Application of pleiotropic molecular markers for simultaneous prediction of abdominal fat traits, leg muscle traits and reproductive traits in chickens

Abstract

The application of multi-effect molecular markers that simultaneously predict chicken abdominal fat traits, leg muscle traits and reproductive traits belongs to the field of animal molecular genetics technology. In order to study the influence of LDAH gene on chicken abdominal fat, leg muscle and testicle, the present invention designs primers according to the c.43346_43347insTGTGTCTT mutation site of chicken LDAH gene, performs PCR amplification of chicken genomic DNA on F2 population, electrophoresis, and detects 2 genotypes in F2 population (AA rooster and white-ear hen hybrid construction), and proves that its influence on abdominal fat rate and leg muscle rate reaches extremely significant level; The influence on testicle rate reaches significant level, proving that chicken LDAH gene mutation site c.43346_43347insTGTGTCTT is a molecular marker that affects the growth and development of chicken abdominal fat, leg muscle and testicle. The molecular marker can be used to select chicken abdominal fat content, leg muscle weight and testicle weight at the same time.

Description

Technical Field

[0001] The invention belongs to the technical field of animal molecular genetics, and relates to the application of pleiotropic molecular markers for simultaneously predicting chicken abdominal fat traits, leg muscle traits and reproductive traits, and specifically to a pleiotropic molecular marker method for simultaneously predicting chicken abdominal fat traits, leg muscle traits and reproductive traits using the LDAH gene. Background Art

[0002] Through long-term selection, the growth rate, feed efficiency and meat production of broilers have been significantly improved, but many problems have also emerged, such as excessive fat deposition in chickens, increased bone diseases and metabolic diseases, reduced reproductive performance and increased mortality. Excessive abdominal fat deposition in broilers will reduce reproductive performance, feed conversion rate and carcass yield; increase feeding costs and reduce economic income; fat discarded during processing will pollute the environment; and the taste of chicken with high abdominal fat content is not accepted by consumers. Therefore, breeding low-fat broilers is an effective way to solve these problems.

[0003] Chicken abdominal fat traits and leg muscle traits are slaughter traits, and testicular traits are reproductive traits. The size and weight of the testicles of roosters are closely related to the quantity and quality of sperm and semen, and have an important impact on the fertilization rate of the flock. The use of conventional breeding methods to breed low-fat broilers has been slow, and marker-assisted selection (MAS) is an effective method for selecting such traits. By identifying molecular markers that significantly affect the target traits and selecting individuals carrying favorable marker genotypes for breeding, the target traits of the offspring can be improved.

[0004] Lipid droplet associated hydrolase (LDAH, also known as C2ORF43) is a newly discovered lipid droplet protein that belongs to the α / β hydrolase superfamily. Its sequence contains a highly conserved GxSxG lipase catalytic motif and a hydrophobic motif that anchors the protein to cytoplasmic lipid droplets. It is abundantly expressed in tissues that mainly store triglycerides (including liver, white fat and brown fat) and macrophages. The chicken LDAH gene is located on chromosome 3, is about 4.2 kb in length, and contains 5 introns and 6 exons.

[0005] Studies on humans and mice have shown that the LDAH gene is closely related to the body's lipid metabolism. Kory et al. (Kory N, Grond S, Kamat SS, et al. Mice lacking lipid droplet-associated hydrolase, a gene linked to human prostate cancer, have normal cholesterol ester meTableolism [J]. J Lipid Res, 2017, 58 (1): 226-235.) found that LDAH has a higher expression level in 3T3-L1 differentiated adipocytes compared with preadipocytes. Compared with the white adipose tissue of normal mice, the expression of LDAH in the tissues of mice fed a high-fat diet was significantly increased. Goo et al. (Goo YH, Son SH, Kreienberg PB, et al. Novel lipid droplet-associated serine hydrolase regulates macrophage cholesterol mobilization [J]. Arterioscler Thromb Vasc Biol, 2014, 34 (2): 386-396.) found that under the conditions of triglyceride deposition in lipid droplets, LDAH promoted the fusion and expansion of aggregated lipid droplets, and enhanced the polyubiquitination and proteasome degradation of triglyceride hydrolysis rate-limiting enzyme lipase adipose triglyceride lipase. LDAH can reduce the turnover of triglycerides and the fatty acids released by cells. LDAH promotes the degradation of adipose triglyceride lipase by proteasomes, and the lack of LDAH will lead to an increase in the level of adipose triglyceride lipase, thereby increasing lipolysis. Currall et al. (Currall BB, Chen M, Sallari RC, et al. Loss of LDAH associated with prostate cancer and hearing loss [J]. Hum Mol Genet, 2019, 28 (10): 1753-1754.) found that knocking out the LDAH gene in mice would lead to lipid metabolism disorders.

