Biomarkers associated with clinical outcomes following hematopoietic stem cell transplantation for acute myeloid leukemia and uses thereof
By detecting the proportion of RGS1 protein in CD3 and CD8 T cells and using single-cell sequencing technology, the problem of predicting disease relapse after hematopoietic stem cell transplantation in AML patients has been solved, enabling more accurate prognostic judgment and early intervention, and improving treatment outcomes.
Patent Information
- Application Number
- CN202410415282.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-04-08
- Publication Date
- 2026-06-26
- Estimated Expiration
- 2044-04-08
AI Technical Summary
Existing technologies are insufficient to accurately mark the disease relapse trend after hematopoietic stem cell transplantation in patients with acute myeloid leukemia (AML), leading to difficulties in prognostic prediction and a lack of effective diagnostic and prognostic biomarkers.
Using RGS1 protein as a biomarker, and employing reagents that specifically detect CD3, CD8, CD45RA, and CCR7, combined with flow cytometry, we analyzed the proportion of CD8 TEFF cells and CD3 T cells in bone marrow blood. We then used single-cell sequencing technology to identify T cell characteristics and predict post-transplant clinical outcomes.
It improves the accuracy of predicting disease relapse after transplantation in AML patients, provides opportunities for early intervention, optimizes clinical treatment strategies, and improves patient survival rates.
Smart Images

Figure CN118465265B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to biomarkers and their applications in the field of biomedicine related to clinical outcomes after hematopoietic stem cell transplantation for acute myeloid leukemia. Background Technology
[0002] Acute myeloid leukemia (AML) is a malignant proliferative disease of the hematopoietic system, characterized by the infiltration of large numbers of undifferentiated or abnormally differentiated primitive cells into the bone marrow, peripheral blood, and extramedullary tissues, impairing the patient's normal hematopoietic function and seriously endangering people's lives and health. Currently, in addition to first-line chemotherapy, allogeneic hematopoietic stem cell transplantation (Allo-HSCT) is an important means of curing AML patients. However, long-term, large-sample follow-up data shows that after fully matched / half matched human leukocyte antigen (HLA) transplantation, the 10-year cumulative relapse-related mortality rate for AML patients is 15.6% and 16.7%, respectively, accounting for 32% and 42% of all deaths, indicating that disease relapse remains a significant cause of death. In clinical diagnosis and treatment, early detection of disease relapse trends allows for effective intervention, leading to better patient prognosis. Therefore, prognostic biomarkers for AML have significant clinical application value, and there is an urgent need to discover novel prognostic biomarkers for AML in order to optimize clinical diagnosis and treatment strategies and improve patient survival rates.
[0003] Currently, the main prognostic markers for AML are: 1. AML cell-specific gene mutations: such as NPM1 (Nucleophosmin 1) mutations, FTL3-IDT mutations in the FLT3 molecule, and point mutations in the tyrosine kinase domain; 2. AML cell chromatin abnormalities: such as the PML-RARA fusion gene and the AML1-ETO fusion gene; 3. AML cell DNA methylation abnormality-related regulatory protein molecules: such as DNA demethylase TET2 and DNA methyltransferase DNMT3A; 4. AML-specific non-coding RNA molecules, all of which are intracellular molecules of AML cells. Due to the high heterogeneity of AML cells, it is difficult to accurately mark the presence of AML cells and their changes as the disease progresses, thus increasing the difficulty of predicting leukemia prognosis. Therefore, discovering potential diagnostic and prognostic markers from the immune microenvironment cell subsets outside of the patient's AML cells undoubtedly has a significant advantage: the AML immune microenvironment consists of normal cells with low heterogeneity, making them relatively easy to accurately label. However, there is still a lack of diagnostic and prognostic biomarkers for leukemia in cells other than AML cells. Therefore, it is urgent to discover novel diagnostic and prognostic biomarkers in cells other than AML cells in order to optimize clinical treatment strategies and improve the quality of life of patients. Summary of the Invention
[0004] The technical problem solved by this invention is how to diagnose and predict the clinical outcome of patients with acute myeloid leukemia after hematopoietic stem cell transplantation.
[0005] To address the above problems, the present invention provides the following applications.
