Application of HLA-DPB1*05:01 in Screening for Acquired Immunodeficiency Caused by Autoantibodies against Interferon-γ

Abstract

The present invention relates to the field of biological detection technologies, and provides the application of the HLA-DPB1*05:01 allele in the risk screening of acquired immunodeficiency caused by human anti-interferon-γ autoantibodies. Specifically, it relates to the use of a substance for detecting the HLA-DPB1*05:01 allele in the preparation of a kit for screening the risk of acquired immunodeficiency caused by anti-interferon-γ autoantibodies, and also relates to the application of a substance for detecting the HLA-DPB1*05:01 allele in the preparation of a kit for screening drugs for inhibiting acquired immunodeficiency caused by anti-interferon-γ autoantibodies. The HLA-DPB1*05:01 allele provided by the present invention can also be used as a marker or target to develop, identify or screen drugs for treating acquired immunodeficiency diseases caused by anti-interferon-γ autoantibodies. The present invention provides a new idea for the risk screening of acquired immunodeficiency diseases caused by anti-interferon-γ autoantibodies.

Description

Technical Field

[0001] The present invention relates to the field of biological detection technologies, and particularly to the application of HLA-DPB1*05:01 in the detection of acquired immunodeficiency caused by autoantibodies against interferon-γ. Background Art

[0002] The human major histocompatibility complex is located on the short arm of chromosome 6 and is also known as human leukocyte antigen (HLA). It has the most complex polymorphic alleles in humans. Because the leukocyte antigens encoded by it participate in antigen presentation and regulatory functions, it is at the core of the immune system and is closely related to the occurrence and prognosis of various immune and infectious diseases. Since its first discovery, HLA genes have been reported to be related to more than 100 diseases, including infectious diseases. Existing studies have shown that infectious diseases including HIV infection (BAILEY J R, WILLIAMS T M, SILICIANO R F, et al. Maintenance of viral suppression in HIV-1-infected HLA-B*57+ elite suppressors despite CTL escape mutations [J]. J Exp Med, 2006, 203(5): 1357-69.), chronic hepatitis B (CHU R H, MA L X, WANG G, et al. Influence of HLA-DRB1 alleles and HBV genotypes on interferon-alpha therapy for chronic hepatitis B [J]. World J Gastroenterol, 2005, 11(30): 4753-7.), onychomycosis (GARCIA-ROMERO M T, GRANADOS J, VEGA-MEMIJE M E, et al. Analysis of genetic polymorphism of the HLA-B and HLA-DR loci in patients with dermatophytic onychomycosis and in their first-degree relatives [J]. Actas Dermosifiliogr, 2012, 103(1): 59-62.), etc. are related to HLA alleles.

[0003] The Th1 cell-mediated cellular immune response is one of the important ways for the host to resist pathogen invasion. Interferon-γ (IFN-γ) plays an important role in this process. IFN-γ activates macrophages by collaborating with other cytokines, initiating innate and adaptive immune responses. High-titer anti-IFN-γ autoantibodies with neutralizing ability can cause defects in the immune response pathways involving IFN-γ by blocking the upregulation of TNF-α and the induction of IFN-γ-induced genes, inhibiting the upregulation of HLA class II expression on antigen-presenting cells, etc., leading the host to suffer from severe opportunistic pathogen infections.

[0004] The immune deficiency syndrome associated with anti-IFN-γ autoantibodies can cause multiple opportunistic infections in previously immunocompetent individuals, presenting clinical manifestations similar to those of patients with advanced HIV infection. Reports of this immune deficiency syndrome mainly come from East Asia and Southeast Asia, including countries such as China, Thailand, the Philippines, and Vietnam. These patients are most commonly infected with disseminated nontuberculous mycobacteria (NTM). In addition, Talaromyces marneffei (TM) is also commonly seen in the opportunistic infections of anti-IFN-γ antibody patients. However, there is currently no unified diagnostic standard for adult-onset immune deficiency syndrome associated with anti-IFN-γ autoantibodies, and clinicians have insufficient awareness of the infections caused by opportunistic pathogens such as TM and NTM. Therefore, if gene markers of anti-interferon-γ autoantibodies and their susceptibility to Talaromyces marneffei or (and) nontuberculous mycobacteria infections can be found, it will play a guiding role in clinical diagnosis and medication.

