate gene for mental illness using the Mendelian randomization method (SMR). It also shows that the risk alleles of the SNPs identified in the 3p21.1 region correspond to high expression of NEK4.

[0081] The inventors used the GWAS data of PGC3 (including 41,917 clinically diagnosed cases of bipolar disorder and 371,549 controls of European descent) to conduct a detailed analysis of the relationship between SNPs across the 3p21.1 (hg19chr3:52300000-53300000) chromosome region and the risk of bipolar disorder. Figure 1 As shown in B, 368 SNPs were found in this region and the tag SNPrs2336147 (P=3.62×10 -13 ) have different degrees of linkage disequilibrium (LD), and these 368 SNPs have achieved genome-wide statistical association with the disease (P ≤ 5.00 × 10 –8In addition, in the case samples and control groups with self-reported bipolar disorder in the PGC4 BD GWAS (including a total of 131,969 case samples and 2,322,416 control samples), another gene was found to be associated with rs2336147 or rs2276824 (rs7622851-rs2336147: r 2 =0.001;rs7622851-rs2276824:r 2 =0.001) showed the strongest association with bipolar disorder in the 3p21.1 region (P = 9.52 × 10 -10 ), in PGC3BDGWAS, except for rs2336147 (P=3.62×10 -13 ), rs7622851 and rs2276824 also showed genome-wide association with the disease (rs7622851: P = 1.83 × 10 -11 ;rs2276824:P=1.02×10 -10 ). These data indicate to some extent that there is an independent risk-associated signal for bipolar disorder in the chromosome 3p21.1 region.

[0082] Subsequently, PheWeb-based whole-brain imaging analysis using data from UKbiobank22 showed that the three independent SNPs (rs7622851, rs2336147, and rs2276824) were associated with structural indicators in multiple brain regions, including the hippocampus.

[0083] Therefore, the inventors used the data of hippocampal sample RNA-seq (n=371) in the second phase of BrainSeq dataset to analyze the expression quantitative trait loci (eQTL) of the three SNPs. Figure 2 As shown in Figure 2, three genes were significantly associated with these three SNPs, including NEK4 (rs7622851, P = 1.01 × 10 -5 ; rs2336147, P = 6.88 × 10 -11 rs2276824, P = 3.79 × 10 -5 , Figure 2 A), GNL3(rs7622851, P=5.63×10 -5 rs2336147, P = 2.39 × 10 -10 rs2276824, P = 1.56 × 10 -6 , Figure 2 B), GLYCTK(rs7622851, P=2.96×10 -8rs2336147, P = 1.83 × 10 -5 ; rs2276824, P = 3.82 × 10 -5 , Figure 2 C) At the same time, the risk alleles of these three bipolar disorder risk SNPs all correspond to the high expression of NEK4, GNL3 and GLYCTK mRNA.

[0084] Furthermore, in an analysis of the differential expression of bipolar disorder cases and controls in the hippocampus dataset, the results were Figure 3 As shown, case represents the bipolar disorder case group, and control represents the control group; Figure 3 A shows that the NEK4 mRNA expression in the bipolar disorder group was increased to a certain extent compared with the control group (P=0.031, bipolar disorder group: 7.519±0.087, control group: 7.447±0.097; mean±SD), which is consistent with the results of eQTL analysis. However, Figure 3 B shows that the mRNA expression level of GNL3 did not change significantly between the bipolar disorder group and the control group (P=0.834, bipolar disorder case group: 8.918±0.068, control group: 8.911±0.120; mean±SD); Figure 3 C shows that the mRNA expression level of GLYCTK had no significant change between the bipolar disorder group and the control group (P=0.412, bipolar disorder case group: 5.766±0.099, control group: 5.800±0.146; mean±SD). Therefore, the present invention mainly focuses on the NEK4 gene.

[0085] Neuropsychiatric diseases and diseases related to decreased neurogenesis

[0086] Neuropsychiatric diseases are a type of neurodevelopmental disorder caused by disorders of the nervous system, or more accurately, pathological changes in the brain's neural circuits, including bipolar disorder, autism spectrum disorder, schizophrenia, depression, anxiety, phobia, epilepsy, etc. Neurodevelopmental disorders such as abnormal neuronal development, improper modification of synaptic connections, and incorrect connections of neural circuits can all lead to serious neuropsychiatric diseases. Bipolar disorder is a typical neuropsychiatric disease. Studies have shown that abnormal neuronal growth and abnormal dendrite development lead to the occurrence of bipolar disorder.

[0087] Neuropsychiatric diseases and neuronal dendritic spines

[0088] Neuronal dendritic spines are generally considered to be the site of excitatory synapses, especially mushroom-shaped dendritic spines with enlarged heads that can accommodate more postsynaptic receptors and neuroligins, which are more conducive to the behavior of synaptic structures. Many autopsy brain tissue studies on neuropsychiatric diseases have reported abnormalities in dendritic spines in patients with bipolar disorder, schizophrenia, and depression, which can serve as an important endophenotype of mental illness.

[0089] H11 safe site

[0090] Random integration transgenic models have problems such as multiple copies, multiple insertion sites, unstable expression, and the need to establish lines. However, the use of safe harbor sites for site-specific insertion allows the predictable integration of exogenous genes into the genome without affecting the activity of endogenous genes. Common safe harbor sites for mouse genome integration include Rosa26, Hprt1, and H11. The H11 site (also called Hipp11) is located on chromosome 11 of the mouse, between two ubiquitously expressed and oppositely transcribed genes, Drg1 and Eif4enif1. Therefore, the risk of affecting the expression of endogenous genes after the insertion of exogenous genes is very small. In addition, this site is an open intergenic region that does not contain any endogenous promoter elements, which enables the exogenous genes integrated here to be stably expressed under the drive of the specified promoter and support interchromosomal recombination during meiosis. This gene region has been proven to be a safe harbor site in mice, humans, and pigs, and homozygous knock-in mice at this site can develop and reproduce normally. The H11 locus is used to construct a conditional knock-in mouse model, which can achieve stable and regulatable expression of exogenous genes and avoid unpredictable abnormal phenotypes that may be caused by systemic gene overexpression. It is widely used in the study of human disease genes. In this project, CRISPR / Cas9 technology can be used to insert the CAG-Loxp-Stop-Loxp-cDNA-polyA sequence at the H11 locus, that is, the broad-type strong promoter CAG and the exogenous target gene cDNA are separated by the Loxp-Stop-Loxp structure. Only after mating with tissue-specific Cre tool mice, STOP is removed and the target gene is expressed in specific cells or tissues.

[0091] Animal models

[0092] Animal model of human disease refers to animals with simulated manifestations of human disease established in various medical scientific research. According to the cause of their occurrence, they are classified into spontaneous animal models and induced or experimental animal models.

[0093] Spontaneous animal models refer to diseases that occur in experimental animals under natural conditions without any conscious artificial treatment. They include genetic diseases of mutant lines and tumor disease models of inbred lines. The biggest advantage of using such animal disease models to study human diseases is that the occurrence and development of the disease are very similar to the corresponding human diseases. They are all diseases that occur under natural conditions and have higher application value, but such models are difficult to source. In the art, the technology of introducing target genes through CRISPR-CAS9 technology is known, and these conventional techniques can be used in the present invention.

[0094] In the present invention, examples of non-human mammals include (but are not limited to): mice, rats, rabbits, monkeys, etc., preferably rats and mice. In the present invention, a fragment containing NEK4 is conditionally knocked into a non-mammalian fertilized egg to obtain a chimeric mouse containing NEK overexpression, and then a homozygous mouse with NEK overexpression is further obtained by screening, hybridization, etc. In a preferred embodiment of the present invention, the homozygous (or heterozygous) mice obtained by the present invention are fertile and develop normally. In addition, NEK overexpression can be inherited to offspring mice according to Mendel's law. This shows that the model animal of the present invention is suitable for large-scale and low-cost production.