[0006] In summary, the LDAH gene is closely related to fat metabolism in the body and has the effect of promoting fat production. So far, there has been no report on the selection of chicken abdominal fat content, leg muscle content and reproductive traits using LDAH gene molecular markers. Summary of the invention

[0007] In order to breed low-fat broilers more quickly, the possibility of LDAH gene as a molecular marker for chicken abdominal fat content, leg muscle content and reproductive traits was studied. Primers were designed based on the upstream 302bp and downstream 201bp sequences of the third intron insertion mutation site c.43346_43347insTGTGTCTT of the chicken LDAH gene (the mutation was counted from the A base of 101939545bp of chromosome 3 of chicken, corresponding to the sixth version of the chicken genome sequence GRCg6a:NC_006090.5:101982890), and the chicken genomic DNA was amplified using the obtained primers. Denaturing polyacrylamide gel (PAGE) electrophoresis found that the c.43346_43347insTGTGTCTT site has two genotypes, and the two genotypes have extremely significant effects on abdominal fat weight, abdominal fat rate, leg muscle weight and leg muscle rate (P<0.01); the effects on testis weight and testis rate are significant (P<0.05), indicating that the chicken LDAH gene variation site c.43346_43347insTGTGTCTT is a molecular marker that affects the growth and development of chicken abdominal fat, leg muscle and testis, and can be used to identify broilers with low abdominal fat, high leg muscle and high fertility, or to breed broilers with low abdominal fat, high leg muscle and high fertility.

[0008] In order to solve the above technical problems and achieve corresponding technical effects, the present invention provides the following technical solutions:

[0009] The first purpose of the present invention is to provide a multi-effect molecular marker that simultaneously predicts chicken abdominal fat traits, leg muscle traits and reproductive traits and its application in genetic breeding related to chicken abdominal fat, leg muscle and reproductive traits. The multi-effect molecular marker is the chicken LDAH gene variation site c.43346_43347insTGTGTCTT, and the variation site is counted from the A base of 101939545bp of chicken chromosome 3, corresponding to the chicken version 6 genome sequence GRCg6a:NC_006090.5:101982890.

[0010] The second object of the present invention is to provide a multi-effect molecular marker that simultaneously predicts chicken abdominal fat traits, leg muscle traits and reproductive traits for use in identifying chicken abdominal fat, leg muscle and reproductive traits, wherein the multi-effect molecular marker is the chicken LDAH gene variation site c.43346_43347insTGTGTCTT, and the variation site is counted from the A base of 101939545bp on chicken chromosome 3, corresponding to the chicken version 6 genome sequence GRCg6a:NC_006090.5:101982890.

[0011] In one embodiment of the present invention, if the pleiotropic site of the pleiotropic molecular marker is expressed as a homozygous deletion of the TGTGTCTTT sequence, the genotype is DD, and individuals with the DD genotype have the characteristics of low abdominal fat content, high leg muscle content and strong reproductive capacity; if the pleiotropic site of the pleiotropic molecular marker is expressed as a heterozygous insertion / deletion of the TGTGTCTTT sequence, the genotype is ID, and individuals with the ID genotype have the characteristics of high abdominal fat content, low leg muscle content and weak reproductive capacity.

[0012] In one embodiment of the present invention, the chicken abdominal fat traits are abdominal fat weight and abdominal fat rate, the leg muscle traits are leg muscle weight and leg muscle rate, and the reproductive traits are testicle weight and testicle rate.

[0013] The third object of the present invention is to provide a primer pair for amplifying the above-mentioned pleiotropic molecular marker for use in genetic breeding related to chicken abdominal fat, leg muscle and reproductive traits, wherein the primer pair contains an upstream primer with a nucleotide sequence as shown in SEQ ID NO.1 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO.2.