[0005] Similar to other common infections, most of the Talaromyces marneffei infections and nontuberculous mycobacteria infections caused by the immune deficiency syndrome associated with anti-IFN-γ autoantibodies manifest as fever, cough, weight loss, and lymph node enlargement. Moreover, due to frequent misdiagnosis and missed diagnosis, once patients miss the treatment opportunity for early infections, some of these opportunistic infections can develop into severe infections, sepsis, and even cause multiple organ failure and death.

[0006] So far, there has been no reliable detection method to predict the risk of anti-IFN-γ autoantibodies or their related immune deficiencies. At the same time, some scholars have reported that patients with NTM and TM with IFN-γ autoantibody-related immune deficiencies frequently carry the classical class II HLA gene DRB1*16:02-DQB1*05:02 haplotype (CHI C Y, CHU C C, LIU J P, et al. Anti-IFN-gamma autoantibodies in adults with disseminated nontuberculous mycobacterial infections are associated with HLA-DRB1*16:02 and HLA-DQB1*05:02 and the reactivation of latent varicella-zoster virus infection[J]. Blood, 2013, 121(8):1357-66.)(GUO J, NING XQ, DING J Y, et al. Anti-IFN-gamma autoantibodies underlie disseminated Talaromyces marneffei infections[J]. J Exp Med, 2020, 217(12).), which provides certain genetic basis for exploring the pathogenesis and diagnosis of the disease.

[0007] DPB1*05:01 is a relatively common allele genotype at the DPB1 locus of the classical class II HLA gene in East Asians. Through the retrieval of existing technical literature, it is found that there has been no report on the association between the HLA-DPB1*05:01 allele and the pathogenesis of acquired immune deficiency caused by anti-gamma interferon autoantibodies, and it can be used as a genetic marker for screening this disease. Summary of the Invention

[0008] The present invention aims at the above problems and provides a detection marker for acquired immune deficiency caused by anti-gamma interferon autoantibodies, and also provides a new use of the HLA-DPB1*05:01 allele.

[0009] The research process of the present invention is as follows: The present invention conducted a control study on 98 patients infected with *Talaromyces marneffei* and / or non-tuberculous mycobacteria with positive anti-interferon-γ autoantibodies and 114 healthy control subjects. The results showed that most of the infected patients were positive for the HLA-DPB1*05:01 allele. The probability of developing *Talaromyces marneffei* and / or non-tuberculous mycobacteria infection with positive anti-interferon-γ autoantibodies in people carrying the HLA-DPB1*05:01 allele was significantly higher than that in people not carrying the HLA-DPB1*05:01 allele. The HLA-DPB1 typing of the patients in the group of *Talaromyces marneffei* and / or non-tuberculous mycobacteria infection caused by anti-interferon-γ autoantibodies was mainly HLA-DPB1*05:01. Therefore, it is preliminarily determined that the HLA-DPB1*05:01 allele can be used as a screening marker for judging anti-interferon-γ autoantibodies or the acquired immunodeficiency caused by them, especially as a diagnostic marker for *Talaromyces marneffei* and / or non-tuberculous mycobacteria infection with positive anti-interferon-γ autoantibodies.

[0010] Based on the above research, the specific technical solution of the present invention is as follows:

[0011] In the first aspect of the present invention, there is provided the use of a substance for detecting the HLA-DPB1*05:01 allele in the preparation of a risk screening kit for acquired immunodeficiency caused by anti-interferon-γ autoantibodies. Preferably, the susceptible opportunistic infections in patients with acquired immunodeficiency caused by anti-interferon-γ autoantibodies are *Talaromyces marneffei* infection and non-tuberculous mycobacteria infection.

[0012] Specifically, the kit can be used for: detecting or evaluating the risk of a person developing acquired immunodeficiency caused by anti-interferon-γ autoantibodies; and, on the basis of this immunodeficiency, the risk of suffering from *Talaromyces marneffei* disease and / or non-tuberculous mycobacteria disease.

[0013] The evaluation method is as follows: The risk of a person carrying the HLA-DPB1*05:01 allele developing acquired immunodeficiency caused by anti-interferon-γ autoantibodies is higher than that of a person not carrying the HLA-DPB1*05:01 allele.