[0095] Construction of animal models

[0096] In a preferred example of the present invention, the NEK4 gene is treated with adeno-associated virus or conditionally knocked in with CRISPR / Cas9 technology and then transferred into a non-human mammal to obtain an animal model that overexpresses the NEK4 gene and spontaneously develops abnormal mood swings.

[0097] In a preferred embodiment, the present invention provides a method for constructing a NEK4-adeno-associated virus:

[0098] The target gene NEK4 was amplified by PCR using synthetic amplification primers designed based on the known target gene NEK4 cDNA sequence, the upstream primer was shown in SEQ ID NO: 1, and the downstream primer was shown in SEQ ID NO: 2; the PCR product was recovered using an agarose gel recovery kit after the amplification;

[0099] The obtained target gene PCR product is double-digested with BamHI and HindIII endonucleases, and the rAAV vector is cut with these two endonucleases at the same time. The cut target gene and rAAV vector are mixed and connected with T4 DNA ligase at 21-23°C for 1 h, preferably 22°C;

[0100] The ligated product was transformed into bacterial competent cells, single clones were picked and plasmids were extracted, and the extracted plasmids were transfected into HEK293T cells. After 72 hours of culture, the cells were centrifuged and the cell supernatant rich in rAAV was collected;

[0101] The cell supernatant was purified and concentrated, and the purified NEK4-adeno-associated virus was collected and stored at -80°C.

[0102] In another preferred embodiment, the purified NEK4-adeno-associated virus is added at 4-5×10 12 GC / mL; preferably 5×10 12 The virus titer of GC / mL is injected into the dorsal hippocampus of non-human mammals to obtain an animal model in which the dorsal hippocampus overexpresses the NEK4 gene.

[0103] In another preferred embodiment of the present invention, an animal model of conditional overexpression of NEK4 gene in forebrain pyramidal neurons is obtained by conditional knock-in treatment using CRISPR / Cas9 technology, comprising the steps of:

[0104] Using CRISPR / Cas9 technology, sgRNA targeting the H11 site, a targeting vector containing CAG-LSL-NEK4-HA-polyA and a homologous sequence of the H11 site, and Cas9 protein are introduced into the fertilized eggs of non-human mammals to obtain engineered fertilized eggs;

[0105] The engineered fertilized egg is transplanted into a female individual of the non-human mammal to give birth to an F0 generation individual; the F0 generation individual is hybridized for at least one generation to obtain NEK4- flox / flox animal;

[0106] Camk2a-Cre animals were used with the NEK4- flox / flox Animal hybridization was used to obtain a non-human mammal model that conditionally overexpressed the NEK4 gene in forebrain pyramidal neurons.

[0107] Candidate substances or therapeutic agents

[0108] The present invention also provides a method for screening candidate substances or therapeutic agents for treating neuropsychiatric diseases using the animal model of the present invention.

[0109] In the present invention, candidate substances or therapeutic agents refer to substances known to have certain pharmacological activities or substances that are being tested and may have certain pharmacological activities, including but not limited to nucleic acids, proteins, carbohydrates, chemically synthesized small molecules or macromolecular compounds, cells, etc. The administration of candidate substances or therapeutic agents can be oral, intravenous, intraperitoneal, subcutaneous, spinal or direct intracerebral injection.

[0110] The present invention has the following main advantages:

[0111] (1) The spontaneous mood swing model mouse of the present invention can better simulate spontaneous mood swings in clinical practice, especially the circadian rhythmic mood swings of patients with bipolar disorder.

[0112] (2) For the model mice with spontaneous abnormal mood swings that overexpress the NEK4 gene after conditional knock-in treatment using CRISPR / Cas9 technology in the present invention, there are no differences between individuals caused by surgical operations or drug dosages, and their genetic backgrounds are highly consistent.

[0113] (3) The spontaneously abnormal mood swing model mice of the present invention can be used as a powerful tool for studying the pathogenesis of bipolar disorder and screening new drugs.

[0114] (4) The spontaneously abnormal mood swing model mice of the present invention spontaneously exhibit bipolar disorder-like behavioral symptoms, including changes in behavioral rhythmicity.

[0115] (5) The spontaneous abnormal mood fluctuation model of the present invention exhibits a variety of neurological and psychiatric disease-like symptoms, and can therefore be widely used in drug screening and testing for neuropsychiatric diseases, including bipolar disorder, schizophrenia, depression, anxiety, phobia, autism spectrum disorder, etc.

[0116] The present invention will be further described below in conjunction with specific examples. It should be understood that these examples are intended to illustrate the present invention only and are not intended to limit the scope of the present invention. The experimental methods for which specific conditions are not indicated in the following examples are usually performed under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer. Unless otherwise indicated, percentages and parts are weight percentages and weight parts.

[0117] Unless otherwise specified, the materials used in the examples are all commercially available products.

[0118] Some main reagents are summarized in Table 1 below:

[0119] Table 1:

[0120]

[0121] Example 1 Obtaining mice with adeno-associated virus (AAV)-mediated NEK4 overexpression in the dorsal hippocampus

[0122] 1.1 Construction of NEK4-AAV viral vector and virus packaging and purification

[0123] (1) Construction of NEK4 overexpression plasmid: AAV overexpression plasmid pAAV-CAG-tdTomato (#59462, Addgene) was linearized by digestion with BamHI and HindIII at 37°C for 1 h. The digestion system is shown in Table 2 below:

[0124] Table 2:

[0125]

[0126] The coding sequence of NEK4 (ENST00000233027) was obtained from the Ensembl database, and then upstream and downstream primers for NEK4 gene cloning were designed based on the coding sequence, as shown in Table 3 below:

[0127] Table 3:

[0128]

[0129] Using the cell line cDNA as a template, the NEK4 coding sequence was amplified by PCR (the PCR reaction system and procedure are shown in Table 4 below), and the PCR band size was determined by agarose gel electrophoresis to determine whether it met expectations, and finally the gel was cut and purified to recover the NEK4 coding sequence. The NEK4 PCR product was then digested with BamHI and HindIII enzymes at 37°C for 1 hour to expose the sticky ends, and the product was purified again for subsequent connection to the expression vector.

[0130] Table 4:

[0131]

[0132] After obtaining the linearized vector and NEK4 coding sequence through the above steps, the linearized vector and NEK4 PCR product were placed at 22°C for 1 hour. The connection system is shown in Table 5. Then, the competent state transformation was carried out: 50μL of bacterial competent state was added to the connection product and placed on ice for 20 minutes, and then the competent state was immediately placed on ice for 5 minutes after heat shock in a 42-degree water bath for 50 seconds, and then 1mL of LB culture medium was added and shaken at 37°C for 1 hour to restore the competent state. After centrifugation at room temperature for 10 minutes at 1000g, about 900μL of LB culture medium was removed, and the remaining about 900μL of culture medium was resuspended at the bottom of the EP tube with a pipette. After plating, picking bacterial monoclonal and plasmid extraction, Sanger DNA sequencing was used to verify that the NEK4 coding sequence was successfully inserted behind the CAG spectrum promoter of the pAAV-CAG-tdTomato vector.

[0133] Table 5:

[0134]

[0135] (2) Cell plating and transfection: HEK293T cells in a healthy state were cultured to 90% of the culture dish for cell passage, and the cells were plated at 4×10 6 The cells were plated at a density of 10000 ng in a 150 mm culture dish and cultured for 48 hours before plasmid transfection (cells grew to about 60%). Three plasmids were co-transfected in the following proportions (pAAV-CAG-tdTomato or pAAV-CAG-NEK4: 10000 ng, AAVDJ: 10000 ng, pHelper: 20000 ng), and PEI was used to mediate plasmid transfection into cells. PEI is a cationic polymer with a positive charge. When PEI is mixed with plasmid DNA, due to electrostatic effects, the positive charge of PEI and the negative charge of plasmid DNA attract each other to form a polymer complex. PEI wraps DNA into positively charged microparticles, which can adhere to negatively charged cell surface residues and enter cells through cell endocytosis, allowing the expression plasmid to be transcribed and translated in the cell.

