A method for detecting Cronobacter malonate based on the MIRA-CRISPR Cas12a system

Abstract

The present invention discloses a method for detecting Cronobacter malonate based on the MIRA-CRISPR Cas12a system, using a high-temperature boiling method to quickly extract Cronobacter DNA, screening out the Cronobacter malonate specific sequence Genbank: NZ_CP013940.12727946...2728626 as the detection target, using MIRA isothermal amplification technology to achieve rapid amplification of the target gene on site, designing CrRNA for specific sequences, to activate the non-specific cutting function of the Cas12a enzyme, thereby realizing the interpretation of the detection results by ssDNA reporter probes. The detection system constructed by the present invention has excellent sensitivity, extremely high specificity, and the advantages of short detection time, and the detection method is commonly used for the detection of Cronobacter malonate.

Description

Technical Field

[0001] The present invention belongs to the field of on-site rapid detection of food safety microorganisms, and specifically relates to a method for detecting Cronobacter malonate based on a MIRA-CRISPR Cas12a system. Background Art

[0002] Cronobacter is an extremely dry-resistant foodborne pathogen that mainly causes diseases in infants, young children, and the elderly. Infant formula is one of the important food sources for infants, and infants have become the main group infected with Cronobacter. Infants and young children will experience serious consequences such as bacteremia, meningitis, and necrotizing enterocolitis after being infected with Cronobacter. Therefore, it is particularly important to develop corresponding detection methods to conduct risk assessment and safety control of foods that may be at risk of contamination in order to prevent the spread and occurrence of foodborne diseases.

[0003] The genus Cronobacter includes seven different species. In addition to Cronobacter sakazakii, Cronobacter malonate is also the main Cronobacter in infant formula (PIF) worldwide. After searching, the current reports on the detection of Cronobacter are concentrated on the genus Cronobacter and Cronobacter sakazakii, the earliest pathogenic bacteria, and lack the detection of Cronobacter malonate. The existing detection methods for Cronobacter include traditional biochemical culture detection, molecular biology-based nucleic acid detection methods, and immunological detection. The traditional biochemical culture method is cumbersome, low in specificity, and time-consuming. It takes at least three to five days from pre-treatment to the issuance of test results; the molecular biology detection method based on PCR has high specificity and short time consumption, but it relies on the operation of professional technicians and expensive instruments and equipment. In addition, the pathogenicity of the seven species in the genus is different, but the nucleic acid sequences are highly homologous and difficult to distinguish; the antibody preparation cycle in the immunological detection method is long, the process is complicated, the cost is high, and the sensitivity is lower than that of the molecular biology method.

[0004] At present, in addition to laboratory testing methods, food safety-related testing methods tend to develop into rapid screening methods for field applications. Multienzyme Isothermal Rapid Amplification (MIRA) has been developed for the detection of various pathogens. This technology amplifies the target sequence at a constant temperature, which can save the repeated heating and cooling steps of PCR and greatly shorten the detection time; the constant incubation temperature also reduces the requirements for equipment, breaking the boundaries of the laboratory and opening up new ways for detection in resource-scarce areas.

[0005] However, currently, there are no reports on the detection method of Cronobacter malonate based on the MIRA-CRISPR Cas12a system. Summary of the invention

[0006] The purpose of this section is to summarize some aspects of embodiments of the present invention and briefly introduce some preferred embodiments. Some simplifications or omissions may be made in this section and the specification abstract and the invention title of this application to avoid blurring the purpose of this section, the specification abstract and the invention title, and such simplifications or omissions cannot be used to limit the scope of the present invention.

[0007] In view of the above problems and / or the problems existing in the prior art, the present invention is proposed.

[0008] Therefore, the purpose of the present invention is to overcome the deficiencies in the prior art and provide a method for detecting Cronobacter malonate based on the MIRA-CRISPRCas12a system.

[0009] In order to solve the above technical problems, the present invention provides the following technical solutions: a method for detecting Cronobacter malonate based on the MIRA-CRISPRCas12a system, comprising:

[0010] The DNA of Cronobacter was quickly extracted by high temperature boiling method;

[0011] MIRA-specific primers were used to amplify Cronobacter malonate-specific genes to obtain Cronobacter malonate-specific products that can be used in the MIRA-CRISPRCas12a system;

[0012] Design of crRNA targeting sequences specific to Cronobacter malonate;

[0013] Through the CRISPR Cas12a detection system, specific CrRNA targets and recognizes the Cronobacter malonate-specific product, activates the nonspecific cleavage activity of CrRNA-Cas12a, and interprets the detection results through the reporter probe to achieve the detection of Cronobacter malonate;

[0014] Among them, the specific primer sequences are SEQ NO.1 and SEQ NO.2, and the nucleotide sequence of CrRNA is SEQ NO.9.

[0015] As a preferred embodiment of the detection method of the present invention, the high temperature boiling method is used to quickly extract Cronobacter DNA, including:

[0016] Take 1 ml of fresh bacterial liquid, boil it at 100℃ for 10 minutes, lyse the bacteria and obtain genomic DNA.

[0017] As a preferred embodiment of the detection method of the present invention, the detection result is interpreted by using a reporter probe, including using a reporter probe labeled with FAM / BHQ1 groups at both ends to achieve rapid fluorescence visualization detection.