[0014] The present invention conducted a control study on 98 patients infected with *Talaromyces marneffei* and / or non-tuberculous mycobacteria who were positive for anti-interferon-γ autoantibodies and 114 healthy control subjects. The results showed that the allele frequencies of DPB1*05:01, DPB1*02:02, and DPB1*13:01 were relatively high in patients with single or dual infections of *Talaromyces marneffei* and non-tuberculous mycobacteria. Among them, the majority of infected patients were positive for the DPB1*05:01 allele. The probability of individuals carrying the HLA-DPB1*05:01 allele developing single or dual infections of *Talaromyces marneffei* and non-tuberculous mycobacteria with positive anti-interferon-γ autoantibodies was significantly higher than that of those without the HLA-DPB1*05:01 allele.

[0015] Preferably, the substance for detecting the HLA-DPB1*05:01 allele is a substance for detecting the expression level of the HLA-DPB1*05:01 gene in a biological sample. It is used to determine whether the test sample carries the HLA-DPB1*05:01 allele by detecting its expression level.

[0016] The substance for detecting the HLA-DPB1*05:01 allele can be any reagent, kit, and / or instrument used in the methods known in the art for detecting the presence of the HLA-DPB1*05:01 allele, such as PCR detection kits, probe detection kits, sequencers from ABI (3100, 3130, 3130XL, 3700, 3730, 3730XL), etc. In a specific embodiment of the present invention, the kit is the SeCore kit - Thermo Fisher Scientific, MA, USA (ThermoFisher Scientific Inc.).

[0017] The nucleotide sequence of the HLA-DPB1*05:01 allele is shown as SEQ ID NO.1 as follows:

[0018] ATGATGGTTCTGCAGGTTTCTGCGGCCCCCCGGACAGTGGCTCTGACGGCGTTACTGATGGTGCTGCTCACATCTGTGGTCCAGGGCAGGGCCACTCCAGAGAATTACCTTTTCCAGGGACGGCAGGAATGCTACGCGTTTAATGGGACACAGCGCTTCCTGGAGAGATACATCTACAACCGGGAGGAGCTCGTGCGCTTCGACAGCGACGTGGGGGAGTTCCGGGCGGTGACGGAGCTGGGGCGGCCTGAGGCGGAGTACTGGAACAGCCAGAAGGACATCCTGGAGGAGAAGCGGGCAGTGCCGGACAGGATGTGCAGACACAACTACGAGCTGGACGAGGCCGTGACCCTGCAGCGCCGAGTCCAGCCTAAGGTGAACGTTTCCCCCTCCAAGAAGGGGCCCCTGCAGCACCACAACCTGCTTGTCTGCCACGTGACAGATTTCTACCCAGGCAGCATTCAAGTCCGATGGTTCCTGAATGGACAGGAGGAAACAGCTGGGGTCGTGTCCACCAACCTGATCCGTAATGGAGACTGGACCTTCCAGATCCTGGTGATGCTGGAAATGACCCCCCAGCAGGGAGACGTCTACATCTGCCAAGTGGAGCACACCAGCCTGGACAGTCCTGTCACCGTGGAGTGGAAGGCACAGTCTGATTCTGCCCGGAGTAAGACATTGACGGGAGCTGGGGGCTTCATGCTGGGGCTCATCATCTGTGGAGTGGGCATCTTCATGCACAGGAGGAGCAAGAAAGTTCAACGAGGATCTGCATAA。

[0019] The PCR detection kit includes primer pairs 1 and 2 respectively for amplifying the second and third exons of the HLA-DPB1 locus in a biological sample. The sequences of primer pair 1 are shown in SEQ ID NO.2 and 3 respectively, and the sequences of primer pair 2 are shown in SEQ ID NO.4 and 5 respectively, specifically as follows:

[0020]

[0021] The test sample used during detection can be used to detect whether the tested person carries the HLA-DPB1*05:01 allele by using the peripheral blood of the tested person or white blood cells or DNA prepared from the peripheral blood. When detecting whether the HLA-DPB1*05:01 allele is carried, both homozygous individuals with HLA-DPB1*05:01 alleles on both chromosomes and heterozygous individuals with HLA-DPB1*05:01 alleles on only one chromosome are considered to carry the HLA-DPB1*05:01 allele.

[0022] In a second aspect of the present invention, there is provided a kit for detecting acquired immunodeficiency caused by anti-interferon-γ autoantibodies, which kit contains reagents for detecting the HLA-DPB1*05:01 allele in a biological sample.

[0023] By means of this kit, it is possible to detect or evaluate the risk of acquired immunodeficiency caused by anti-interferon-γ autoantibodies in humans.