[0006] The following applications of the marker or the substance that detects the marker:
[0007] A1) Application in the preparation of products for prognostic assessment and / or prediction of patients with acute myeloid leukemia after hematopoietic stem cell transplantation;
[0008] A2) Use in the preparation of products for assessing and / or diagnosing and / or assisting in the diagnosis of risks in patients with acute myeloid leukemia after hematopoietic stem cell transplantation;
[0009] A3) Application in the preparation of products for predicting the risk of relapse in patients with acute myeloid leukemia after hematopoietic stem cell transplantation;
[0010] A4) Use in the preparation of products for the diagnosis and / or auxiliary diagnosis of relapse in patients with acute myeloid leukemia after hematopoietic stem cell transplantation;
[0011] A5) Application in the preparation of products for judging and / or predicting clinical outcomes of patients with acute myeloid leukemia after hematopoietic stem cell transplantation;
[0012] The feature is that the marker is the RGS1 protein.
[0013] The hematopoietic stem cell transplantation mentioned above can be either haploidentical or fully matched.
[0014] The substance includes reagents for the specific detection of the RGS1 protein. These reagents include antibodies or aptamers that specifically bind to the RGS1 protein. The substance may also include reagents for the specific detection of CD3, CD8, CD45RA, and CCR7. These reagents may include antibodies or aptamers that specifically bind to CD3, CD8, CD45RA, and CCR7.
[0015] The substance may also include reagents used in flow cytometry and / or flow cytometry.
[0016] The RGS1 protein may be any of the following proteins:
[0017] B1) The amino acid sequence is the same as sequence 2 of the protein;
[0018] B2) A protein having more than 80% identity and the same function as the protein shown in B1) obtained by substituting and / or deleting and / or adding amino acid residues.
[0019] B3) A fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of B1) or B2).
[0020] The inclusion criteria for acute myeloid leukemia (AML) mentioned above are as follows: patients diagnosed with acute myeloid leukemia (FAB classification: non-acute promyelocytic leukemia M3) by bone marrow examination according to the World Health Organization (WHO) criteria.
[0021] The hematopoietic stem cell transplantation mentioned above can be either haploidentical or fully matched.
[0022] The substance mentioned above may be a reagent used for RGS1 protein content (i.e., CD8 TEFF cells in bone marrow blood).
[0023] In the above text, the substance mentioned can be any substance that detects the amount of intermediate products produced during the expression of the RGS1 protein-coding gene into a protein. Specifically, the intermediate products can be any of the following:
[0024] 1) RGS1 gene transcript;
[0025] 2) Primary transcripts of the RGS1 gene;
[0026] 3) Intermediate transcripts of the RGS1 gene;
[0027] 4) Reverse transcript of RGS1 gene mRNA.
[0028] In the above applications, the substances used to detect the expression level of RGS1 protein may include methods such as enzyme-linked immunosorbent assay (ELISA), immunofluorescence assay, radioimmunoassay, immunoprecipitation assay, Western blotting, high performance liquid chromatography (HPLC), capillary gel electrophoresis, near-infrared spectroscopy, mass spectrometry, immunochemiluminescence assay, colloidal gold immunochromatography, fluorescence immunochromatography, surface plasmon resonance (SPR), immuno-PCR, or biotin-avidin assay to measure the RGS1 protein content.
[0029] In the above text, the test sample for the product may be bone marrow blood.
[0030] In the above text, the product may be a reagent, reagent kit, chip, or device.
[0031] The prognosis mentioned above can be used to predict relapse in patients with acute myeloid leukemia after hematopoietic stem cell transplantation.
[0032] The risks described in A2) above may be patients with relapsed acute myeloid leukemia (AML) after hematopoietic stem cell transplantation or patients with acute myeloid leukemia (AML) in remission after hematopoietic stem cell transplantation.
[0033] The inclusion criteria for patients with relapsed acute myeloid leukemia (AML) after hematopoietic stem cell transplantation, as stated above, are as follows:
[0034] Patients with AML who underwent their first hematologic relapse more than one year after transplantation and were included in this center from September 2021 to the present.
[0035] Among them, the diagnostic criteria for AML recurrence are:
[0036] According to the "Guidelines for the Diagnosis and Treatment of Relapsed / Refractory Acute Myeloid Leukemia in China (2023 Edition)," the presence of leukemia cells in the peripheral blood or ≥5% of primitive cells in the bone marrow after complete remission (CR) of AML is considered a sign of leukemia.
[0037] Inclusion criteria for patients with relapsed acute myeloid leukemia (AML) after treatment (also known as relapsed patients):
[0038] According to the "Guidelines for the Diagnosis and Treatment of Relapsed and Refractory Acute Myeloid Leukemia in China (2023 Edition)," acute myeloid leukemia (AML) is defined as AML that has been diagnosed as AML according to the inclusion criteria. After complete remission (CR) of AML, leukemia cells reappear in the peripheral blood, ≥5% of primitive cells in the bone marrow (excluding other causes such as bone marrow regeneration after consolidation chemotherapy), or leukemia cell infiltration appears in the extramedullary space.