[0018] As a preferred embodiment of the detection method of the present invention, the fluorescence visualization rapid detection comprises:

[0019] The malonate Cronus-specific product that can be used in the MIRA-CRISPR Cas12a system was added to the CRISPR Cas12a system, and the dynamic fluorescence signal of the entire reaction process was monitored by a microplate reader;

[0020] When Cas12a, CrRNA, and substrate DNA are present at the same time, the nonspecific cleavage activity of Cas12a is stimulated, and the fluorescent probe is cut to produce a fluorescent signal.

[0021] As a preferred embodiment of the detection method of the present invention, after the determination by the microplate reader is completed, the enzyme cleavage reaction products in the 384-well plate are immediately recovered, placed in a dark environment, irradiated with a 365nm ultraviolet lamp, and the fluorescence results are observed with the naked eye.

[0022] As a preferred embodiment of the detection method of the present invention, the detection result is interpreted by using a reporter probe, and further comprises:

[0023] Using reporter probes labeled with FAM / Biotin groups at both ends, colloidal gold lateral flow immunochromatography test strips can be used to visualize and rapidly detect Cronobacter malonate.

[0024] As a preferred embodiment of the detection method of the present invention, the colloidal gold lateral flow immunochromatographic test strip for rapid visual detection comprises:

[0025] The malonate Cronus-specific product of the MIRA-CRISPR Cas12a system was directly added to the CRISPR Cas12a system, incubated at room temperature, 6 μl of substrate DNA and 0.8 μl of reporter probe were added, and enzyme digestion was performed at 37 °C;

[0026] After the reaction is completed, take 5 μl of the reaction product and add it to 45 μl of the test strip loading buffer. After mixing, slowly drip it onto the test strip loading area and read the result after 5 minutes.

[0027] As a preferred embodiment of the detection method of the present invention, the concentration of the reporter probe is 0.4-1 nM.

[0028] As a preferred embodiment of the detection method of the present invention, the concentration of the reporter probe is 0.4 nM.

[0029] As a preferred embodiment of the detection method of the present invention, when the probe concentration is 0.4 nM, for 10 8CFU / ml bacterial sample can produce accurate results within 15 minutes of enzyme digestion reaction; 0 The reaction time of the CRISPR Cas12a system for bacterial liquid samples with CFU / ml was shortened from 1.5 to 1h.

[0030] Beneficial effects of the present invention:

[0031] (1) The present invention provides a method for detecting Cronobacter malonate with simple operation and accurate results. The detection process includes the following four steps: sample pretreatment, MIRA isothermal amplification, CRISPR Cas12a system detection, and result determination.

[0032] (2) The detection method established by the present invention only needs to replace the corresponding target nucleic acid sequence and CrRNA sequence, which can realize the detection of various microorganisms and has a wide range of applications; the detection method established by the present invention has a low detection limit, and the detection limit of bacterial liquid samples can be as low as 10 0 CFU / ml.

[0033] (3) The detection method established by the present invention has strong specificity. The presence of Cronobacter sakazakii, Cronobacter zurichensis, Cronobacter moginii, Escherichia coli, Staphylococcus aureus, and Salmonella will not stimulate the CRISPR Cas12a system to initiate the enzyme cleavage mechanism to cut the reporter probe.

[0034] (4) The detection method established by the present invention is time-saving, and only takes 1.5 hours from sample pretreatment to issuing the test results. Compared with the national standard method (GB 4789.40-2016) which takes at least 5 days, the detection time is greatly shortened.

[0035] (5) The detection results of the detection method established by the present invention can be interpreted through fluorescence or dual-channel test strips, which meets the detection needs in different scenarios. It does not rely on traditional PCR instruments, electrophoresis and other equipment and is suitable for on-site detection. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the following briefly introduces the drawings required for describing the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without creative labor. Among them:

[0037] Figure 1 This is a result diagram of the feasibility of detecting cis-cleavage of Cronobacter malonate based on the CRISPR Cas12a system in the present invention;

[0038] Figure 2This is a result diagram of the feasibility of detecting trans-cleavage of Cronobacter malonate based on the CRISPR Cas12a system in the present invention;

[0039] Figure 3 This is a diagram of the electrophoresis results of MIRA-specific primer screening in the present invention;

[0040] Figure 4 It is a graph of the detection results at different time points under different probe concentrations based on the MIRA-CRISPR Cas12a colloidal gold lateral flow chromatography test strip system in the present invention;

[0041] Figure 5 This is a graph showing the detection results of Cronobacter malonate at different concentrations (0.4 nM reporter probe concentration) based on the MIRA-CRISPR Cas12a colloidal gold lateral flow chromatography test strip system of the present invention;

[0042] Figure 6 This is a graph showing the specific characterization results of detecting Cronobacter malonate based on the MIRA-CRISPR Cas12a fluorescence system in the present invention;

[0043] Figure 7 This is a graph showing the sensitivity characterization results of detecting Cronobacter malonate based on the MIRA-CRISPR Cas12a fluorescence system in the present invention;