[0024] In a third aspect of the present invention, there is provided the use of a substance for detecting the HLA-DPB1*05:01 allele in the preparation of a kit for screening drugs for inhibiting acquired immunodeficiency caused by anti-interferon-γ autoantibodies.

[0025] In a fourth aspect of the present invention, there is provided a kit for screening drugs for inhibiting acquired immunodeficiency caused by anti-interferon-γ autoantibodies, characterized in that the kit contains reagents for detecting the HLA-DPB1*05:01 allele in a biological sample.

[0026] The method for drug screening using HLA-DPB1*05:01 as a marker is as follows:

[0027] (A) Treating a disease model with acquired immunodeficiency caused by anti-interferon-γ autoantibodies or treating cells, tissues or animals in an environment simulating a disease response with a candidate substance;

[0028] (B) Detecting whether the cells, tissues or animals carry the HLA-DPB1*05:01 allele;

[0029] (C) If the expression level of HLA-DPB1*05:01 is lower than the level before treatment with the candidate substance, it indicates that the candidate substance has the effect of treating the acquired immunodeficiency disease by inhibiting HLA-DPB1*05:01.

[0030] In a fifth aspect, the present invention provides a method for detecting or evaluating the risk of a person developing an acquired immunodeficiency disease caused by producing anti-γ interferon autoantibodies, comprising the following steps: detecting whether the person carries the HLA-DPB1*05:01 allele, wherein the risk of a person carrying the HLA-DPB1*05:01 allele developing an acquired immunodeficiency disease caused by producing anti-γ interferon autoantibodies is higher than that of a person not carrying the HLA-DPB1*05:01 allele.

[0031] In the present invention, a comparative study was conducted on 98 patients infected with Talaromyces marneffei or (and) non-tuberculous mycobacteria with positive anti-γ interferon autoantibodies and 114 healthy controls. The results showed that the probability of people carrying the HLA-DPB1*05:01 allele to be infected with Talaromyces marneffei or (and) non-tuberculous mycobacteria was significantly higher than that of people not carrying the HLA-DPB1*05:01 allele. Among them, the p value of patients infected with Talaromyces marneffei with positive anti-γ interferon autoantibodies VS healthy controls was 3.71×10 -4 , OR value was 4.95, 95% confidence interval was 1.94-12.63; patients with non-tuberculous mycobacterium infection who were positive for anti-γ interferon autoantibodies VS healthy controls: p value was 0.029, OR value was 3.91, 95% confidence interval was 1.07-14.24; patients with mixed infection of Talaromyces marneffei and non-tuberculous mycobacteria who were positive for anti-γ interferon autoantibodies VS healthy controls: p value was 3.59×10 -4 , the OR value was 6.25, and the 95% confidence interval was 2.07-18.84.

[0032] This method can also be used to screen for other pathogenic bacteria that are positive for anti-γ interferon autoantibodies. In practical applications, the HLA-DPB1*05:01 allele can be detected in patients with suspected acquired immunodeficiency disease caused by anti-γ interferon autoantibodies and infectious clinical manifestations to assist in the diagnosis of acquired immunodeficiency caused by anti-γ interferon autoantibodies. For such individuals, it is recommended to conduct anti-γ interferon autoantibody testing and other targeted auxiliary examinations and early treatment as soon as possible.

[0033] Beneficial protection and effects of the present invention:

[0034] The present invention provides the application of HLA-DPB1*05:01 allele in the detection of acquired immunodeficiency caused by autoantibodies against interferon-γ. By detecting whether a subject carries the HLA-DPB1*05:01 allele, the risk of developing acquired immunodeficiency disease caused by autoantibodies against interferon-γ can be predicted / assist in diagnosis, which is used to guide early targeted auxiliary examinations and early empirical treatments, thereby reducing the critical illness and even mortality of patients. The HLA-DPB1*05:01 allele provided by the present invention can also be used as a marker or target to develop, identify or screen drugs for treating acquired immunodeficiency disease caused by autoantibodies against interferon-γ. The present invention provides a new idea for the risk screening of acquired immunodeficiency disease caused by autoantibodies against interferon-γ. Detailed implementation manners

[0035] The following examples and experimental examples further illustrate the present invention and should not be construed as limiting the present invention. The examples do not include detailed descriptions of traditional methods, such as PCR methods, those for constructing vectors and plasmids, methods for inserting genes encoding proteins into such vectors and plasmids, or methods for introducing plasmids into host cells. Such methods are well known to those of ordinary skill in the art and are described in many publications, including Sambrook, J., Fritsch, E.F. and Maniais, T. (1989) Molecular Cloning: A Laboratory Manual, 2 nd edition, Cold spring Harbor Laboratory Press.