[0039] Complete remission was defined as meeting the following criteria: bone marrow smear showed a blast cell percentage of <5%; peripheral blood smear showed no blast cells; no Auer bodies were found in the blast cells; there were no extramedullary lesions; and the absolute neutrophil count in peripheral blood was >1.0 × 10⁻⁶. 9 / L (1000 / μL); peripheral blood platelet count >100×10 9 / L (100,000 / μL); not dependent on red blood cell transfusion.
[0040] In the above text, the treatment mentioned refers to hematopoietic stem cell transplantation. Hematopoietic stem cell transplantation can be either haploidentical or fully matched.
[0041] In the above text, complete remission of AML is defined as having 5% or less of blast cells in the bone marrow.
[0042] In the above criteria, the diagnosis time for relapsed patients is one month or more after treatment. The age of relapsed patients is 21-60 years.
[0043] In the above criteria, the diagnosis time for relapsed patients is 1-5 months after treatment. The age range for relapsed patients is 23-55 years.
[0044] Inclusion criteria for patients with acute myeloid leukemia (AML) who have achieved remission after treatment (also known as patients in remission):
[0045] Patients diagnosed with acute myeloid leukemia (AML) according to the inclusion criteria and achieving complete remission after treatment are considered to have AML. Complete remission is defined as meeting the following criteria: bone marrow smear showing <5% blast cells; no blast cells observed in peripheral blood smears; no Auer bodies among blast cells; no extramedullary lesions; and an absolute neutrophil count >1.0 × 10⁻⁶ in peripheral blood. 9 / L (1000 / μL); peripheral blood platelet count >100×10 9 / L (100,000 / μL); not dependent on red blood cell transfusion.
[0046] In the above text, the treatment mentioned refers to hematopoietic stem cell transplantation. Hematopoietic stem cell transplantation can be either haploidentical or fully matched.
[0047] In the above text, complete remission of AML is defined as having 5% or less of blast cells in the bone marrow.
[0048] In the above criteria, the diagnostic time for remission is 1-4 months after treatment. Patients in remission are aged 17-60 years.
[0049] In the above criteria, the diagnostic time for remission is one month or more after treatment. Patients in remission are aged 22-63 years.
[0050] In the above applications, the substance is a reagent used to detect the RGS1 protein on the cell peripheral membrane as described above.
[0051] The cells mentioned above are CD8 TEFF cells.
[0052] In the above text, the substance may be RGS1-PE. RGS1-PE may be an RGS1 antibody coupled with PE / R-Phycoerythrin.
[0053] In the above text, the RGS1 antibody was purchased from Abcam, catalog number ab154973; the PE / R-Phycoerythrin was purchased from Abcam, catalog number ab102918.
[0054] In the above text, the preparation of the RGS1 antibody coupled with PE / R-Phycoerythrin was carried out in accordance with the operation manual provided by the PE / R-Phycoerythrin Conjugation Kit (catalog number ab102918).
[0055] In the above applications, the product is a reagent, reagent kit, chip, or device. Summary of the Invention:
[0057] The kit may contain the aforementioned substance.
[0058] In any of the applications described above, the test sample for the product is a bone marrow mononuclear cell.
[0059] In the above applications, the bone marrow mononuclear cells are at least one of CD8 TEFF cells, CD8 T cells, or CD3 T cells.
[0060] The CD8 TEFF cells can be CD3+CD8+CD45RA+CCR7- T cells. The CD3+CD8+CD45RA+CCR7- T cells can be T cells that are positive for CD3, CD8, and CD45RA and negative for CCR7. The CD8 TEFF cells are derived from bone marrow mononuclear cells.
[0061] To address the above problems, the present invention also provides a composition.
[0062] The composition contains the above-mentioned substances, and the composition has at least one of the following uses:
[0063] A1) Application in the preparation of products for prognostic assessment and / or prediction of patients with acute myeloid leukemia after hematopoietic stem cell transplantation;
[0064] A2) Use in the preparation of products for assessing and / or diagnosing and / or assisting in the diagnosis of risks in patients with acute myeloid leukemia after hematopoietic stem cell transplantation;
[0065] A3) Application in the preparation of products for predicting the risk of relapse in patients with acute myeloid leukemia after hematopoietic stem cell transplantation;
[0066] A4) Use in the preparation of products for the diagnosis and / or auxiliary diagnosis of relapse in patients with acute myeloid leukemia after hematopoietic stem cell transplantation;
[0067] A5) Application in the preparation of products for judging and / or predicting clinical outcomes of patients with acute myeloid leukemia after hematopoietic stem cell transplantation.