[0136] (3) Cell harvesting and NEK4-AAV virus lysis:

[0137] 72 h after plasmid transfection, cells were scraped and centrifuged at 300 × g for 10 min at room temperature. After centrifugation, the supernatant was discarded to obtain cells containing NEK4-AAV virus particles.

[0138] Add cell lysis buffer solution (0.15M NaCl + 20mM Tris PH 8.0) to the centrifuged cells, and use a pipette to repeatedly pipette and resuspend the cells.

[0139] The suspension was placed in liquid nitrogen to rapidly solidify, and then thawed in a 37°C water bath. The rapid freezing and thawing process was repeated 4 times to fully lyse the cell membrane and release the NEK4-AAV virus particles inside the cells.

[0140] Add 0.5% sodium deoxycholate and 50U / mL Benzonase to the lysate and incubate in a 37°C water bath for 30 min. Sodium deoxycholate is a water-soluble bile acid, anionic detergent that is particularly useful for disrupting and separating protein interactions. Benzonase can completely digest nucleic acids released by cell rupture into 3-5 bases in length to avoid turbidity in the lysate.

[0141] After the incubation of NEK4-AAV virus lysate, the large cell debris was removed by centrifugation at 4°C, 3000×g for 10 min, and the supernatant was centrifuged at 4°C, 8000×g for 60 min to obtain the crude NEK4-AAV virus product (NEK4-AAV virus containing more impurities).

[0142] (4) NEK4-AAV virus ultracentrifugation and purification:

[0143] The crude NEK4-AAV virus was added to a 15%-25%-40%-54% iodixanol gradient and centrifuged at 350,000 × g for 2 hours at 18°C ​​to ultracentrifuge the crude NEK4-AAV virus.

[0144] Use a 10 mL syringe to extract the 40% iodixanol layer (where the NEK4-AAV virus is located after ultracentrifugation).

[0145] Add HBSS to the extracted liquid and centrifuge at 4°C, 5000×g for 10 min to remove possible impurities. Transfer the centrifuged viral liquid to an ultrafiltration tube and wash and purify it with HBSS solution and finally concentrate the NEK4-AAV virus to about 200 µL. NEK4-AAV virus needs to be stored in a −80°C refrigerator.

[0146] 1.2 NEK4-AAV virus titer determination

[0147] The pAAV-CAG-tdTomato plasmid was linearized with KpnI, and the restriction enzyme system was referred to the above 1、 Construction of NEK4-AAV virus vector and virus packaging and purification The vector was digested at 37°C for 1 h and the linearized plasmid was purified and recovered.

[0148] After the concentration was determined, this sample was set as the standard and diluted to the following concentrations, with the copy number set to 10 10 , 10 9 , 10 8 , 10 7 , 10 6 and 10 5 vg / mL. Take 5 µL of each purified and concentrated NEK4-AAV sample, treat with DNaseI (#EN0529, ThermoScientific) at 37°C for 30 min to remove possible plasmid components, then treat at 95°C for 10 min to inactivate DNaseI, and then dilute the NEK4-AAV virus 1:1000. The following real-time fluorescence quantitative PCR (RT-qPCR) reaction system and program were used to read the Ct values ​​of each gradient standard and NEK4-AAV virus sample. The RT-qPCR used ITR-specific primers as shown in Table 6 below:

[0149] Table 6:

[0150]

[0151] According to the Ct values ​​of each gradient standard and the standard curve of known concentration, the virus titer corresponding to the Ct value of the NEK4-AAV virus sample was calculated based on this standard curve.

[0152] 1.3 Stereotaxic brain injection

[0153] 7-week-old wild-type C57BL / 6J mice were used for brain stereotaxic injection experiments. Before surgery, the mice were placed in the induction anesthesia box and the anesthesia machine was adjusted to use 3% isoflurane gas to fully anesthetize the mice (usually 2-3 min). The isoflurane gas concentration of the anesthesia machine was adjusted to 1% and the gas supply path was switched to the mouse mask of the brain localization injection instrument. Then, the head of the mouse in a fully anesthetized state was quickly fixed to the localization injection instrument using the ear rod of the localization instrument. After that, the isoflurane gas concentration was maintained at 1% to continuously anesthetize the mouse. After the hair on the head of the mouse was cleaned with a hair trimmer to expose the skin, iodine was wiped for surface disinfection, and then the mouse scalp was cut open with small surgical scissors to expose the skull. After the skull surface was dry, the mouse bregma was clearly visible, and then the bregma was used as the origin to find the target brain area according to the mouse brain atlas coordinates, and a small hole with a diameter of 0.5 mm was drilled in the mouse skull with a cranial drill to deliver the NEK4-AAV virus. In this example, NEK4-AAV virus was injected into the dorsal hippocampus of mice. The injection site and fluorescence expression diagram are shown in FIG. Figure 4 As shown in A, the injection position is 2.06 mm posterior to the anterior fontanelle (AP: -2.06 mm); 1.50 mm lateral to the raphe (ML: ±1.50 mm); the skull (dura mater) is downward (DV: -1.50 mm), and bilateral injection is used. During the injection, the microinjection pump is assembled with a glass tube filled with mineral oil and with a very fine needle mouth pulled by a needle puller. After the microinjection pump sucks in the NEK4-AAV virus, the glass needle is placed above the drilled skull. The Z-axis knob of the positioning injection instrument is adjusted to make the glass needle slowly and smoothly descend 1.5 mm, that is, to reach the dorsal hippocampus of the mouse. After the needle is inserted, stop for 3 min and then inject 200 nL of NEK4-AAV virus at a rate of 60 nL / min. The NEK4-AAV virus titer is adjusted to 5×10 12 GC / mL. After the NEK4-AAV virus is injected, the needle is retained for 8-10 min to prevent the virus from spilling into other tissues, and the glass needle is finally removed. After the injection, the skin is sutured and disinfected with disinfectant. The mouse after the operation is completed is removed from the positioning instrument and placed on a 37°C electric blanket to restore normal consciousness, and the mouse is returned to the normal breeding environment. It is used for subsequent animal behavior experiments.

[0154] Example 2 Behavioral Analysis of Mice

[0155] When facing external stimuli, it is likely that emotions will fluctuate significantly. Light and emotions are closely related external stimuli. Therefore, the inventors tested whether day and night have an effect on the behavior of NEK4-overexpressing mice obtained in Example 1. The following behavioral studies are all carried out during the day and at night. The time for daytime behavior is from 9:00 am to 3:00 pm (lights on), and the time for evening behavior is from 21:00 pm to 24:00 pm (lights off). At the same time, in order to avoid the impact of behavioral studies on the normal activity state and emotions of mice, each behavioral study must be separated by more than three days. The time plan for behavioral testing of mice injected with NEK4-AAV virus is as follows: Figure 4 As shown in B.

[0156] Before the mouse behavior test was carried out, the experimental mice were transferred to the experimental room for one week to adapt to the environment of the behavior room. During this period, the experimenters gently stroked the mice every day to reduce the stress of the mice during the experiment. Before each behavioral test, the mice were placed in the behavior room for 1 hour in advance to adapt to the experimental environment. The experimental recording and analysis equipment was purchased from Shanghai Xinruan Information Technology Co., Ltd.