[0036] Unless otherwise stated, percentages and parts are calculated by volume. Unless otherwise defined, all professional and scientific terms used herein have the same meaning as those familiar to those skilled in the art. In addition, any methods and materials similar or equivalent to those described may be applied to the present invention, and the preferred implementation methods and materials described in the detailed implementation manners are for illustrative purposes only.

[0037] Example 1: HLA-DPB1*05:01 allele is a genetic marker for the risk of acquired immunodeficiency caused by autoantibodies against interferon-γ

[0038] I. Samples

[0039] 1. Case samples

[0040] The case samples in this example were 98 patients with positive anti-interferon-γ autoantibodies and infected with Talaromyces marneffei or (and) nontuberculous mycobacteria from China, including 44 patients infected with Talaromyces marneffei, 18 patients infected with nontuberculous mycobacteria, and 36 patients with mixed infections of Talaromyces marneffei and nontuberculous mycobacteria. According to the recognized indirect ELISA detection method, the critical value of the absorbance was defined as 0.5, and the anti-IFN-γ antibodies of all 98 patients were determined to be positive. Among the 98 patients, 51 were male and 47 were female, with an average age of 55.4 years. The clinical manifestations of the 98 patients included infectious symptoms such as fever, pulmonary symptoms, lymphadenopathy, and rash.

[0041] 2. Healthy control samples (healthy population control group)

[0042] The healthy control group in this example consisted of 114 healthy Chinese people, and special past medical histories were excluded according to the questionnaire records.

[0043] II. Analysis of the relationship between HLA-DPB1*05:01 allele and acquired immunodeficiency caused by anti-interferon-γ autoantibodies

[0044] 1. Detection of HLA-DPB1*05:01 allele

[0045] 1.5 mL of peripheral venous blood was taken from each sample in Step 1, and genomic DNA was extracted. The HLA-DPB1 allele typing was performed by entrusting the HLA Service Laboratory of Thermo Fisher Scientific in Beijing to use the kit (SeCore kit - Thermo Fisher Scientific, MA, USA) and operating according to the instructions. The result analysis was carried out by uTYPE HLA sequence analysis software, and the software finally confirmed the gene typing by comparing with the data in the IMGT / HLA database.

[0046] The results showed that the HLA-DPB1 typing of the patients in the group infected with Talaromyces marneffei or (and) nontuberculous mycobacteria with positive anti-interferon-γ autoantibodies was mainly HLA-DPB1*05:01 (Table 1). Therefore, it was initially judged that the HLA-DPB1*05:01 allele could be used as a marker for judging acquired immunodeficiency caused by anti-interferon-γ autoantibodies.

[0047] Table 1 Clinical characteristics and HLA-DPB1 typing of patients in the group infected with Talaromyces marneffei or (and) nontuberculous mycobacteria with positive anti-interferon-γ autoantibodies

[0048]

[0049]

[0050]

[0051]

[0052] 2. Analysis of the relationship between HLA-DPB1*05:01 allele and positive anti-interferon-γ autoantibody with Penicillium marneffei and / or non-tuberculous mycobacterium infection

[0053] Count the number of people carrying HLA-DPB1*05:01 allele and not carrying HLA-DPB1*05:01 allele in the group of patients with positive anti-interferon-γ autoantibody with Penicillium marneffei and / or non-tuberculous mycobacterium infection and the healthy population control group. Analyze the distribution differences of HLA-DPB1*05:01 allele between the group of patients with positive anti-interferon-γ autoantibody with Penicillium marneffei and / or non-tuberculous mycobacterium infection and the healthy population control group, and the sensitivity, specificity and OR value of using the detection of HLA-DPB1*05:01 allele to predict the risk of Penicillium marneffei and / or non-tuberculous mycobacterium infection in patients with positive anti-interferon-γ autoantibody.