[0014] The fourth object of the present invention is to provide a primer pair for amplifying the above-mentioned multi-effect molecular marker for use in identifying chicken abdominal fat, leg muscle and reproductive traits, wherein the primer pair contains an upstream primer with a nucleotide sequence as shown in SEQ ID NO.1 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO.2.

[0015] A fifth object of the present invention is to provide a reagent or kit comprising the above primer pair for use in identifying chicken abdominal fat, leg muscle and reproductive traits.

[0016] The sixth object of the present invention is to provide a reagent or kit comprising the above primer pair for use in genetic breeding related to chicken abdominal fat, leg muscle and reproductive traits.

[0017] In one embodiment of the present invention, the chicken abdominal fat traits are abdominal fat weight and abdominal fat rate, the leg muscle traits are leg muscle weight and leg muscle rate, and the reproductive traits are testicle weight and testicle rate.

[0018] A seventh object of the present invention is to provide a molecular marker method for simultaneously predicting broiler abdominal fat traits, leg muscle traits and reproductive traits, the molecular marker method comprising the following steps:

[0019] S1, extracting chicken genomic DNA, and performing PCR amplification on the chicken genomic DNA using an upstream primer having a nucleotide sequence as shown in SEQ ID NO.1 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO.2 to obtain an amplified product;

[0020] S2, identifying the amplified product obtained in S1 by agarose gel electrophoresis;

[0021] S3. Non-denaturing polyacrylamide gel electrophoresis detection. The PCR product obtained in step S1 is subjected to PAGE electrophoresis. After the electrophoresis, the genotype is determined by silver staining. If the electrophoresis band is one band, the site of the molecular marker is a homozygous deletion of the TGTGTCTTT sequence, the genotype is DD, and the individual has the characteristics of low abdominal fat content, high leg muscle content and strong reproductive capacity. If the electrophoresis band is two bands, the site of the molecular marker is a heterozygous insertion / deletion of the TGTGTCTTT sequence, the genotype is ID, and the individual has the characteristics of high abdominal fat content, low leg muscle content and weak reproductive capacity.

[0022] In one embodiment of the present invention, the conditions for PCR amplification are pre-denaturation at 94°C for 1 min; denaturation at 98°C for 10 sec, annealing at 52.6°C for 15 sec, extension at 68°C for 30 sec, 30 cycles; final extension at 68°C for 5 min, and insulation at 4°C.

[0023] Beneficial effects of the present invention:

[0024] The present invention proves that the two genotypes of the chicken LDAH gene variation site c.43346_43347insTGTGTCTT have extremely significant effects on abdominal fat weight, abdominal fat rate, leg muscle weight and leg muscle rate (P<0.01); and have significant effects on testis weight and testis rate (P<0.05), indicating that the chicken LDAH gene variation site c.43346_43347insTGTGTCTT is a molecular marker that affects the growth and development of chicken abdominal fat, leg muscle and testis.

[0025] The molecular markers of the present invention can be used to select the abdominal fat rate, leg muscle weight and testis rate of chickens at the same time with the same marker, providing an effective, simple and easy molecular marker breeding method for the simultaneous improvement of the abdominal fat trait, leg muscle trait and reproductive trait of chickens. The molecular marker breeding method is simple to operate, low in cost and high in accuracy, and can efficiently and accurately identify broilers with low abdominal fat, high leg muscle and high reproductive capacity, and can better achieve multi-trait balanced breeding, cultivate low-fat broilers with high leg muscle content and high reproductive capacity that meet market demand, thereby obtaining better economic benefits and accelerating the breeding process of broilers. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 It is the agarose gel electrophoresis diagram of the PCR amplification product of the LDAH gene mutation site c.43346_43347insTGTGTCTT; among which, lanes 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10 are all PCR amplification products of the LDAH gene mutation site c.43346_43347insTGTGTCTT;

[0027] Figure 2This is the PAGE electrophoresis diagram of the LDAH gene mutation site c.43346_43347insTGTGTCTT. DETAILED DESCRIPTION

[0028] In order to make the purpose, technical scheme and advantages of the present invention more clear, the present invention is further described in detail below in conjunction with specific embodiments and drawings. The experimental methods used in the following examples are conventional experimental methods unless otherwise specified, and the materials, reagents, methods and instruments used are conventional materials, reagents, methods and instruments in the art unless otherwise specified, and those skilled in the art can purchase them through commercial channels.