[0157] (1) Open Field Test (OFT): The open field test mainly evaluates the autonomous behavior of experimental animals in a novel environment. Rodents are afraid of new open environments and thus mainly move around in the surrounding environment. During the experiment, the square roofless test box was evenly divided into 16 grids, with the 4 grids in the central area defined as the central area and one grid in each of the four corners defined as the corner area (the experimental device was 40 cm (length) × 40 cm (width) × 40 cm (height)). During the experiment, the mice were placed in the central area, and the time and distance of the mice in the central area and the total time and distance in the four corners were tracked and recorded within 5 minutes. Mice that exhibited anxiety-like behavior spent less time or distance in the central area, and spent more time or distance in the four corners.

[0158] The results are as follows Figure 5 As shown, it was found that the behavior of NEK4 overexpressing mice had obvious diurnal fluctuations. In the open field test conducted during the day, there was no significant difference in the total movement distance between the control group and the NEK4 overexpressing group (control group, 17705±2893mm; NEK4 overexpressing group, 17671±6012mm, df=29, t=0.020, P=0.9842, n=15-16; Figure 5 A left). However, the time spent in the center area of ​​the open field by NEK4 overexpressing mice was significantly reduced (control group, 26.33±11.64 s; NEK4 overexpressing group, 18.53±9.37 s, df=29, t=2.062, P=0.0483, n=15-16; Figure 5B left), and stayed longer in the corner area of ​​the open field (control group, 153.0±17.79 s; NEK4 overexpression group, 178.3±34.49 s, df=29, t=2.542, P=0.0166, n=15-16; Figure 5 C left). However, in the open field test conducted at night, there was no difference in the time it took NEK4 overexpression mice and control mice to enter the central area of ​​the open field (control group, 27.80±11.85 s; NEK4 overexpression group, 31.57±13.08 s, df=29, t=0.837, P=0.4094, n=15-16; Figure 5 (A, right). These results suggest that NEK4-overexpressing mice transition from an anxious state during the day to a normal state at night.

[0159] (2) Elevated Plus Maze (EPM): The elevated plus maze uses the conflicting behaviors between rodents’ exploration tendency for novel environments (open arms) and their dark-loving nature (closed arms) to induce anxiety. The elevated plus maze device consists of closed arms and open arms that cross each other 75 cm above the ground. During the experiment, the mouse is placed with its back to the experimenter at the intersection of the open and closed arms, which is defined as the central area. The mouse is placed facing the open arm, and the time the mouse stays in the open and closed arms and the corresponding distance traveled within 5 minutes are tracked and recorded. The higher the anxiety level of the mouse, the shorter the time it stays in the open arm and the shorter the distance it moves.

[0160] The results are as follows Figure 6 As shown, in the elevated plus maze test conducted during the day, there was no significant difference in the total distance traveled between the control mice and the NEK4 overexpressing mice ( Figure 6 However, compared with the control group, the NEK4 overexpression group had a longer stay time in the open arm (control group, 22.38±13.05s; NEK4 overexpression group, 12.51±9.395s, df=26, t=2.297, P=0.0299, n=14-14, Figure 6 (B left) and movement distance (control group, 487.8±355.3 mm; NEK4 overexpression group, 230.1±220.9 mm, df=26, t=2.304, P=0.0294, n=14-14, Figure 6 C (left) were significantly increased, indicating that NEK4-overexpressing mice had higher anxiety levels during the day.

[0161] However, NEK4-overexpressing mice showed the opposite behavioral pattern at night, that is, the time NEK4-overexpressing mice stayed on the open arm was significantly increased compared with the control group (control group, 20.64±16.82 s; NEK4-overexpressing group, 44.74±20.98 s, df=28, t=3.472, P=0.0017, n=15-15; Figure 6 B right); in the open arm movement distance (control group, 1011±860.0 mm; NEK4 overexpression group, 1583±1008 mm, df=28, t=1.672, P=0.1056, n=15-15; Figure 6 C (right) showed an upward trend but did not reach a significant level, indicating that the NEK4 overexpression group mice had increased exploratory activity and manic-like behavior at night.

[0162] (3) Forced Swim Test (FST): The principle of forced swimming is to use the rodents' innate aversion to water. They will desperately swim in the water to try to escape the water environment. After a period of time, it was found that when there was no hope of escape, the animals would stop struggling and show a state of "behavioral despair" (floating immobile). Forced swimming is a common method for detecting antidepressant behavior in experimental mice. Therefore, the forced swimming test forces the animals to swim in a confined space from which they cannot escape. The swimming immobility time is used as the main indicator to detect the desperate behavior of the animals. During the experiment, water is poured into a transparent cylindrical bucket (diameter: 26 cm, height: 40 cm) to about 2 / 3 of the bucket height (water temperature 22-23°C), so that the mice's feet cannot touch the bottom of the bucket when struggling in the water. The record is continuously recorded for 8 minutes, and the immobility time of the mice in the last 6 minutes is analyzed. The shorter the immobility time, the lower the degree of depression of the mice.

[0163] The results are as follows Figure 7 As shown, in the forced swimming test conducted during the day, there was no difference in the immobility time of NEK4 overexpressing mice compared with that of control mice (control group, 134.3±58.36 s; NEK4 overexpressing group, 131.8±59.39 s, df=28, t=0.116, P=0.9086, n=15-15, Figure 7 Left side). However, in the forced swimming test conducted at night, the immobility time of NEK4 overexpressing mice was significantly reduced compared with that of the control group (control group, 171.6±79.46 s; NEK4 overexpressing group, 109.9±71.63 s, df=28, t=2.234, P=0.0337, n=15-15, Figure 7 (Right) This result confirmed that NEK4-overexpressing mice were more manic at night.

[0164] Behavioral results showed that NEK4 can affect the diurnal variation of mice's emotions, and abnormal rhythm is an important symptom of bipolar disorder patients, so the inventors suspected whether NEK4 affected the biological rhythm of animals. However, when the inventors used the small animal metabolic and behavioral phenotyping system to monitor the free activities of the NEK4 overexpressing mice obtained in Example 1 for 3 consecutive days to see whether there was a circadian rhythm disorder, the results were as follows: Figure 8 As shown, there was no significant difference in the biological rhythm of NEK4 overexpressing mice compared with control mice (n=3-3). In addition, the results provided by the CircaDB (http: / / circadb.hogeneschlab.org / ) database were queried, showing that the mRNA level of NEK4 was relatively stable between day and night. These results indicate that NEK4 does not affect the biological rhythm of mice.

[0165] Example 3 Sparse labeling of dorsal hippocampal neurons and dendritic spine analysis in NEK4 overexpressing mice

[0166] By searching for NEK4-interacting proteins, we found that NEK4 may have an important regulatory effect on postsynapses. By stereotaxic injection of sparsely labeled NEK4-AAV virus into the mouse brain, we explored the effect of NEK4 overexpression on excitatory postsynaptic structures, namely neuronal dendritic spines.

[0167] (1) NEK4-AAV virus injection: pAAV-CAG-tdTomato or pAAV-CAG-NEK4 overexpression adeno-associated virus (AAV) and neuron sparse marker virus NCSP-YFP (#BC-SL001, BrainCase) were mixed at a ratio of 2:1, and then the mixed virus was injected into the dorsal hippocampus of mice as described in 1.3 Stereotaxic injection in Example 1. About 3 weeks after the injection, brain tissues were taken during the day and at night to observe the effect of NEK4 overexpression on dendritic spines of mouse neurons.

[0168] (2) Mouse cardiac perfusion: Weigh the mouse and inject ketamine into the peritoneal cavity with a syringe according to the mouse weight (0.06 mL for a mouse weighing about 10 grams, and 150 µL for an adult mouse). After the mouse is fully anesthetized, fix the mouse on a foam board with its abdomen facing up, and then use surgical scissors to cut open the mouse chest and ribs to expose the intact heart. The perfusion needle is inserted into the left atrium from the apex of the heart and the right atrial appendage is cut open. Then, normal saline is used to drain the blood from the body until the liver turns visibly white. Finally, 4% paraformaldehyde is used to perform cardiac perfusion again to pre-fix the tissue. The mouse brain is removed by dissection and soaked in 4% paraformaldehyde overnight at 4°C for post-fixation.