[0044] Figure 8 This is a graph showing the specific characterization results of detecting Cronobacter malonate under ultraviolet light based on the MIRA-CRISPR Cas12a fluorescence system in the present invention;

[0045] Fig. 9 This is a result diagram of sensitivity characterization of detecting Cronobacter malonate under ultraviolet light based on the MIRA-CRISPR Cas12a fluorescence system in the present invention;

[0046] Fig.10 This is a graph showing the specific characterization results of detecting Cronobacter malonate based on the MIRA-CRISPR Cas12a colloidal gold lateral flow chromatography test strip system in the present invention;

[0047] Fig.11 This is a graph showing the sensitive characterization results of detecting Cronobacter malonate based on the MIRA-CRISPR Cas12a colloidal gold lateral flow chromatography test strip system in the present invention. DETAILED DESCRIPTION

[0048] In order to make the above-mentioned objects, features and advantages of the present invention more obvious and easy to understand, the specific implementation methods of the present invention are described in detail below in conjunction with the embodiments of the specification.

[0049] In the following description, many specific details are set forth to facilitate a full understanding of the present invention, but the present invention may also be implemented in other ways different from those described herein, and those skilled in the art may make similar generalizations without violating the connotation of the present invention. Therefore, the present invention is not limited to the specific embodiments disclosed below.

[0050] Secondly, the term "one embodiment" or "embodiment" as used herein refers to a specific feature, structure, or characteristic that may be included in at least one implementation of the present invention. The term "in one embodiment" that appears in different places in this specification does not necessarily refer to the same embodiment, nor does it refer to a separate or selective embodiment that is mutually exclusive with other embodiments.

[0051] A method for detecting Cronobacter malonate based on a MIRA-CRISPR Cas12a system, wherein a specific target gene is obtained by MIRA amplification, a specific CrRNA targeting the target gene sequence is designed, and the CrRNA-Cas12a complex recognizes the target gene and then cuts a reporter probe in the system to achieve the purpose of detection, and the result is interpreted by a fluorescent signal and a colloidal gold lateral flow chromatography test strip.

[0052] The specific steps are:

[0053] The target gene (i.e., Cronobacter malonate-specific gene) is amplified in large quantities by MIRA, and the CrRNA-Cas12a complex specifically recognizes the target gene. The complementary pairing of CrRNA and the target gene nucleic acid sequence activates the non-specific cleavage activity of the Cas12a enzyme and the reporter probe in the cleavage system. The fluorescent probe used in the fluorescence detection system is FAM-ssDNA-BHQ1, whose sequence is: ssDNA-FQ: 6-FAM-TTTTTTTT-BHQ-1, one end of which is labeled with a FAM fluorescent group and the other end is labeled with a BHQ1 quenching group.

[0054] When the target gene is present, it undergoes a large amount of amplification, the Cas12a trans-cleavage activity is stimulated, the fluorescent probe is cut, and the FAM fluorescent group loses the restraining effect of the BHQ1 quenching group to produce a fluorescent signal.

[0055] When the target gene does not exist, the trans-cleavage activity of Cas12a is not stimulated, the fluorescent probe is not cut, and almost no fluorescent signal is generated.

[0056] The colloidal gold lateral flow chromatography test strip detection system uses a probe: FAM-ssDNA-Biotin, whose sequence is ssDNA-FB: 6-FAM-TTTTTTTATTTTTTT-Biotin.

[0057] When the target gene exists, the probe is cut, and only the quality control line of the colloidal gold lateral flow chromatography test strip shows a purple-red band or the test line shows a relatively weak color band; when the target gene does not exist, the probe is not cut, the probe is captured by the Biotin antibody on the test line, and both the quality control line and the test line show obvious purple-red bands.

[0058] The specific steps are as follows:

[0059] (1) Sample pretreatment: Boil the bacterial solution at high temperature to lyse the bacteria and release nucleic acids.

[0060] (2) MIRA amplification of target gene: MIRA amplifies the Cronobacter malonate-specific gene.

[0061] (3) Fluorescence detection: Add the amplified MIRA product to the CRISPR Cas12a system and collect the fluorescence signal generated by the enzyme cleavage system to obtain the detection result.

[0062] (4) Or colloidal gold lateral flow chromatography test strip detection: Add the amplified MIRA product to the CRISPR Cas12a system. After the reaction is completed, take the reaction product and immediately verify the result with a test strip.

[0063] Moreover, the specific genes in step 2 are specific genes of Cronobacter malonate: AFK66_013200 and AFK66_013205.

[0064] Moreover, the MIRA-specific primer sequences are SEQ NO.1 and SEQ NO.2, and the nucleotide sequence of CrRNA is SEQ NO.9.

[0065] Example 1

[0066] (1) Design of primers, crRNA, and probes

[0067] The whole genome sequence of Cronobacter malonate was analyzed through literature review and database comparison, and Genbank: NZ_CP013940.1 REGION 2727946...2728626, NZ_CP013940.1 REGION2968486..2969163, NZ_CP013940.1 REGION 221468..221935 were preliminarily selected as specific sequences for detection of Cronobacter malonate.

[0068] Based on the above specific sequences and the requirement of crRNA targeting PAM sites in the CRISPR Cas12a system, MIRA-specific primers and crRNA were designed using software.