[0054] Among them, the formula for calculating sensitivity is as follows: (the number of patients with positive anti-interferon-γ autoantibody with Penicillium marneffei and / or non-tuberculous mycobacterium infection carrying HLA-DPB1*05:01 allele / the total number of patients with positive anti-interferon-γ autoantibody with Penicillium marneffei and / or non-tuberculous mycobacterium infection) × 100%;

[0055] The formula for calculating specificity is as follows: (the number of healthy population controls not carrying HLA-DPB1*05:01 allele / the total number of healthy population controls) × 100%;

[0056] The formula for calculating OR value is as follows: (the number of patients with positive anti-interferon-γ autoantibody with Penicillium marneffei and / or non-tuberculous mycobacterium infection carrying HLA-DPB1*05:01 allele / the number of patients with positive anti-interferon-γ autoantibody with Penicillium marneffei and / or non-tuberculous mycobacterium infection not carrying HLA-DPB1*05:01 allele) / (the number of healthy population controls carrying HLA-DPB1*05:01 allele / the number of healthy population controls not carrying HLA-DPB1*05:01 allele).

[0057] Use SPSS 26.0 to calculate Odds Ratio (OR) and its 95% confidence interval, and select the chi-square test for statistical analysis. The statistical significance level is set as P < 0.05.

[0058] (1) The statistical results of HLA-DPB1 typing of patients with Penicillium marneffei infection with positive anti-interferon-γ autoantibody are shown in Table 2:

[0059] Table 2 Statistical results of HLA-DPB1 typing in patients with Penicillium marneffei infection positive for anti-interferon-γ autoantibody

[0060]

[0061] The results of HLA-DPB1 typing showed that among the patients with Penicillium marneffei infection positive for anti-interferon-γ autoantibody, 38 carried the HLA-DPB1*05:01 allele and 6 did not carry the HLA-DPB1*05:01 allele; among the healthy control group, 64 carried the HLA-DPB1*05:01 allele and 50 did not carry the HLA-DPB1*05:01 allele. That is, 86.4% of the patients with Penicillium marneffei infection positive for anti-interferon-γ autoantibody carried the HLA-DPB1*05:01 allele, while only 56.1% of the healthy control group carried the HLA-DPB1*05:01 allele. The risk of Penicillium marneffei infection positive for anti-interferon-γ autoantibody in HLA-DPB1*05:01 allele carriers was 4.95 times that of non-carriers of the HLA-DPB1*05:01 allele (95% confidence interval was 1.94 - 12.63).

[0062] (2) Statistical results of HLA-DPB1 typing in patients with non-tuberculous mycobacterial infection positive for anti-interferon-γ autoantibody are shown in Table 3:

[0063] Table 3 Statistical results of HLA-DPB1 typing in patients with non-tuberculous mycobacterial infection positive for anti-interferon-γ autoantibody

[0064]

[0065] Similarly, among the patients with non-tuberculous mycobacterial infection positive for anti-interferon-γ autoantibody, 15 carried the HLA-DPB1*05:01 allele and 3 did not carry the HLA-DPB1*05:01 allele, that is, 83.3% of the patients with non-tuberculous mycobacterial infection positive for anti-interferon-γ autoantibody carried the HLA-DPB1*05:01 allele. The risk of non-tuberculous mycobacterial infection positive for anti-interferon-γ autoantibody in HLA-DPB1*05:01 allele carriers was 3.91 times that of non-carriers of the HLA-DPB1*05:01 allele (95% confidence interval was 1.07 - 14.24).

[0066] (3) Statistical results of HLA-DPB1 typing in patients with dual infection of Penicillium marneffei and non-tuberculous mycobacteria positive for anti-interferon-γ autoantibody are shown in Table 4:

[0067] Table 4 Statistical results of HLA-DPB1 typing in patients with mixed infections of *Talaromyces marneffei* and nontuberculous mycobacteria positive for anti-interferon-γ autoantibodies

[0068]

[0069]

[0070] In the group of patients with mixed infections of *Talaromyces marneffei* and nontuberculous mycobacteria positive for anti-interferon-γ autoantibodies, 32 people carried the HLA-DPB1*05:01 allele, and 4 people did not carry the HLA-DPB1*05:01 allele. That is, 88.9% of the people in the group of patients with mixed infections of *Talaromyces marneffei* and nontuberculous mycobacteria positive for anti-interferon-γ autoantibodies carried the HLA-DPB1*05:01 allele. The risk of dual infections of *Talaromyces marneffei* and nontuberculous mycobacteria positive for anti-interferon-γ autoantibodies in HLA-DPB1*05:01 allele carriers was 6.25 times that of non-carriers of the HLA-DPB1*05:01 allele (95% confidence interval was 2.07 - 18.84).