[0169] (3) Brain tissue dehydration: The fixed mouse brain was washed three times with PBS on a side-swing shaker, each time for half an hour, and then the brain tissue was gradient dehydrated. First, the brain tissue was immersed in 8 mL of 20% sucrose PBS solution and placed in a 4°C refrigerator until the brain tissue settled to the bottom of the tube, and then replaced with 30% sucrose PBS solution for related operations.

[0170] (4) Brain tissue embedding and sectioning: When the brain tissue sinks to the bottom of the tube in the 30% sucrose PBS solution, take out the sample, use absorbent paper to absorb the sucrose solution remaining on the surface of the brain tissue sample, and then put it into a square embedding mold. Add embedding agent OCT to the mold and put it in a −80°C refrigerator to quickly freeze the sample. Before slicing, place the embedded sample in a slicer to balance for about 1 hour, then use a freezing slicer to cut the brain tissue sample into slices with a thickness of 50 µm. Collect the brain slices at the location of the dorsal hippocampus and place them in a 24-well plate filled with PBS.

[0171] (5) Immunofluorescence staining of brain slices: The slices were washed three times with PBS to remove the embedding agent OCT as much as possible, and then blocked with 2% goat serum in PBS at room temperature for one hour. Then the blocking solution was removed, and 2% goat serum + 0.2% TritonX-100 + antiFLAG antibody PBS solution was added to incubate the primary antibody in a refrigerator at 4°C overnight. The next day, the primary antibody liquid was removed and the samples were washed three times with PBS, once every 10 minutes. Then 2% goat serum + 0.2% TritonX-100 + AlexaFluor594 antibody PBS solution was added to incubate the secondary antibody at room temperature for 1 hour. Finally, DAPI was used for nucleus staining (1:1000 diluted in PBS) at room temperature for 10 minutes, and then the slices were washed three times with PBS and sealed.

[0172] (6) Photographing and analysis of neuronal dendritic spines: The 2-3 branches of the apical dendrites of the dorsal hippocampal CA1 pyramidal neurons were selected for photography. The dorsal hippocampal CA1 neurons were randomly photographed using the Z-Stack system of a Zeiss confocal microscope (LSM880 Basic Operation) (using a 100x lens, a resolution of 1024×1024 pixels, and 41 consecutive photos with a step size of 0.25 µm). In each batch of experiments, approximately 20 neurons were randomly photographed from approximately 8 brain slices, and the experiment was repeated 3 times. NeuronStudio software was used to analyze the shape and density of secondary or tertiary dendritic spines in the neuronal dendrites in the photographed images. At least two branches were analyzed for each neuron, and the average was calculated as the density of each type of dendritic spine and the total dendritic spine density of the neuron. The criteria for judging the subtype of dendritic spines are as follows: If a dendritic spine has a head and a neck and the width of the head is greater than 0.6 µm, it is classified as a mushroom dendritic spine (mushroom); otherwise, it is a slender dendritic spine (thin). When the dendritic spines had no obvious neck and the aspect ratio was <1, they were classified as stubby. Two-tailed t-test and Bonferroni post-hoc two-way ANOVA were used to evaluate the differences in dendritic spines between experimental groups. *P≤0.05, **P≤0.01, ***P≤0.005, ****P<0.0001.

[0173] The results are as follows Fig. 9 As shown in A, NEK4 overexpression leads to circadian fluctuations in dendritic spine morphogenesis. Specifically, the stubby dendritic spines ( Fig. 9 B Left Stubby group) and total dendritic spine density ( Fig. 9 C) No difference.

[0174] But if Fig. 9 As shown in the Mushroom group on the right in B, the density of mushroom-shaped dendritic spines in NEK4-overexpressing mice was higher than that in the control group during the day (control group, 3.885±0.645; NEK4-overexpressing group, 5.366±0.973, df=99, t=3.541, P=0.0018, n=19-16); while at night, the trend was just the opposite, that is, the density of mushroom-shaped dendritic spines in NEK4-overexpressing mice was lower than that in the control group (control group, 5.196±0.860; NEK4-overexpressing group, 3.243±0.823, df=75, t=3.815, P=0.0008, n=14-13), indicating that NEK4 exerts a strong effect on dendritic spines in a circadian manner.

[0175] In addition, if Fig. 9As shown in the Thin group in the middle of B, NEK4 overexpression led to a significant decrease in the density of slender dendritic spines during the day (control group, 11.587±1.867; NEK4 overexpression group, 9.220±2.054, df=99, t=5.663, P<0.0001, n=19-16), while this effect disappeared at night.

[0176] It is worth noting that the above results also showed that the density of mushroom-shaped dendritic spines in mice at night (Control-night) was higher than that during the day (Control-day), while the number of slender dendritic spines was less (day: mushroom-shaped dendritic spines, 3.885±0.6455; night: mushroom-shaped dendritic spines, 5.196±0.8599, df=31, t=5.009, P<0.0001, n=19-14. Day: slender dendritic spines, 11.59±1.867; night: slender dendritic spines, 10.25±2.180, df=31, t=1.895, P=0.0675, n=19-14). This result may be related to the fact that mice are nocturnal animals.

[0177] Neuronal dendritic spines are generally considered to be the site of excitatory synapses, especially mushroom-shaped dendritic spines with enlarged heads that can accommodate more postsynaptic receptors and neuroligins, which are more conducive to the behavior of synaptic structures. Therefore, we further explored whether overexpression of NEK4 in mice would cause changes in synaptic structure. Transmission electron microscopy images of hippocampal tissues of mice injected with NEK4 overexpression virus were analyzed by stereotaxic (the position of the top dendrites of hippocampal CA1 was randomly collected in a double-blind manner, and the area was 19 μm 2 , the magnification is 20000, such as Fig.10 A).

[0178] The results are as follows Fig.10 As shown in B, the number of synapses formed per unit area in the hippocampal CA1 region of NEK4-overexpressing mice and control mice also showed significant differences, and also had circadian rhythms. The number of synapses formed by NEK4-overexpressing mice during the day was significantly higher than that of the control group (control group, 8.421±2.143; NEK4-overexpressing group, 11.79±2.070, df=36, t=4.928, P<0.0001, n=19-19), but the number of synapses formed by NEK4-overexpressing mice at night was significantly lower than that of the control group (control group, 8.421±2.143; NEK4-overexpressing group, 11.79±2.070, df=37, t=3.481, P=0.0013, n=19-19). Therefore, the results of dendritic spines and synaptic structure all proved that NEK4 affects the circadian rhythm of synapse formation.