[0069] SEQ NO.1 and SEQ NO.2 are the primer sets corresponding to the sequence NZ_CP013940.1 REGION 2727946...2728626;

[0070] SEQ NO.3 and SEQ NO.4, SEQ NO.5 and SEQ NO.6 are the primer sets corresponding to the sequence NZ_CP013940.1REGION2968486..2969163;

[0071] SEQ NO.7 and SEQ NO.8 are the primer sets corresponding to the sequence of NZ_CP013940.1 REGION 221468..221935;

[0072] SEQ NO.9 is the CrRNA sequence corresponding to the NZ_CP013940.1 REGION 2727946...2728626 sequence.

[0073] Fluorescent probes in the CRISPR system fluorescence visualization system: the 5' end is labeled with a FAM fluorescent group, and the 3' end is labeled with a BHQ1 quenching group;

[0074] Probes in the colloidal gold lateral flow test strip visualization system: the 5' end is labeled with FAM and the 3' end is labeled with Biotin.

[0075] Primers, CrRNA and all probes were synthesized by a third-party primer synthesis company, and colloidal gold test strips used commercial test strips.

[0076] (2) Activation, cultivation and counting of bacterial strains

[0077] Take out the frozen Cronobacter malonate from the -80℃ freezer and thaw slowly on ice;

[0078] Inoculate the glycerol bacteria onto LB solid medium plates by streaking three zones, and incubate them upside down at 37°C for 12 h; pick a single colony on the plate and inoculate it into a test tube containing 5 ml LB liquid medium, and incubate it in a shaker at 220 rpm and 37°C for 12 h;

[0079] Take 100 μl of bacterial solution and dilute it in 900 μl of physiological saline, and then take the diluted bacterial solution and perform 10-fold gradient dilution in sequence; take 50 μl of bacterial solution from each gradient and spread it on the LB solid culture medium plate, repeat one gradient three times, invert and culture at 37℃ for 24 hours, and select the plates with colony counts between 20-200 CFU for counting.

[0080] The activation and culture of Escherichia coli, Staphylococcus aureus and Salmonella can refer to the above methods.

[0081] (3) Extraction of Cronobacter genomic DNA

[0082] Take 1 ml of fresh bacterial liquid, boil it at 100℃ for 10 minutes, lyse the bacteria and obtain genomic DNA.

[0083] (4) MIRA amplification of target gene

[0084] Using the genomic DNA of Cronobacter malonate as a template, the specific genes of Cronobacter malonate were amplified by MIRA (Weifang Anpu Future Biotechnology Co., Ltd.) at constant temperature. The amplification system is shown in the following table, and the amplification conditions are: 37°C, 30min.

[0085]

[0086] (5) Design, transcription and purification of crRNA

[0087] The crRNA involved in the present invention was transcribed by HiScribe® T7 Quick High Yield RNA Synthesis Kit (New England Biolabs, USA) and purified by Monarch® RNA Cleanup Kit (New England Biolabs, USA).

[0088] The crRNA transcription template was synthesized by Beijing Qingke Biotechnology Co., Ltd. and then annealed to obtain a short oligonucleotide chain.

[0089] The specific steps are as follows:

[0090] 5 μl of each of the transcription template short oligonucleotide chain (10 μM) and its complementary chain (10 μM) were annealed in a PCR instrument;

[0091] The annealing program was: 95°C for 5 min, decreasing by 1°C per minute to 25°C, which was used as a template for crRNA transcription.

[0092] The transcription process was carried out according to the instructions of the transcription kit. Since the target product CrRNA was short in length, the total transcription system was adjusted to 30 μl. The system is as follows:

[0093]

[0094] The transcription conditions were as follows: overnight transcription at 37°C. The next day, the volume was filled to 50 μl with sterile enzyme-free water, 2 μl of DNase I was added, and the cell culture was incubated at 37°C for 15 min to remove the transcription template.

[0095] According to the instructions of the RNA purification kit, the transcribed crRNA was purified. The specific steps are as follows:

[0096] Add 100 μl RNA Cleanup Binding Buffer to 50 μl of transcription product, add 150 μl (1 volume) of ethanol (≥95%), and mix by pipetting.

[0097] Insert the chromatographic column into the collection tube, transfer the sample to the chromatographic column, centrifuge at 16000rpm for 1min, and discard the waste liquid. Add 500μl RNA Cleanup Wash Buffer for elution, centrifuge at 16000rpm for 1min, dry the chromatographic column matrix, transfer the chromatographic column to a 1.5ml centrifuge tube without RNase, add 50μl Nuclease-free water, let stand at room temperature for 5min, and centrifuge at 16000rpm for 1min to obtain the purified CrRNA. After measuring the concentration using an ultra-micro UV spectrophotometer, immediately freeze it in a -80℃ refrigerator for later use.