[0029] The experimental animals and trait determination methods involved in the present invention are as follows:

[0030] A total of 426 male and female chickens from the Northeast Agricultural University F2 population (cross construction of AA roosters and white-eared hens) were collected. Blood was collected from the wing vein at 12 weeks of age and anticoagulated with EDTA-Na2. The live weight was measured before slaughter at 12 weeks of age, and the abdominal fat weight, leg muscle weight, and testicle weight were measured after slaughter. The weight traits were divided by the live weight at 12 weeks of age to calculate the corresponding weight ratio.

[0031] The medicines involved in the present invention are as follows:

[0032] TaKaRa Ex Premier TM DNA Polymerase was purchased from Bio-Rad Biotechnology (Beijing) Co., Ltd.; 30% acrylamide and TEMED were purchased from Bio-Technology Co., Ltd.; Tris was purchased from Sigma Chemicals Co.; 6× loading buffer and DNA Marker were purchased from Quanshijin Company; Tris-saturated phenol was purchased from Beijing Dingguo Biotechnology Development Center; agarose was purchased from Yuanpinghao Company; 10000× SuperRed nucleic acid dye was purchased from Zhuangmeng Company; gel recovery kit was purchased from Axygen Company; blood / cell / tissue genomic DNA extraction kit was purchased from Beijing Tiangen Technology Biochemical Co., Ltd.

[0033] The main instruments and equipment involved in the present invention are as follows:

[0034] PCR instrument and micropipette were purchased from Eppendorf, Germany; electronic scale ACS-30 was purchased from Shanghai Huade Company; -20℃ / 4℃ refrigerator was purchased from Qingdao Haier Company; -80℃ refrigerator was purchased from Froma Company, USA; electronic constant temperature water bath was purchased from Shanghai Yiheng Technology Co., Ltd.; electrophoresis instrument and electrophoresis tank were purchased from Beijing Liuyi Instrument Factory; electronic balance was purchased from Mettler-Toledo Instrument (Shanghai) Co., Ltd.; vertical plate electrophoresis tank was purchased from Beijing Oriental Special Co., Ltd.; gel imaging system was purchased from UVP Company, USA; ultrapure water instrument was purchased from Milli-Q Company, USA; high-pressure steam sterilizer was purchased from SANYO Company, Japan; and clean bench was purchased from Suzhou Purification Equipment Co., Ltd.

[0035] The buffer solution and common reagents involved in the present invention are prepared as follows:

[0036] 1×TAE buffer: weigh 242 g Tris and 37.2 g Na2EDTA·2H2O (disodium ethylenediaminetetraacetate dihydrate) in a beaker, add about 600 mL of deionized water, stir thoroughly to dissolve, add 57.1 mL of acetic acid, stir thoroughly, dilute the solution to 1 L, and store at room temperature.

[0037] 10×TBE buffer: weigh 108 g Tris, 7.44 g Na2EDTA·2H2O (disodium ethylenediaminetetraacetate dihydrate), and 55 g boric acid, add 800 mL of deionized water, stir thoroughly to dissolve, add deionized water to make the final volume 1 L, and store at room temperature.

[0038] 10% ammonium persulfate: Weigh 1 g of ammonium persulfate into a beaker, add 10 mL of deionized water to dissolve, and store in a refrigerator at 4°C.

[0039] Silver staining solution: weigh 0.5 g AgNO3, add 100 mL of deionized water and stir thoroughly to dissolve, add deionized water to make up to 500 mL, and store in a refrigerator at 4°C.

[0040] Color developing solution: weigh 3.25 g NaOH, add 100 mL deionized water and 2.5 mL formaldehyde, stir thoroughly to dissolve, and add deionized water to make up to 250 mL.