[0179] Example 4 Lithium salt improves diurnal fluctuations in emotional behavior of mice caused by NEK4 overexpression

[0180] There is currently no gold standard to measure whether an animal model of bipolar disorder is a bipolar model. The above examples observed that overexpression of NEK4 in the mouse hippocampus caused diurnal fluctuations in the emotional behavior of mice. In order to better illustrate the relationship between the NEK4 gene and the onset of bipolar disorder, this example further uses clinical drugs to explore whether the drug can improve the emotional disorder of mice caused by NEK4 overexpression. Emotional instability is a key clinical manifestation of patients with bipolar disorder. Lithium salts are the most commonly used mood stabilizers in the treatment of bipolar disorder. Therefore, the effect of lithium salts on the emotional behavior of NEK4-overexpressing mice was explored. At the same time, in order to simulate the blood lithium concentration of clinical treatment, the inventors used intraperitoneal injection of lithium salts to quickly increase the blood lithium concentration of mice, and then added lithium salts to the drinking water of mice to maintain the blood lithium concentration of mice at a certain concentration after drug treatment. Lithium salts are slow to take effect in clinical practice, so chronic treatment is also used for administration. After two weeks of drug treatment, behavioral tests were performed on the experimental mice. The specific behavioral process is described in Example 3; the results are as follows Fig.11 As shown:

[0181] (1) In the open field test, in the lithium-untreated group, it was still observed that the NEK4-overexpressing mice had higher anxiety levels during the day than the control mice (total distance traveled by NEK4-overexpressing mice ( Fig.11 A) and the distance to the central area ( Fig.11 B) less, stay in the corner area ( Fig.11 D) longer), but at night the emotional behavior of the NEK4 overexpression group mice was comparable to that of the control group mice. In the lithium-treated group, lithium significantly reduced the anxiety-like behavior of the NEK4 overexpression mice during the day, that is, compared with the untreated group, the lithium-treated NEK4 overexpression mice entered the central area of ​​the open field and stayed there for a longer time ( Fig.11 C) longer, staying in the open field corner area ( Fig.11 D) Less, no significant difference compared with the wild-type group.

[0182] (2) In the elevated plus maze test, it was also observed that the NEK4 overexpression group mice had higher anxiety levels during the day compared with the control group mice (total distance traveled by NEK4 overexpression mice ( Fig.11 E) and the distance to the open arm ( Fig.11 F) and residence time ( Fig.11 G) is less, and the residence time in the closed arm ( Fig.11 H) longer), but at night, the anxiety level of NEK4 overexpressing mice was significantly lower than that of control mice (the distance NEK4 overexpressing mice entered into the open arms ( Fig.11 F) and residence time ( Fig.11G) more, in closed arm dwell time ( Fig.11 H) shorter). In the lithium-treated group, lithium significantly alleviated the anxiety-like behavior during the day and mania-like behavior at night in NEK4-overexpressing mice. In summary, NEK4-overexpressing mice exhibit fluctuations in emotion-related behaviors that can be rescued by lithium treatment, suggesting that these mice may mimic the abnormal mood shifts seen in patients with bipolar disorder.

[0183] Example 5 Lithium salt improves the diurnal fluctuation of dendritic spines and synapses in mice caused by NEK4 overexpression

[0184] After observing that lithium salt improved the diurnal fluctuations in emotional behavior of mice caused by NEK4 overexpression, we further explored the effect of lithium salt treatment on the synaptic structure of NEK4 overexpressing mice. Fig.12 As shown,

[0185] Fig.12 A shows that NEK4 overexpression in the lithium untreated group changed the morphology of dendritic spines during the day and at night, especially in the mushroom-shaped dendritic spines (Control-day group: 3.354±0.4261; NEK4 OE-day group, 4.553±0.9704, df=69, t=3.471, P=0.0027, n=12-13. Control-night group, 4.684±0.5967; NEK4 OE-night group, 2.463±0.8469, df=72, t=5.252, P<0.0001, n=13-13). However, lithium treatment alleviated the diurnal fluctuations in the abnormal morphology of dendritic spines (especially mushroom-shaped dendritic spines) in NEK4 overexpressing mice (Control-Li-day group: 3.557±0.2477; NEK4 OE-Li-day group: 3.144±0.6154, df=69, t=1.043, P=0.6058, n=12-13. Control-Li-night group: 4.392±0.6069; NEK4 OE-Li-night group: 4.295±0.6461, df=75, t=0.3374, P=0.9818, n=13-14).

[0186] Fig.12B also shows that in the lithium untreated group, NEK4 overexpression caused abnormalities in the number of synapse formation in mice during the day and night (Control-day group: 9.893±2.149; NEK4 OE-day group: 11.760±2.444, df=55, t=3.056, P=0.0035, n=28-29. Control-night group: 11.570±2.373; NEK4 OE-night group: 9.214±3.281, df=56, t=3.144, P=0.0027, n=30-28). Lithium treatment alleviated the abnormal changes in the number of synapses during the day and night caused by NEK4 overexpression (Control-Li-day group: 10.90±2.119; daytime: NEK4 OE-Li-day group: 11.18±2.653. Control-Li-night group: 11.57±2.348; NEK4 OE-Li-night group: 11.34±2.497).

[0187] In order to further explore the effect of NEK4 on the structure and function of synapses, the inventors simultaneously studied the structure of the postsynaptic density (PSD) of the above mice. Fig.12 C shows that in the lithium untreated group, the PSD thickness of the control mice increased slightly at night compared with that during the day (day: 26.71±8.263; night: 31.81±4.713, df=43, t=2.604, P=0.0126, n=20-25). At the same time, compared with the control group, the NEK4 overexpression mice were found to have increased PSD thickness during the day and decreased PSD thickness at night (day: control group, 26.71±8.263; day: NEK4 overexpression group, 33.58±9.178, df=38, t=2.478, P=0.0173, n=20-20. Night: control group, 31.81±4.713; night: NEK4 overexpression group, 23.99±6.117, df=45, t=4.940, P<0.0001, n=25-22). At the same time, it was consistently found that lithium salt treatment could alleviate the abnormal changes in PSD thickness caused by NEK4 overexpression (during the day: Control-Li group, 28.59±5.414; NEK4 OE-Li group: 26.45±4.810. At night: Control-Li group, 33.43±6.183; NEK 4OE-Li group: 35.51±8.283).

[0188] Example 6 NEK4 overexpression downregulates lithium target GSK3β phosphorylation but does not show diurnal fluctuation

[0189] Bipolar disorder is currently mainly treated with drugs in clinical practice, including mood stabilizer lithium salts, which are commonly used drugs in clinical treatment. Although lithium salts have a relatively long history as a first-line drug for the treatment of bipolar disorder, their use in treatment is not a drug designed by medicine, but it was discovered by chance that lithium salts have a therapeutic effect on bipolar disorder. In fact, many drugs for the treatment of mental illnesses were discovered accidentally, so the mechanism of action of many psychiatric gene drugs including lithium salts is not clear. Lithium salts are now considered to have multiple targets, but it is now clear that lithium salts (Klein and Melton, 1996) are inhibitors of GSK-3β. Studies on multiple clinical samples have found that the phosphorylation level of GSK-3β has changed, especially the two sites S9 and S21, which show reduced phosphorylation levels in samples from patients with bipolar disorder. The main mechanism of GSK3 activity regulation is the phosphorylation of its N-terminal serine (S) residue, among which GSK3β is mainly related to the degree of S9 phosphorylation, and GSK3α is mainly related to the degree of S21 phosphorylation, and phosphorylation of these two sites has an inhibitory effect on GSK3 kinase activity. Overactivity of GSK-3β is currently believed to be one of the causes of bipolar disorder, and lithium salts can inhibit overactivity of GSK-3β.

[0190] In this example, the effect of NEK4 overexpression on the phosphorylation level of GSK3β in the hippocampus tissue of mice in the lithium salt treatment group and the untreated group was detected by western blot. Fig.13 As shown, NEK4 overexpression significantly reduced the phosphorylation levels of the corresponding S21 and S9 sites of GSK3α and GSK-3β, both during the day and at night ( Fig.13 A and 13B). Moreover, lithium treatment can rescue this hypophosphorylation change to a certain extent.

[0191] Example 7 NEK4 conditional knock-in mice lead to circadian fluctuations in emotional behavior

[0192] 7.1 Obtaining mice with NEK4 knock-in specifically in hippocampal CA1 pyramidal neurons and forebrain

[0193] Wild-type C57BL / 6J mice were purchased from Jiangsu Jicui Pharmaceutical Biotechnology Co., Ltd.