[0098] (6) Screening of MIRA-specific primers

[0099] The specificity of the four primer sets was verified using Cronobacter sakazakii, Cronobacter zurichensis, Cronobacter moginsii, Escherichia coli, Staphylococcus aureus, and Salmonella stored in the laboratory. The genomic DNA of each strain was extracted according to "(3)" and used as a template. The amplification electrophoresis results of the four primer sets are shown in Figure 2. Figure 3 As shown:

[0100] Figure 3 -a is the verification result of the primer set of SEQ NO.1 and SEQ NO.2; 3-b is the verification result of the primer set of SEQ NO.3 and SEQ NO.4; 3-c is the verification result of the primer set of SEQ NO.5 and SEQ NO.6; 3-d is the verification result of the primer set of SEQ NO.7 and SEQ NO.8.

[0101] Figure 3 -a, b, c, d Lanes 1-4 are: Cronobacter sakazakii; Lanes 5 and 6 are: Cronobacter malonate; Lanes 7 and 8 are: Cronobacter zurichensis; Lanes 9 and 10 are: Cronobacter moginii; Lanes 11 and 12 are Escherichia coli; Lanes 13 and 14 are Staphylococcus aureus; Lanes 15 and 16 are Salmonella.

[0102] The results showed that there were differences in the specificity of the four primer sets. For the SEQ NO.1 and SEQ NO.2 primer sets, only the lane where Cronobacter malonate was located had a band, and the band size was consistent with the expected result, indicating that this primer set had a high specificity; the SEQ NO.3 and SEQ NO.4 primer sets, the SEQ NO.5 and SEQ NO.6 primer sets, and the SEQ NO.7 and SEQ NO.8 primer sets all had non-specific amplification results and were not used in subsequent experiments.

[0103] (7) Feasibility analysis and results of CRISPR Cas12a system for detecting cis-cleavage of Cronobacter malonate

[0104] In order to verify whether the Cas12a enzyme (New England Biolabs, USA) in the CRISPR Cas12a system can accurately cut the target under the guidance of crRNA, the feasibility of its cis-cutting target was experimentally verified.

[0105] The specific steps are as follows:

[0106] The CRISPR Cas12a cis-cutting positive system (1000bp cutting target + CrRNA targeting the target) verified in the laboratory was used to verify the CRISPR Cas12a cis-cutting system. The verification system is as follows: (The main components of the buffer are: 50mM NaCl, 10mM Tris-HCl, 10mM MgCl2, 100µg / ml Recombinant Albumin, pH7.9)

[0107]

[0108] Each component was added in strict accordance with the above order, and incubated at room temperature for 10 min to allow Cas12a to fully bind to CrRNA; 3 μl of substrate DNA was added, and the enzyme digestion results were verified by electrophoresis after incubation at 37 °C for 15 min.

[0109] The results are as follows Figure 1 As shown, lane 1 of the control group is substrate DNA with a fragment length of 996bp; lanes 2 and 3 are Cas12a enzyme cutting systems. According to the position of crRNA targeting substrate DNA, after Cas12a accurately cuts the target gene, the expected enzyme cutting products are 636bp and 364bp. Lanes 2 and 3 show that each lane has 3 bands: the first band is fuzzy and consistent with the position of the control group, and is analyzed as part of the uncut substrate; the second and third bands are long and short fragments after enzyme cutting, respectively, and the positions of the bands are basically in line with the expected results. This preliminarily indicates that the Cas12a enzyme in the CRISPR Cas12a system can accurately cut the target under the guidance of crRNA.

[0110] (8) Feasibility analysis and results of CRISPR Cas12a system for detecting trans-cleavage of Cronobacter malonate

[0111] Based on the experimental results of cis-cleavage in (7), the feasibility of trans-cleavage by Cas12a enzyme in CRISPR Cas12a system was further verified. The specific steps are as follows:

[0112] The product amplified by MIRA was used as the cutting target, and the verification system was as follows:

[0113]

[0114] The total reaction system is 30μl. In addition to the verification system, three more systems are set up: Cas12a, CrRNA and substrate DNA of these three systems are removed respectively, and other components remain unchanged as three control groups. Add each component strictly in the above order, incubate at room temperature for 10 minutes, add 3μl substrate DNA and 1.2μl fluorescent probe (10μM), and immediately transfer the reaction system to a black sterile enzyme-free 384-well ELISA plate;

[0115] The fluorescence signal was immediately monitored by an ELISA reader with the excitation wavelength set at 490.4 nM, the emission wavelength set at 520 nm, the incubation temperature set at 37 °C, the kinetic cycle set at 120 times, and the reading set set at every 30 s.

[0116] The results are as follows Figure 2 As shown, the results show that only when Cas12a, CrRNA and substrate DNA exist at the same time can the non-specific cleavage activity of Cas12a be stimulated and the fluorescent probe be cut to produce a fluorescent signal.

[0117] Example 2

[0118] Detection of Cronobacter malonate based on the MIRA-CRISPR Cas12a fluorescence system:

[0119] The genomic DNA of Cronobacter malonate was extracted by thermal lysis method and used as a template for MIRA isothermal amplification of Cronobacter malonate specific genes. The amplification system and experimental steps refer to step "(4)" in Example 1.

[0120] The amplified product was directly added to the CRISPR Cas12a system, and the microplate reader monitored the dynamic fluorescence signal of the entire reaction process. The CRISPR detection system and experimental steps refer to step "(8)" in Example 1.