[0071] The above results indicate that the HLA-DPB1*05:01 allele is strongly associated with the occurrence of *Talaromyces marneffei* or (and) nontuberculous mycobacteria infections positive for anti-interferon-γ autoantibodies, and can be used as a risk genetic marker for the occurrence of *Talaromyces marneffei* or (and) nontuberculous mycobacteria infections positive for anti-interferon-γ autoantibodies. Using the HLA-DPB1*05:01 allele to predict the risks of *Talaromyces marneffei*, nontuberculous mycobacteria, and dual infections of *Talaromyces marneffei* and nontuberculous mycobacteria positive for anti-interferon-γ autoantibodies, the sensitivities were 86.4%, 83.3%, and 88.9% respectively, and the specificity was 43.9%.

[0072] In practical applications, it is possible to predict / assist in diagnosing whether a subject with suspected *Talaromyces marneffei* or (and) nontuberculous mycobacteria infections with infectious clinical manifestations carries the HLA-DPB1*05:01 allele, so as to guide the early implementation of targeted auxiliary examinations and early empirical treatments, thereby reducing the critical illness and even mortality rates of patients with *Talaromyces marneffei* or (and) nontuberculous mycobacteria infections positive for anti-interferon-γ autoantibodies. The HLA-DPB1*05:01 allele is relatively prevalent in the Chinese population. Therefore, it is of great benefit to screen for the HLA-DPB1*05:01 allele and conduct risk assessments in patients with suspected *Talaromyces marneffei* or (and) nontuberculous mycobacteria infections.

[0073] Example 2. Kit Detection

[0074] Take 200 μl of white blood cells from 27 patients diagnosed with positive anti-interferon-γ autoantibodies and infected with Talaromyces marneffei or (and) nontuberculous mycobacteria. Use a kit (QIAamp DNA Blood Mini Kit (50)) to extract DNA according to the instructions, and detect the DNA concentration and purity with an ultraviolet spectrophotometer. Use the primers shown in Table 5 below to amplify the polymorphic regions of HLA-DPB1 respectively, and then analyze the DNA sequence to directly obtain the genotype.

[0075] In the example, commercially available conventional PCR reagents were used to amplify exons 2 and 3 of HLA-DPB1; the amplification products were entrusted to Sangon Biotech (Shanghai) Co., Ltd. for first-generation sequencing; the sequencing data was entrusted to the HLA Typing Laboratory of Thermo Fisher Scientific in Beijing for HLA typing.

[0076] Table 5 Summary of Primers for Exons 2 and 3 of HLA-DPB1

[0077]

[0078] Use SPSS 26.0 to calculate the Odds Ratio (OR) and its 95% confidence interval, and select Fisher's exact test for statistical analysis. The statistical significance level is set to P < 0.05.

[0079] The results showed that 10 patients with Talaromyces marneffei infection with positive anti-interferon-γ autoantibodies, 7 patients with nontuberculous mycobacteria infection with positive anti-interferon-γ autoantibodies, 9 patients with mixed infection of Talaromyces marneffei and nontuberculous mycobacteria with positive anti-interferon-γ autoantibodies, and 8 healthy controls were collected. The positive proportion of HLA-DPB1*05:01 in patients with Talaromyces marneffei infection (Tables 6, 9), nontuberculous mycobacteria infection (Tables 7, 10), and mixed infection of Talaromyces marneffei and nontuberculous mycobacteria (Tables 8, 11) with positive anti-interferon-γ antibodies was higher than that in the normal control group. The differences were all statistically significant.

[0080] Table 6 Clinical Characteristics and HLA-DPB1 Typing of Patients in the Talaromyces marneffei Infection Group with Positive Anti-interferon-γ Autoantibodies

[0081] Patient Gender Age (years) Infection type HLA-DPB1* 1 M 65 TM DPB1*05:01 / DPB1*05:01 2 F 53 TM DPB1*05:01 / DPB1*05:01 3 M 50 TM DPB1*02:02 / DPB1*05:01 4 M 59 TM DPB1*02:02 / DPB1*05:01 5 M 55 TM DPB1*13:01 / DPB1*05:01 6 M 46 TM DPB1*05:01 / DPB1*05:01 7 M 42 TM DPB1*05:01 / DPB1*05:01 8 M 35 TM DPB1*13:01 / DPB1*13:01 9 F 38 TM DPB1*05:01 / DPB1*05:01 10 F 47 TM DPB1*05:01 / DPB1*05:01