[0068] The hematopoietic stem cell transplantation mentioned above can be either haploidentical or fully matched.
[0069] To address the aforementioned problems, the present invention also provides a reagent kit.
[0070] The kit comprises the above-described composition and has at least one of the following uses:
[0071] A1) Application in the preparation of products for prognostic assessment and / or prediction of patients with acute myeloid leukemia after hematopoietic stem cell transplantation;
[0072] A2) Use in the preparation of products for assessing and / or diagnosing and / or assisting in the diagnosis of risks in patients with acute myeloid leukemia after hematopoietic stem cell transplantation;
[0073] A3) Application in the preparation of products for predicting the risk of relapse in patients with acute myeloid leukemia after hematopoietic stem cell transplantation;
[0074] A4) Use in the preparation of products for the diagnosis and / or auxiliary diagnosis of relapse in patients with acute myeloid leukemia after hematopoietic stem cell transplantation;
[0075] A5) Application in the preparation of products for judging and / or predicting clinical outcomes of patients with acute myeloid leukemia after hematopoietic stem cell transplantation.
[0076] The hematopoietic stem cell transplantation mentioned above can be either haploidentical or fully matched.
[0077] The above-mentioned application of RGS1 protein as a target in the preparation of drugs for the treatment of patients with acute myeloid leukemia after hematopoietic stem cell transplantation.
[0078] To address the aforementioned problems, the present invention also provides a computer-readable storage medium storing a computer program.
[0079] The computer program causes the computer to perform the following steps:
[0080] 1) Obtain the ratio of RGS1+CD8 TEFF cells / CD8 TEFF cells, the ratio of RGS1+CD8 T cells / CD8 T cells, and / or the ratio of RGS1+CD3 T cells / CD3 T cells in the subjects;
[0081] 2) Based on the stated ratios, the risk of hematopoietic stem cell transplantation in patients with acute myeloid leukemia is assessed and / or diagnosed and / or assisted in diagnosis; the RGS1+CD8 TEFF cell / CD8 TEFF cell ratio is the ratio of the number of RGS1+CD8 TEFF cells to the number of CD8 TEFF cells in bone marrow mononuclear cells, the RGS1+CD8 T cell / CD8 T cell ratio is the ratio of the number of RGS1+CD8 T cells to the number of CD8 T cells in bone marrow mononuclear cells, and the RGS1+CD3 T cell / CD3 T cell ratio is the ratio of the number of RGS1+CD3 T cells to the number of CD3 T cells in bone marrow mononuclear cells; the CD8 TEFF cells are lymphocytes that are positive for CD3, CD8, and CD45RA and negative for CCR7, and the RGS1+CD8 TEFF cells are... TEFF cells are lymphocytes that are positive for CD3, CD8, CD45RA, and RGS1 and negative for CCR7. RGS1+CD8 T cells are lymphocytes that are positive for CD3, CD8, and RGS1. CD8 T cells are lymphocytes that are positive for CD3 and CD8. RGS1+CD3 T cells are lymphocytes that are positive for both CD3 and RGS1. CD3 T cells are lymphocytes that are positive for CD3.
[0082] To address the above problems, the present invention also provides an apparatus.
[0083] The device has at least one of the following uses:
[0084] (B1) Prognosis and / or assessment and / or diagnosis and / or auxiliary diagnosis of the risk of hematopoietic stem cell transplantation in patients with acute myeloid leukemia;
[0085] (B2) Predicting the risk of relapse in patients with acute myeloid leukemia after hematopoietic stem cell transplantation;
[0086] (B3) Diagnosis and / or auxiliary diagnosis of whether acute myeloid leukemia patients have relapsed after hematopoietic stem cell transplantation;
[0087] (B4) To assess and / or predict the clinical outcome of patients with acute myeloid leukemia after hematopoietic stem cell transplantation;
[0088] The device is characterized by comprising:
[0089] M1) RGS1+CD8TEFF cell / CD8TEFF cell ratio, and / or RGS1+CD8 T cell / CD8 T cell ratio, and / or RGS1+CD3 T cell / CD3 T cell ratio acquisition module: used to acquire the RGS1+CD8TEFF cell / CD8TEFF cell ratio, and / or RGS1+CD8T cell / CD8 T cell ratio, and / or RGS1+CD3 T cell / CD3 T cell ratio as stated by the subject;
[0090] M2) Prognostic module: Used to predict the prognosis of patients with acute myeloid leukemia after hematopoietic stem cell transplantation based on the ratio of RGS1+CD8 TEFF cells / CD8 TEFF cells, and / or the ratio of RGS1+CD8 T cells / CD8 T cells, and / or the ratio of RGS1+CD3 T cells / CD3 T cells.