[0121] To meet the needs of portable on-site testing, the fluorescence detection results can also be interpreted with the help of a handheld ultraviolet lamp: after the microplate reader is used to measure the result, the enzyme cleavage reaction products in the 384-well plate are immediately recovered, placed in a dark environment, and irradiated with a 365nm handheld ultraviolet lamp, and the fluorescence results are observed with the naked eye.

[0122] Example 3

[0123] Detection of Cronobacter malonate based on MIRA-CRISPR Cas12a colloidal gold lateral flow chromatography test strip system:

[0124] The genomic DNA of Cronobacter malonate was extracted by thermal lysis method, and the specific gene of Cronobacter malonate was amplified by MIRA specific primers. The amplification system and experimental steps refer to step "(4)" in Example 1.

[0125] The amplified product was directly added to the CRISPR Cas12a system for detection.

[0126] CRISPR Cas12a detection system Assemble the reaction according to the table below.

[0127]

[0128] Incubate at room temperature for 10 min, add 6 μl of substrate DNA and 0.8 μl of reporter probe (10 μM), and digest at 37°C for 1.5 h.

[0129] After the reaction is completed, take 5 μl of the reaction product and add it to 45 μl of the test strip loading buffer. After mixing, slowly drip it onto the test strip loading area and read the result after 5 minutes.

[0130] The interpretation method is: if both the quality control line and the test line have obvious purple-red bands, the result is judged to be negative; if only the quality control line has a purple-red band or the test line shows a relatively weak color band, the result is judged to be positive; if no purple-red band appears on the quality control line, the result is invalid.

[0131] Example 4

[0132] Optimization of the MIRA-CRISPR Cas12a colloidal gold lateral flow chromatography test strip system for detecting Cronobacter malonate:

[0133] Compared with the fluorescence detection system, the test strip visualization detection system requires 90 minutes of enzyme cleavage reaction to produce accurate results.

[0134] In order to shorten the detection time, the test strip detection system was further optimized, and the final concentration of the probe in the CRISPR Cas12a colloidal gold lateral flow chromatography test strip detection system was adjusted to 0.4 nM, and the other components remained unchanged. The experimental steps were referred to the steps in Example 3.

[0135] The results are as follows Figure 4 As shown, 10 6 The bacterial liquid sample with CFU / ml was used as the detection target, and the enzymatic cleavage reaction of the reporter probe was set at two different working concentrations of 0.4nM and 40nM. The enzymatic cleavage products of 60min and 90min were respectively taken for verification using colloidal gold lateral flow chromatography test strips. The results showed that when the probe concentration was too high, a sufficiently long reaction time was required to produce accurate results; when the probe concentration was reduced to 0.4nM, accurate detection results could be obtained and the detection time could be effectively saved.

[0136] Based on the above optimization results, we further explored the detection results of high-concentration bacterial solution and low-concentration bacterial solution under optimized conditions. 8 CFU / ml and 10 0 The two gradient bacterial samples of CFU / ml were verified, and the results were as follows Figure 5 As shown, the enzyme cleavage products at 15min, 30min, and 60min were taken for verification using test strips. The results showed that when the probe concentration was adjusted to 0.4nM, for 10 8 CFU / ml bacterial sample can produce accurate results in 15 minutes of enzyme digestion reaction, while for 10 0 It takes at least 60 minutes for the CFU / ml bacterial liquid sample to have a different detection line from the control group.

[0137] This shows that reducing the probe concentration of the CRISPR Cas12a system can effectively shorten the detection time and improve the sensitivity of the test strip visualization system. Considering that the bacterial content of the sample is unknown in the actual test, the test strip visualization detection system selects the reaction product at the 60-min time point for verification to ensure the accuracy of the test results. The reporter probe in the subsequent test strip signal readout detection system uses a final concentration of 0.4 nM.

[0138] Example 5

[0139] Characterization of specific experimental results of detecting Cronobacter malonate based on MIRA-CRISPR Cas12a fluorescence system:

[0140] In order to verify the feasibility of the construction method, its specificity was first characterized.

[0141] Using Cronobacter sakazakii, Cronobacter zurichensis, Cronobacter moginii, Escherichia coli, Staphylococcus aureus, and Salmonella existing in the laboratory as negative controls, the experimental method was referred to Example 2 to verify the specificity of the fluorescence signal readout detection system.

[0142] Figure 6-A is the dynamic fluorescence result measured by the microplate reader. The results show that only the malonate Cronobacter bacterial solution can be amplified by the MIRA specific primers, further stimulating the enzyme cutting mechanism in the CRISPR Cas12a system, cutting the fluorescent probe in the system to generate a fluorescent signal. Moreover, as time goes by, the fluorescent signal gradually increases, and at about 30 minutes, the fluorescent signal reaches a plateau.

[0143] Figure 6 -B is the fluorescence signal intensity of different groups at the time point of 30 minutes. The results showed that there were significant differences in the fluorescence signal intensity of Cronobacter malonate and all negative controls, which verified the specificity of the constructed detection method.