[0082] Table 7 Clinical Characteristics and HLA-DPB1 Typing of Patients in the Nontuberculous Mycobacteria Infection Group with Positive Anti-interferon-γ Autoantibodies

[0083] Patient Gender Age (years) Infection type HLA-DPB1* 1 F 51 NTM DPB1*05:01 / DPB1*05:01 2 F 45 NTM DPB1*05:01 / DPB1*05:01 3 F 47 NTM DPB1*13:01 / DPB1*05:01 4 F 52 NTM DPB1*05:01 / DPB1*05:01 5 M 45 NTM DPB1*13:01 / DPB1*05:01 6 M 57 NTM DPB1*02:02 / DPB1*05:01 7 F 58 NTM DPB1*02:02 / DPB1*02:02 8 M 55 NTM DPB1*05:01 / DPB1*135:01

[0084] Table 8. Clinical characteristics and HLA-DPB1 typing of patients with mixed infections of *Talaromyces marneffei* and nontuberculous mycobacteria positive for anti-interferon-γ autoantibodies

[0085] Patient Gender Age (years) Infection type HLA-DPB1* 1 F 52 TM + NTM DPB1*05:01 / DPB1*05:01 2 F 67 TM + NTM DPB1*02:02 / DPB1*21:01 3 F 44 TM + NTM DPB1*21:01 / DPB1*05:01 4 M 44 TM + NTM DPB1*05:01 / DPB1*05:01 5 M 53 TM + NTM DPB1*05:01 / DPB1*05:01 6 F 46 TM + NTM DPB1*05:01 / DPB1*05:01 7 F 46 TM + NTM DPB1*02:01 / DPB1*05:01 8 M 55 TM + NTM DPB1*05:01 / DPB1*05:01 9 F 43 TM + NTM DPB1*13:01 / DPB1*05:01

[0086] According to Tables 6-8, similar to the above-mentioned large-sample typing results, HLA-DPB1 gene typing can also be achieved by kit detection. When the gene typing result shows HLA-DPB1*05:01, it can be judged that the subject has a relatively high risk of infection with *Talaromyces marneffei* or (and) nontuberculous mycobacteria positive for anti-interferon-γ autoantibodies.

[0087] Table 9. Positive proportion of HLA-DPB1*05:01 in the *Talaromyces marneffei* infection group positive for anti-interferon-γ autoantibodies and healthy control group

[0088]

[0089] Table 10. Positive proportion of HLA-DPB1*05:01 in the nontuberculous mycobacteria infection group positive for anti-interferon-γ autoantibodies and healthy control group

[0090]

[0091] Table 11. Positive proportion of HLA-DPB1*05:01 in the mixed infection group of *Talaromyces marneffei* and nontuberculous mycobacteria positive for anti-interferon-γ autoantibodies and healthy control group

[0092]

[0093] The preferred embodiments of the present invention have been specifically described above, but the present invention is not limited to the described embodiments. Those skilled in the art can also make various equivalent variations or substitutions without departing from the spirit of the present invention, and these equivalent variations or substitutions are all included within the scope defined by the claims of this application.

Claims

1. Use of a substance for detecting HLA-DPB1*05:01 allele in the preparation of a risk screening kit for acquired immunodeficiency caused by anti-γ interferon autoantibodies, characterized in that: The acquired immunodeficiency is one or both of Talaromycosis marneffei and nontuberculous mycobacterial disease.

2. The use according to claim 1, characterized in that: The substance for detecting the HLA-DPB1*05:01 allele is a substance for detecting the HLA-DPB1*05:01 gene in a biological sample.

3. The use according to claim 2, characterized in that: The material for detecting the HLA-DPB1*05:01 gene in a biological sample includes a PCR system, a probe or a high-throughput sequencing system for detecting the HLA-DPB1*05:01 gene.

4. The use according to claim 3, characterized in that: The nucleotide sequence of the HLA-DPB1*05:01 allele is shown as SEQ ID NO.

1. The PCR system includes primer pair 1 and primer pair 2 for amplifying exons 2 and 3 of the HLA-DPB1 locus in the biological sample, respectively. The sequence of primer pair 1 is shown as SEQ ID NO.2 and 3, respectively, and the sequence of primer pair 2 is shown as SEQ ID NO.4 and 5, respectively.

Images