[0041] Example 1: A multi-effect molecular marker method for identifying broilers with low abdominal fat, high leg muscle and high fertility using the LDAH gene

[0042] 1. Primer design and synthesis

[0043] Primers were designed based on the upstream 302bp and downstream 201bp sequences of the chicken LDAH gene mutation site c.43346_43347insTGTGTCTT (the mutation is counted from the A base of 101939545bp of chicken chromosome 3, corresponding to the chicken genome sequence GRCg6a:NC_006090.5:101982890 of the sixth version, and the nucleotide sequence is as described in SEQ ID NO.3) and synthesized by Anshengda Technology Co., Ltd. The primer sequences are as follows:

[0044] LDAH-F: 5'-CAGAAATTAGGGCTACTTAAAGG-3' (SEQ ID NO. 1);

[0045] LDAH-R: 5'-CTATATTTCCCTTGAAGTTTCAGG-3' (SEQ ID NO. 2).

[0046] SEQ ID NO.3:

[0047] TTGCAGTGTGGCTGTCTAATAGAAAAAAAAAAAAGTGGATATACAGTTAGCAAAACTGGTTGATAAAGCCACTCATATCTATGGAATAGACCAAAGATTACACACTGCCAGTTTCCTTATTTGATTACTAAACGTCTCCTCTAAAACAGAAATTAGGGCTACTTAAAGG TACAGTGGCAATTAAAGCTCTCTTTTTGCTTCTAGGACATTCTTTTGAAATATACATTTCATTTATTCTTAATAGTGTCTTGTATGTATTATACAAGCAAATAGTGCATCTCTGAACAGTGCTGTCTTAC(TGTGTCTT)AGTGTGTCCTTTCTGAGTGGGTGAAGCAGGTAG ATATCCCTTGCTCAGTCCTGAAACTTCAAGGGAAATATAGATTACATACAGTTCAACA CTCTTCTTAATGAGAAAAATTTACAGTTCAGAGATCTTGAAGATCAAATGAGACCTG TAAATAGTAGAGTGATAATAGAAAGTGCAAATATTAGTTTAGTAAAAATTGAT (the inserted fragment is in brackets)

[0048] 2. Use the amplification primers obtained in step 1 to perform PCR amplification of chicken genomic DNA to obtain an amplified product.

[0049] (1) Extraction of chicken DNA

[0050] The blood / cell / tissue genomic DNA extraction kit (DP304) was used to extract the genome. The specific steps are as follows:

[0051] ① Take 20 μL of anticoagulated blood, add 180 μL of buffer GA, add 20 μL of proteinase K, and mix well;

[0052] ② Add 200 μL of buffer GB, invert thoroughly, place at 70°C for 10 min, and centrifuge briefly to remove water droplets on the inner wall of the tube cap;

[0053] ③ Add 200 μL of anhydrous ethanol and shake thoroughly for 15 seconds. Flocculent precipitation may appear at this time. Centrifuge briefly to remove water droplets on the inner wall of the tube cap.

[0054] ④ Add the obtained solution and flocculent precipitate to the adsorption column CB3 (the adsorption column is placed in the collection tube), centrifuge at 12000rpm for 30 seconds, discard the waste liquid, and put the adsorption column CB3 back into the collection tube;

[0055] ⑤ Add 500 μL of buffer GD to the adsorption column CB3 (check whether anhydrous ethanol has been added before use), centrifuge at 12000 rpm for 30 seconds, discard the waste liquid, and put the adsorption column CB3 back into the collection tube;

[0056] ⑥ Add 600 μL of rinse solution PW to the adsorption column CB3 (check whether anhydrous ethanol has been added before use), centrifuge at 12000 rpm for 30 seconds, discard the waste liquid, and put the adsorption column CB3 back into the collection tube;

[0057] ⑦Repeat step ⑥;

[0058] ⑧Put the adsorption column CB3 back into the collection tube, centrifuge at 12000rpm for 2min to discard the waste liquid, and place the adsorption column CB3 at room temperature for several minutes to completely dry the residual rinse liquid in the adsorption material;

[0059] ⑨ Transfer the adsorption column CB3 to a clean centrifuge tube, add 50 μL of elution solution TE to the middle part of the adsorption membrane, let it stand at room temperature for 5 minutes, centrifuge at 12000 rpm for 2 minutes, and collect the solution into the centrifuge tube.

[0060] (2) PCR amplification reaction system.