[0194] (1) Knock-in gene: relevant information is shown in Table 7:

[0195] Table 7:

[0196]

[0197] (2) Vector construction:

[0198] According to the design plan, gRNA (CTGAGCCAACAGTGGTAGTA) was designed, constructed and transcribed in vitro, and a homologous recombination vector (targeting vector: containing CAG promoter-Loxp-Stop-Loxp- NEK4 -HA-WPRE-polyA and the homology arm of the H11 site) to target the universal safe site H11 of gene knock-in mice, and the correctness of the vector sequence was verified by sequencing. The relevant primer sequences are shown in Table 8 below:

[0199] Table 8:

[0200]

[0201] (3) Microinjection and identification of F0 generation mice:

[0202] Cas9, gRNA and targeting vector samples were microinjected into fertilized eggs of mice with C57BL / 6JGpt background; the surviving fertilized eggs after injection were transplanted into pseudo-pregnant female mice and waited for them to become pregnant and give birth. The F0 generation pups born by the recipient mice were numbered after their tails and toes were cut on days 5-7, and genomic DNA was extracted for PCR and sequencing identification to confirm the genotype. Since the F0 generation mice obtained by the fertilized egg injection method may be chimeras / heterozygous / homozygous, the genotype of the F0 generation mice obtained by genotyping the tails of the F0 generation mice is for reference only and does not necessarily mean that it is a heritable gene mutation. The heritable genotype needs to be determined after the genotype identification of the F1 generation mice.

[0203] (4) Breeding of positive F0 generation mice:

[0204] After the positive F0 generation mice reached sexual maturity, they were mated with wild-type background mice; the F1 generation mice born were numbered after their tails and toes were cut at 5-7 days, and genomic DNA was extracted for PCR and sequencing to confirm the genotype. The relevant primer sequences are shown in Table 9 below:

[0205] Table 9:

[0206]

[0207] (5) Expansion of F1 mice and mating with Camk2a-Cre mice:

[0208] Before mating with Cre-expressing mice, the NEK4-HA gene expression is in a closed state. After mating with Cre-expressing mice, the gene can be overexpressed in specific tissues or cells. NEK4 -HA gene. First, homozygous NEK4 cKI flox male mice, and Camk2a-Cre (JAX: 005359) positive tool female mice (to avoid germline leakage) to obtain an animal model that specifically overexpresses the NEK4 gene in the forebrain, especially in the hippocampal CA1 pyramidal neurons ( Fig.14 A). Validation by Western blot NEK4 Overexpression of Fig.14 B) for subsequent experiments.

[0209] NEK4- flox / flox Mice and Camk2a-Cre tool mice were housed in transparent, independently ventilated standard cages (IVC) with 4-5 mice per cage. Mice had free access to food and water, and the mouse breeding room was set to a 12-h light / dark cycle (lights on at 08:00 and off at 20:00, respectively), and the temperature was set to 22°C. All experiments were approved by the Animal Ethics Committee of the Kunming Institute of Zoology (NO: SMKX-2021-11-001) and complied with the guidelines of the National Advisory Committee on Laboratory Animal Research.

[0210] 7.2 Behavioral analysis of NEK4 conditional knock-in mice

[0211] The behavioral test in this example refers to the method described in Example 2: The specific results are as follows:

[0212] (1) In the open field experiment, the results are as follows Fig.15 As shown in Figure 2, NEK4 conditional knockout mice (NEK4 ckI) switched from an anxious state during the day to a normal state at night. Specifically, NEK4 conditional knockout mice were significantly different from control mice in terms of total movement distance ( Fig.15 A) and the time spent in the corner area ( Fig.15 D) There was no significant difference, but NEK4 conditional knock-in mice traveled more in the central area during the day ( Fig.15 B) was less than that of the control group (control group, 3132±1266mm; NEK4 cKI group, 1862±946.4mm, df=14, t=2.272, P=0.0393, n=8-8), but the difference between the two groups of mice disappeared at night. Fig.15 The same phenomenon was also observed in C).

[0213] (2) In the elevated plus maze, the results are as follows Fig.16 As shown, the total daytime mileage of NEK4 cKI mice ( Fig.16 A) and the distance in the open arm ( Fig.16 B) was significantly higher than that of control mice; and the time that NEK4 cKI mice stayed in the open arms during the day ( Fig.16 C) significantly less than the control group mice, and the time they stayed in the closed arm ( Fig.16 D) was significantly longer than that of control mice (open arm time: control group, 55.83±26.52 s; NEK4 cKI group, 17.10±10.64 s, df=14, t=3.833, P=0.0018, n=8-8. Closed arm time: control, 205.0±33.87 s; NEK4 cKI group, 261.3±13.74 s, df=14, t=4.363, P=0.0006, n=8-8). At night, they showed the opposite behavior pattern. The NEK4 cKI mice stayed on the open arm for a longer time ( Fig.16 C) was significantly longer than the control group, and the time spent in the closed arm ( Fig.16 D) was significantly less than that in the control group (open arm time: control group, 28.77±12.84 s; NEK4 cKI group, 50.87±17.89 s, df=14, t=2.839, P=0.0131, n=8-8. Closed arm time: control group, 256.1±19.93 s; NEK4 cKI group, 231.4±19.03 s, df=14, t=2.535, P=0.0238, n=8-8).

[0214] (3) In the forced swimming test, the movement state of mice was detected within 8 minutes, and the immobility time of mice was analyzed after 6 minutes. Fig.17 As shown in Figure 2, depressive-like mood was observed to be different between day and night in NEK4 cKI mice, although this did not reach statistical significance. Taken together, these results suggest that NEK4 cKI mice induce circadian fluctuations in emotional behavior.

[0215] discuss

[0216] Mood swings are the most typical clinical feature of bipolar disorder, but the biological mechanisms behind mood swings are still poorly understood. So far, some animal models that can simulate manic-like behaviors have been successfully constructed, including circadian rhythm gene regulation, such as Clock-19 mutant mice (Roybal et al., 2007), sleep deprivation (Gessa et al., 1995), and the use of psychostimulants such as cocaine, amphetamine, and dialkyl methamphetamine. These models have made outstanding contributions to the understanding of bipolar disorder (Macêdo et al., 2013). However, few animal models show spontaneous mood changes similar to those of patients with bipolar disorder.

[0217] NEK4 is located in the 3p21.1 chromosome region, which is one of the most important genetic loci in GWAS studies of bipolar disorder. The inventors have demonstrated that independent bipolar disorder risk SNPs in this region consistently predict higher NEK4 mRNA expression levels in the hippocampus. Previous studies have shown that overexpression of this gene leads to changes in the morphology of dendritic spines in primary cultured neurons.

[0218] The inventors have for the first time used transgenic and AAV virus injection methods to construct NEK4-overexpressing mice, and for the first time truly simulated the spontaneous fluctuations between daytime anxiety-like behaviors and nighttime mania-like behaviors found in clinical practice, and are expected to establish an animal model of spontaneous abnormal mood fluctuations with broad application value.

[0219] The present invention uses this animal model to explore the mechanism of emotional transition. Although NEK4 overexpressing mice show circadian fluctuations in emotion-related behaviors, the gene does not affect the circadian biological rhythm of mice, indicating that it may affect biological events that follow circadian changes.

[0220] Secondly, the inventors observed in control mice that the active state of mice was consistent with the changes in their synaptic structure, and all of these indicators increased significantly at night. Although this finding may reflect the activity state of mice as nocturnal animals, it also emphasizes that the synaptic structure exists in a steady-state fluctuation in a circadian rhythm. This form of existence of synapses has also been discovered recently, which has greatly promoted people's understanding of synaptic function (deVivoetal., 2017). The present invention found that overexpression of NEK4 led to a significant interruption of this synaptic steady-state dynamics, that is, NEK4 overexpression led to an increase in mushroom-shaped dendritic spine density, synapse number and PSD thickness during the day, and a decrease at night, accompanied by the generation of behavioral abnormalities. Therefore, it is speculated that the disorder of the synaptic "internal clock" can explain the effect of this gene on emotional behavior.