[0144] Figure 8 The results of the fluorescence detection system under the irradiation of a handheld ultraviolet lamp when the CRISPR Cas12a system reacts for 60 minutes. Among them, the targets to be tested in tubes 1-7 are: Cronobacter sakazakii, Cronobacter zurichensis, Cronobacter moginsii, Escherichia coli, Staphylococcus aureus, and Salmonella, and there is no target to be tested in tube NC. The results show that only tube 2 produces visible fluorescence under ultraviolet light, which further confirms the specificity of the detection method constructed by the present invention, and the interpretation of the results does not require any instruments or equipment, only a handheld ultraviolet lamp is needed to determine the test results, which is simple and portable and suitable for field applications.

[0145] Example 6

[0146] Characterization of sensitivity test results for detecting Cronobacter malonate based on MIRA-CRISPR Cas12a fluorescence system

[0147] According to "(2)" in Example 1, different concentrations of Cronobacter malonate bacterial suspensions were prepared, and sterile enzyme-free water was used as a negative control to verify the sensitivity of the fluorescence signal readout detection system.

[0148] The experimental method refers to Example 2, different bacterial concentrations are expressed as CFU / ml and their corresponding fluorescence intensities are plotted into a graph, each data point is measured three times repeatedly, and the lowest detectable bacterial concentration is defined as the sensitivity of the detection method.

[0149] Figure 7-A is the dynamic fluorescence result of different bacterial solution concentrations measured by the microplate reader. From the overall trend analysis, the fluorescence intensity increases with time, but there are certain differences in the time when different concentrations of bacterial solution reach the plateau. For low-concentration bacterial solution, the fluorescence intensity did not reach the plateau during the entire monitoring process, which indicates that low-concentration or even low-abundance samples may require a longer incubation time. The corresponding fluorescence intensity of each concentration of bacterial solution at 30 minutes was plotted and a significance analysis was performed.

[0150] like Figure 7 -B shows that at 30 minutes, the fluorescence intensity generated by the detection system of each concentration of bacterial solution was significantly different from that of the NC group (negative control) (P < 0.05), and at 30 minutes, the concentration of bacterial solution was as low as 10 0 CFU / ml still has a high fluorescence intensity, indicating that the minimum detection limit is 10 0 CFU / ml.

[0151] Fig. 9 This is the result of the enzyme digestion system after recovery under ultraviolet light after the microplate reader is finished. The results show that compared with the high-concentration bacterial solution, the fluorescence signal generated by the low-concentration bacterial solution sample under ultraviolet light is relatively weak, and there is no target to be tested in the NC tube, and there is no fluorescence signal; after naked eye observation, the fluorescence intensity of the low-concentration bacterial solution sample is also clearly different from that of the NC group, and the test results can be accurately interpreted.

[0152] Example 7

[0153] Characterization of specific experimental results for detection of Cronobacter malonate based on MIRA-CRISPR Cas12a colloidal gold lateral flow chromatography test strip system

[0154] The specificity of the test strip signal readout detection system was verified using the existing laboratory Cronobacter sakazakii, Cronobacter zurichensis, Cronobacter moginsii, Escherichia coli, Staphylococcus aureus, and Salmonella as negative controls. The experimental method refers to "Examples 3 and 4"

[0155] Fig.10 The specificity test results of the visual test strip system are shown in Figure 1-7, where Cronobacter sakazakii, Cronobacter malonate, Cronobacter zurich, Cronobacter mogins, Escherichia coli, Salmonella, and Staphylococcus aureus are the targets to be tested, and there is no target to be tested in the NC group. The results show that the enzyme cleavage mechanism can only be activated when the target to be tested is Cronobacter malonate, the probe is cut, the test line cannot form an immunoprint, and only the quality control line appears a purple-red band, which confirms that the MIRA-CRISPR Cas12a colloidal gold lateral flow chromatography test strip detection system has high specificity.

[0156] Example 8

[0157] Characterization of sensitivity test results of detecting Cronobacter malonate based on MIRA-CRISPR Cas12a colloidal gold lateral flow chromatography test strip system:

[0158] To verify the sensitivity of the test strip visualization system, different concentrations of Cronobacter malonate bacterial suspensions were prepared according to (2) in Example 1. Different concentrations of bacterial suspensions and sterile enzyme-free water were taken as negative controls to verify the sensitivity of the test strip signal readout detection system. The experimental method was similar to that of Examples 3 and 4.

[0159] The results are as follows Fig.11 As shown, there is no target to be detected in the NC group, the probe is not cut, the gold-labeled probe is captured by the FAM antibody on the detection line, the detection line forms an immunoblot, and the result is judged as negative. After the bacterial liquid sample is amplified by MIRA, the Cas12a enzyme cleavage mechanism is activated, the probe is cut, and the detection line cannot form an immunoblot, and the result is judged as positive.

[0160] There are differences in the nucleic acid content after amplification of bacterial solutions of different concentrations, which leads to differences in the number of enzyme cleavage reactions stimulated. Under the same conditions, low-concentration bacterial solution samples stimulate less enzyme cleavage reactions, and the probe cannot be fully cut. Compared with the NC group, the detection line will show a relatively weak purple-red band.

[0161] The results showed that the detection limit of Cronobacter malonate based on MIRA-CRISPR Cas12a colloidal gold lateral flow chromatography test strip system was 10 0 CFU / ml.