[0061] The chicken DNA extracted as above was used as a template for PCR amplification, and the reaction system contained the following solutions or reagents:

[0062]

[0063] The above solutions were mixed and PCR reaction was carried out under the following conditions: denaturation at 94°C for 1 min; 98°C for 10 sec, 52.6°C for 15 sec, 68°C for 30 sec, 30 cycles; extension at 68°C for 5 min to obtain the amplified product.

[0064] 3. Perform agarose gel electrophoresis on the amplified product obtained in step 2.

[0065] (1) Preparation of 1.5% agarose gel: weigh 1.5 g agarose and place it in a conical flask, add 100 ml 1×TAE, add 10 μl 10000× Super Red nucleic acid dye, put a small beaker on the bottle mouth, heat and boil in a microwave oven 3 times until the agarose is completely melted, and shake well;

[0066] (2) Preparation of gel plate: Take the organic glass gel tank in the electrophoresis tank, wash it clean, dry it, put the gel glass plate in it, use transparent tape to seal the glass plate and the edges of the inner tank at both ends to form a mold, put the inner tank in a horizontal position, and place a comb in a fixed position. Mix the 1.5% agarose gel solution cooled to about 65°C and carefully pour it into the gel tank. After the gel solution slowly expands, remove the tape, put the gel and gel tank into the electrophoresis tank, and add 1×TAE electrophoresis buffer until the gel plate is covered;

[0067] (3) Sample loading: Mix the amplified product obtained in step 2 with 2 μL of 6× loading buffer, take 10 μL of the mixture and spot it into the sample wells of the gel plate, and spot the DNA marker and negative control on the left side;

[0068] (4) Electrophoresis: After adding the sample, the gel plate is immediately placed in a power supply environment within the voltage range of 60V-100V for electrophoresis. The sample moves from the negative electrode to the positive electrode. The electrophoresis is stopped when the bromophenol blue moves to 3 / 4 of the gel plate.

[0069] (5) Observation and photography: Observe under ultraviolet light to see whether the target band appears at the corresponding DNA marker (see Figure 1 ).

[0070] 4. Perform LP electrophoresis on the amplified product obtained in step 2.

[0071] (1) Preparation of non-denaturing polyacrylamide gel

[0072] A 10% non-denaturing polyacrylamide gel was prepared using the following solutions or reagents: 30% acrylamide (29:1) 16.65 mL, 10×TBE 5 mL, ddH2O 28 mL, 10% ammonium persulfate 0.35 mL, and TEMED 17.5 μL.

[0073] After preparing the gel solution, you can pour the gel according to the following methods and steps:

[0074] ① Place the sealed glass plates at an angle of 30° on the tabletop (with the pouring port on top), quickly shake the gel solution and slowly pour it into the two glass plates until they are full, taking care not to generate bubbles;

[0075] ② Insert the comb immediately after the glue is poured. The comb should be inserted straight, with the top slightly higher than the top of the glass plate, so that it is easy to pull out after the glue is solidified. Be careful not to leave any bubbles at the bottom of the comb;

[0076] ③ The gel will polymerize at room temperature for about 45 to 60 minutes. Lines with different color refraction rates will appear at the bottom of the comb, indicating that the gel polymerization is complete. When pulling up the comb, use both hands to apply force evenly to ensure that the sample well is straight. If you want to shorten the gel polymerization time, you can add more ammonium persulfate and TEMED, and the amount can be controlled by yourself.

[0077] ④ After pulling out the comb, rinse the sample well with distilled water to wash away excess unpolymerized acrylamide;

[0078] ⑤ Transfer the glass plate with gel to the electrophoresis tank and fix it with iron clamps;

[0079] ⑥ Pour 1×TBE buffer into the upper and lower tanks, and pay attention to whether there is leakage in the upper tank.

[0080] (2) Electrophoresis

[0081] ① Pre-electrophoresis for 10 minutes, and prepare for spotting at the same time;

[0082] ② Add 2 μL 6× loading buffer to 10 μL PCR product and mix well;

[0083] ③ The sample volume is 1 μL. Please make sure to mark the order of spotting on the glass plate.

[0084] ④ Turn on the electrophoresis apparatus and perform electrophoresis at 120V at 4°C for 11-12 hours.