[0221] In addition, the inventors further found that while lithium treatment restored synaptic homeostasis, it also improved the behavioral abnormalities of NEK4 overexpressing mice. It is worth noting that lithium treatment also led to a slight trend of slightly lower daytime activity and slightly higher nighttime activity in control mice, which may reflect the previous study showing that lithium can enhance the amplitude of circadian rhythms (McCarthy and Welsh, 2012).

[0222] Through comprehensive evaluation, the animal model of the present invention mainly reflects the characteristics of bipolar disorder and can be used as an animal model for screening drugs for treating bipolar disorder. At the same time, it is expected to be used to study the relationship between NEK4 and other pathogenic genes of bipolar disorder to further analyze the pathogenesis of bipolar disorder.

[0223] The inventors used the advanced CRISPR-Cas9-assisted transgenic technology and adeno-associated virus transfection technology to construct for the first time a non-human mammal model with spontaneous abnormal mood swings. NEK4 is overexpressed in this model. The disease model of the present invention can be used to analyze the function of NEK4 at the organism level to determine the cause and pathogenesis of NEK4 in bipolar disorder, which has important scientific significance. In addition, by conducting drug treatment on such an animal model, it is expected to lay the foundation for the development of new prevention and treatment technologies and drugs.

[0224] All documents mentioned in the present invention are cited as references in this application, just as each document is cited as reference individually. In addition, it should be understood that after reading the above teachings of the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the claims attached to this application.

Claims

1. A use of a NEK4 gene expression cassette, a construct containing the NEK4 gene expression cassette or an expression vector, characterized in that: For preparing a preparation, the preparation is used to construct a non-human mammal model with spontaneous abnormal mood swings; in the non-human mammal model, the NEK4 gene is overexpressed in brain regions and / or neurons; the non-human mammal model spontaneously exhibits bipolar disorder-like behavioral symptoms, Wherein, the abnormal mood fluctuations include circadian rhythmic mood fluctuations, and wherein the NEK4 gene is a human NEK4 gene.

2. The use according to claim 1, characterized in that The expression vector is a viral vector.

3. The use according to claim 2, characterized in that: The viral vector is selected from adenovirus, adeno-associated virus, lentivirus, or a combination thereof.

4. The use according to claim 1, characterized in that The preparation is an intracranial injection preparation.

5. The use according to claim 1, characterized in that: The preparation is a gene editing reagent, which contains a NEK4 gene expression box with HA homology arms at both ends.

6. The use according to claim 5, characterized in that The gene editing reagent is used to integrate the NEK4 gene expression cassette into the genome of the mouse.

7. The use according to claim 6, characterized in that The integration site is the H11 safe insertion site.

8. The use according to claim 1, characterized in that In the non-human mammal model, overexpression of the NEK4 gene leads to circadian fluctuations in dendritic spine morphogenesis.

9. The use according to claim 1, characterized in that The non-human mammal model of spontaneous abnormal mood swings has one or more characteristics selected from the following group compared with wild-type control animals: 1) decreased open-field activity levels during the day and normal or increased open-field activity levels at night; 2) a decrease in the desire to explore novel environments during the day and an increase in the desire to explore novel environments at night; 3) No manic-like behavior or reduced manic-like behavior during the day and increased manic-like behavior at night; 4) decreased mania during the day and increased mania at night; 5) increased anxiety-like behaviors during the day and no or decreased anxiety-like behaviors at night; 6) Increased anxiety levels during the day and decreased anxiety levels at night.

10. The use according to claim 1, characterized in that The non-human mammal model is an animal model used to study neuropsychiatric diseases, including bipolar disorder, schizophrenia, depression, anxiety, phobia, and autism spectrum disorder.

11. A method for constructing a non-human mammal model that spontaneously experiences abnormal mood swings, characterized in that: Includes steps: (a) transferring a NEK4 gene expression cassette, a construct containing the NEK4 gene expression cassette or an expression vector into a brain region or neuron of a non-human mammal, thereby obtaining a non-human mammal model that overexpresses the NEK4 gene and spontaneously develops abnormal mood swings, wherein the NEK4 gene is a human NEK4 gene.

12. The construction method according to claim 11, characterized in that: In step (a), the NEK4 gene is treated with a viral vector or conditionally knocked in using CRISPR / Cas9 technology and then transferred into the brain region or neurons of a non-human mammal to obtain a non-human mammal model that overexpresses the NEK4 gene and spontaneously develops abnormal mood swings.

13. The construction method according to claim 12, characterized in that: The method for processing the viral vector comprises the following steps: (a) constructing a NEK4-adeno-associated virus expression vector and packaging a NEK4-adeno-associated virus; (b) injecting the NEK4-adeno-associated virus obtained in step (a) into the dorsal hippocampus of a non-human mammal to obtain an animal model in which the dorsal hippocampus overexpresses the NEK4 gene.

14. The construction method according to claim 11, characterized in that: The method further comprises: step (b): determining the abnormal emotional fluctuation state of the non-human mammal model through animal behavior.

15. The construction method according to claim 11, characterized in that: The non-human mammal is a rodent or a non-human primate.

16. The construction method according to claim 12, characterized in that: The method of conditional knock-in treatment using CRISPR / Cas9 technology includes: (1) Using CRISPR / Cas9 technology, sgRNA targeting the H11 site, a targeting vector containing CAG-LSL-NEK4-HA-polyA and a sequence homologous to the H11 site, and Cas9 protein were introduced into the fertilized eggs of non-human mammals to obtain engineered fertilized eggs; (2) transplanting the engineered fertilized egg into a female individual of the non-human mammal to give birth to an F0 generation individual; hybridizing the F0 generation individual for at least one generation to obtain NEK4- flox / flox animal; (3) Using Camk2a-Cre animals and the NEK4- flox / flox Animal hybridization was used to obtain a non-human mammal model that conditionally overexpressed the NEK4 gene in forebrain pyramidal neurons.

17. The construction method according to claim 16, characterized in that: The non-human mammal model is used to screen or identify therapeutic agents that can alleviate or treat neuropsychiatric diseases.

18. The construction method according to claim 11, characterized in that: The non-human mammals include mice, rats, rabbits, and monkeys.

19. Use of a non-human mammal model prepared by the construction method of claim 11, characterized in that: It can be used for screening to identify potential therapeutic agents for treating or alleviating disorders associated with spontaneously occurring abnormal mood swings.

20. A method for screening or identifying a potential therapeutic agent capable of treating or alleviating a disease associated with spontaneous mood swings, comprising the following steps: (1) In the experimental group, the candidate substance is applied to the non-human mammal model prepared by the construction method of claim 11; in the control group, the same experimental conditions are used but the applied substance is replaced with a corresponding solvent that does not contain the candidate substance; (2) Conduct behavioral analysis on the behavior of the animal model described in (1) and compare it with the control group; Among them, if the behaviors characterizing the spontaneous occurrence of abnormal mood swings-related diseases in the animal model administered with the candidate substance are improved compared with the control group, it indicates that the candidate substance can be used as a potential therapeutic agent for the spontaneous occurrence of abnormal mood swings-related diseases.

21. The method according to claim 20, characterized in that The behavioral analysis is selected from the group consisting of locomotor activity, open field test, elevated plus maze test, forced swimming, or a combination thereof.

22. The method according to claim 20, characterized in that In step (2), when the behavioral analysis shows that the symptoms of spontaneous mood swings are significantly improved, it is suggested that the candidate substance can be used as a potential therapeutic agent for diseases related to spontaneous mood swings.

Images