[0162] SEQ NO.1: F: GACGATATTCATCTGCAAATTAACGGTGCC

[0163] SEQ NO.2: R:CATTCCGCTGTTGCTTTCAATAATCTGTAAC

[0164] SEQ NO.3: F: CATCGGCATGATTTTGTGCTTTAGGCATTG

[0165] SEQ NO.4: R:GATCTTGTGCAGTCATGGATTTCGCCCGTC

[0166] SEQ NO.5: F: AAGGTAGTGCTGGAAAACGGTGCCACAAAT

[0167] SEQ NO.6: R: CGGTGCAGAATAAAGATAAAACAGCGGATC

[0168] SEQ NO.7: F: TGATTAGCAACAGACTAAGTAACTGCCAACCG

[0169] SEQ NO.8: R:TTTCTTACCATCTCATATTTGCGCCACAGC

[0170] SEQ NO.9: CrRNA: UAAUUUCUACUAAGUGUAGAUAACUGAGCGUGAUCAACUGCC

[0171] It should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solutions of the present invention can be modified or replaced by equivalents without departing from the spirit and scope of the technical solutions of the present invention, which should all be included in the scope of the present invention.

Claims

1. A method for detecting Cronobacter malonate for non-diagnostic purposes based on the MIRA-CRISPR Cas12a system, characterized in that: include, The DNA of Cronobacter was quickly extracted by high temperature boiling method; MIRA-specific primers were used to amplify Cronobacter malonate-specific genes to obtain Cronobacter malonate-specific products that can be used in the MIRA-CRISPRCas12a system; Design of crRNA targeting Cronobacter malonate-specific products; Through the CRISPR Cas12a detection system, CrRNA targets and recognizes the Cronobacter malonate-specific product, activates the nonspecific cleavage activity of CrRNA-Cas12a, and interprets the detection results through the reporter probe labeled with FAM / BHQ1 groups at both ends to achieve rapid fluorescent visualization detection of Cronobacter malonate. The reporter probe is: 6-FAM-TTTTTTTT-BHQ-1; Among them, the MIRA-specific primer sequences are SEQ NO.1 and SEQ NO.2, and the nucleotide sequence of CrRNA is SEQ NO.

9.

2. The detection method according to claim 1, characterized in that: The high temperature boiling method is used to quickly extract Cronobacter DNA, including: Take 1 ml of fresh bacterial liquid, boil it at 100℃ for 10 minutes, lyse the bacteria and obtain genomic DNA.

3. The detection method according to claim 1, characterized in that: The fluorescent visualization rapid detection comprises: The malonate Cronus-specific product that can be used in the MIRA-CRISPR Cas12a system was added to the CRISPR Cas12a system, and the dynamic fluorescence signal of the entire reaction process was monitored by a microplate reader; When Cas12a, CrRNA, and substrate DNA are present at the same time, the nonspecific cleavage activity of Cas12a is stimulated, and the fluorescent probe is cut to produce a fluorescent signal.

4. The detection method according to claim 3, characterized in that: After the determination by the microplate reader is completed, the enzyme digestion reaction products in the 384-well plate are immediately recovered, placed in a dark environment, irradiated with a 365nm ultraviolet lamp, and the fluorescence results are observed with the naked eye.

5. A non-diagnostic detection method for Cronobacter malonate based on the MIRA-CRISPR Cas12a system, characterized in that: include, The DNA of Cronobacter was quickly extracted by high temperature boiling method; MIRA-specific primers were used to amplify Cronobacter malonate-specific genes to obtain Cronobacter malonate-specific products that can be used in the MIRA-CRISPRCas12a system; Design of crRNA targeting Cronobacter malonate-specific products; Through the CRISPR Cas12a detection system, crRNA targets and recognizes the malonate Cronus-specific product, activating the crRNA-Cas12a nonspecific cleavage activity. Visual rapid detection of Cronobacter malonate by colloidal gold lateral flow immunochromatographic test strips, with the reporter probe being 6-FAM-TTTTTTTATTTTTTT-Biotin; Among them, the MIRA-specific primer sequences are SEQ NO.1 and SEQ NO.2, and the nucleotide sequence of CrRNA is SEQ NO.

9.

6. The detection method according to claim 5, characterized in that: The colloidal gold lateral flow immunochromatographic test strip for visual rapid detection includes: The malonate Cronus-specific product of the MIRA-CRISPR Cas12a system was directly added to the CRISPR Cas12a system, incubated at room temperature, 6 μl of substrate DNA and 0.8 μl of reporter probe were added, and enzyme digestion was performed at 37 °C; After the reaction is completed, take 5 μl of the reaction product and add it to 45 μl of the test strip loading buffer. After mixing, slowly drip it onto the test strip loading area and read the result after 5 minutes.

7. The detection method according to claim 6, characterized in that: The concentration of the reporter probe is 0.4-1 nM.

8. The detection method according to claim 7, characterized in that: The concentration of the reporter probe was 0.4 nM.

9. The detection method according to claim 5, characterized in that: When the probe concentration is 0.4 nM, for 10 8 CFU / ml bacterial sample can produce accurate results within 15 minutes of enzyme digestion reaction; 0 The reaction time of the CRISPR Cas12a system for bacterial liquid samples with CFU / ml was shortened from 1.5h to 1h.

Images