[0085] (3) Silver staining

[0086] ① After the electrophoresis is finished, remove the glass plate, pry the edge of the glass plate gently with a surgical knife handle or something like that, use a gasket to cut the sample wells flush, and cut off a corner on the side where the sample is started as a mark;

[0087] ②Fix in 70% ethanol for 15 minutes;

[0088] ③ Wash twice with deionized water, 2 to 3 minutes each time;

[0089] ④Add silver stain solution and stain for 15 minutes;

[0090] ⑤ Wash with deionized water 2 to 3 times, 2 to 3 minutes each time;

[0091] ⑥ Add color developing solution. After 10 minutes, when the electrophoresis bands become clearer, rinse with deionized water and stop developing.

[0092] 5. Correlation analysis

[0093] (1) Statistical model establishment

[0094] According to the characteristics of the F2 chicken population of Northeast Agricultural University, the following linear model was constructed:

[0095] Y=μ+S+G+F+D(F)+BW 12 +e

[0096] Y is the observed value of the trait, μ is the population mean, S is the sex fixed effect, G is the genotype fixed effect, F is the rooster random effect, D(F) is the hen random effect nested in the rooster, BW 12 As a covariate variable, e is the residual value. When Y is a ratio trait, BW is not included in the model 12 The significant threshold is 0.05, and the extremely significant threshold is 0.01. That is, when 0.01<P≤0.05, it reaches a significant level; when P≤0.01, it reaches an extremely significant level.

[0097] (2) Correlation analysis between the polymorphism of chicken LDAH gene and abdominal fat weight (rate), leg muscle weight (rate) and testis weight (rate)

[0098] The primers (LDAH-F and LDAH-R) of the present invention were used to perform PCR amplification on the genomic DNA of 426 broilers from the F2 population of Northeast Agricultural University, and then polymorphism analysis was performed on the variable site c.43346_43347insTGTGTCTT. As a result, two genotypes were detected in the F2 population, namely, ID type and DD type (see Figure 2 ), those with deletions were recorded as DD type (homozygous for TGTGTCTTT sequence deletion), and those with insertion sequences were recorded as ID type (heterozygous for TGTGTCTTT sequence insertion / deletion).

[0099] The effects of two genotypes of c.43346_43347insTGTGTCTT locus on abdominal fat weight (rate), leg muscle weight (rate), and testis weight (rate) of chickens were analyzed. The results of correlation analysis showed that the genotype of this locus had a very significant effect on abdominal fat weight, abdominal fat rate, leg muscle weight, and leg muscle rate (P<0.01); and a significant effect on testis weight and testis rate (P<0.05) (Table 1). It can be seen that this locus is a molecular marker that affects the growth and development of abdominal fat, leg muscle, and testis in chickens. Further multiple comparison results showed that the DD genotype is a favorable genotype, that is, individuals with the DD genotype have the characteristics of low abdominal fat content, high leg muscle content, and strong reproductive ability. Selecting individuals with the DD genotype for breeding will be able to improve the above three traits at the same time.

[0100] The molecular marker method of the present invention can be used to simultaneously select the abdominal fat content, leg muscle content, and testicle size of chickens using the same marker, providing an effective molecular marker breeding method for improving the abdominal fat traits, leg muscle traits, and reproductive performance of chickens, which can better achieve multi-trait balanced breeding and accelerate the breeding process of broiler chickens.

[0101] Table 1 Effects of the intron c.43346_43347insTGTGTCTT site of the LDAH gene on the abdominal fat, leg muscle and testicular traits of chickens (P value)

[0102]

[0103] Note: The least square means in the same row marked with A or B indicate extremely significant differences (P<0.01), and those marked with a or b indicate significant differences (P<0.05).

[0104] Although the present invention has been disclosed as above in the form of preferred embodiments, it is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

Claims

1. An application of a pleiotropic molecular marker for simultaneously predicting chicken abdominal fat traits, leg muscle traits and reproductive traits in genetic breeding related to chicken abdominal fat, leg muscle and reproductive traits, characterized in that: The pleiotropic molecular marker is the chicken LDAH gene variation site c.43346_43347insTGTGTCTT, which is located between 101982890 bp and 101982891 bp of chicken chromosome 3, corresponding to the chicken version 6 genome sequence GRCg6a:NC_006090.5:101982890_101982891; the nucleotide sequence containing the variation site is shown in SEQ ID NO.3; the reproductive traits are testis weight and testis rate.

2. Use of a multi-effect molecular marker for simultaneously predicting chicken abdominal fat traits, leg muscle traits and reproductive traits in identifying chicken abdominal fat, leg muscle and reproductive traits, characterized in that: The pleiotropic molecular marker is the chicken LDAH gene variation site c.43346_43347insTGTGTCTT, which is located between 101982890 bp and 101982891 bp of chicken chromosome 3, corresponding to the chicken version 6 genome sequence GRCg6a:NC_006090.5:101982890_101982891; the nucleotide sequence containing the variation site is shown in SEQ ID NO.3; the reproductive traits are testis weight and testis rate.

3. The use according to claim 1 or 2, characterized in that: If the pleiotropic site of the pleiotropic molecular marker is expressed as a homozygous deletion of the TGTGTCTTT sequence, the genotype is DD, and individuals with the DD genotype have the characteristics of low abdominal fat content, high leg muscle content and strong reproductive capacity; if the pleiotropic site of the pleiotropic molecular marker is expressed as a heterozygous insertion / deletion of the TGTGTCTTT sequence, the genotype is ID, and individuals with the ID genotype have the characteristics of high abdominal fat content, low leg muscle content and weak reproductive capacity.

4. Use of a primer pair for amplifying the pleiotropic molecular marker of claim 1 in genetic breeding related to chicken abdominal fat, leg muscle and reproductive traits, characterized in that: The primer pair comprises an upstream primer with a nucleotide sequence as shown in SEQ ID NO.1 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO.2; the reproductive traits are testis weight and testis rate.

5. Use of a primer pair for amplifying the pleiotropic molecular marker according to claim 1 in identifying abdominal fat, leg muscle and reproductive traits of chickens, characterized in that: The primer pair comprises an upstream primer with a nucleotide sequence as shown in SEQ ID NO.1 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO.2; the reproductive traits are testis weight and testis rate.

6. Use of a reagent or a kit comprising the primer pair described in claim 4 or 5 in identifying abdominal fat, leg muscle and reproductive traits of chickens; the reproductive traits are testis weight and testis rate.

7. Use of a reagent or a kit comprising the primer pair described in claim 4 or 5 in genetic breeding related to chicken abdominal fat, leg muscle and reproductive traits; the reproductive traits are testis weight and testis rate.

8. The use according to any one of claims 1 to 7, characterized in that: The abdominal fat traits of chickens are abdominal fat weight and abdominal fat rate, and the leg muscle traits are leg muscle weight and leg muscle rate.

9. A molecular marker method for simultaneously predicting broiler abdominal fat traits, leg muscle traits and reproductive traits, characterized in that: The steps include: S1, extracting chicken genomic DNA, and performing PCR amplification on the chicken genomic DNA using an upstream primer having a nucleotide sequence as shown in SEQ ID NO.1 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO.2 to obtain an amplified product; S2, identifying the amplified product obtained in S1 by agarose gel electrophoresis; S3, non-denaturing polyacrylamide gel electrophoresis detection, the PCR product obtained in step S1 is subjected to PAGE electrophoresis, and the genotype is determined by silver staining after the electrophoresis; if the electrophoresis band is one band, the site of the molecular marker is a homozygote with a deletion of the TGTGTCTTT sequence, the genotype is DD, and the individual has the characteristics of low abdominal fat content, high leg muscle content and strong reproductive capacity; if the electrophoresis band is two bands, the site of the molecular marker is a heterozygote with an insertion / deletion of the TGTGTCTTT sequence, the genotype is ID, and the individual has the characteristics of high abdominal fat content, low leg muscle content and weak reproductive capacity; The reproductive traits are testis weight and testis rate.

10. The method according to claim 9, characterized in that The conditions for PCR amplification were as follows: pre-denaturation at 94°C for 1 min; denaturation at 98°C for 10 sec, annealing at 52.6°C for 15 sec, extension at 68°C for 30 sec, 30 cycles; final extension at 68°C for 5 min, and insulation at 4°C.

Images