[0091] The ratios are the ratio of the number of RGS1+CD8TEFF cells to the number of CD8TEFF cells in bone marrow mononuclear cells, and / or the ratio of the number of RGS1+CD8 T cells to the number of CD8 T cells in bone marrow mononuclear cells, and / or the ratio of the number of RGS1+CD3 T cells to the number of CD3 T cells in bone marrow mononuclear cells. The CD8 TEFF cells are lymphocytes that are positive for CD3, CD8, and CD45RA and negative for CCR7. The RGS1+CD8TEFF cells are lymphocytes that are positive for CD3, CD8, CD45RA, and RGS1 and negative for CCR7. The RGS1+CD8 T cells are lymphocytes that are positive for CD3, CD8, and RGS1. The CD8 T cells are lymphocytes that are positive for CD3 and CD8. The RGS1+CD3 T cells are lymphocytes that are positive for both CD3 and RGS1. The CD3 T cells are CD3-positive lymphocytes.
[0092] The hematopoietic stem cell transplantation mentioned above can be either haploidentical or fully matched.
[0093] To address the aforementioned problems, the present invention also provides the application of biomarkers or related biomaterials.
[0094] The biomarker is the RGS1 protein, and the application is any of the following:
[0095] A1) The use of proteins or biomaterials related to said proteins in enhancing the killing power of effector T cells against human monocytic leukemia cells;
[0096] A2) The use of proteins or biomaterials related to said proteins in products that enhance the killing power of effector T cells against human monocytic leukemia cells;
[0097] The biomaterial is any one of the following:
[0098] B1) Nucleic acid molecules encoding the protein;
[0099] B2), an expression cassette containing the nucleic acid molecule described in B1);
[0100] B3), a recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2);
[0101] B4) Recombinant microorganisms containing the nucleic acid molecules described in B1), or recombinant microorganisms containing the expression cassette described in B2), or recombinant microorganisms containing the recombinant vector described in B3). Summary of the Invention:
[0103] In the above text, the RGS1 protein is any one of the following proteins:
[0104] B1) The amino acid sequence is the same as sequence 2 of the protein;
[0105] B2) A protein having more than 80% identity and the same function as the protein shown in B1) obtained by substituting and / or deleting and / or adding amino acid residues.
[0106] B3) A fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of B1) or B2);
[0107] In the above text, the lethality is reflected by the level of cytokines, namely CD107a, GZNB, perforin, IFN-γ and / or KI67.
[0108] The recombinant microorganism mentioned above can be a recombinant virus. Specifically, it can be an RGS1 overexpressing lentivirus. The RGS1 overexpressing lentivirus and the negative control lentivirus were purchased from Sangon Biotech (Shanghai) with catalog number SGXM2022LA881.
[0109] The hematopoietic stem cell transplantation mentioned above can be either haploidentical or fully matched.
[0110] In the above text, the effector T cells are CD3 T cells.
[0111] In the above text, the substance regulating gene expression can be a substance that performs at least one of the following six types of regulation: 1) regulation at the transcriptional level of the gene; 2) post-transcriptional regulation of the gene (i.e., regulation of splicing or processing of the primary transcript of the gene); 3) regulation of RNA transport of the gene (i.e., regulation of mRNA transport of the gene from the nucleus to the cytoplasm); 4) regulation of translation of the gene; 5) regulation of mRNA degradation of the gene; and 6) post-translational regulation of the gene (i.e., regulation of the activity of the protein translated from the gene).
[0112] In the nucleic acid molecule described in B1), those skilled in the art can easily mutate the nucleotide sequence encoding the protein RGS1 of the present invention using known methods, such as directed evolution or point mutation. Those artificially modified nucleotides that have 80% or more of the same nucleotide sequence as the protein RGS1 isolated in the present invention, as long as they encode and function as protein RGS1, are derived from and equivalent to the nucleotide sequence of the present invention.
[0113] The aforementioned 80% or higher identity can be 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%.
[0114] In this article, identity refers to the similarity of amino acid or nucleotide sequences. The identity of amino acid sequences can be determined using homology search sites on the internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, using blastp as the procedure, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values) respectively, and performing a search to calculate the identity of amino acid sequences, then the identity value (%) can be obtained.
[0115] The hematopoietic stem cell transplantation mentioned above can be either haploidentical or fully matched.
[0116] In the above text, the effector T cells are CD3 T cells.
[0117] Beneficial effects
[0118] This invention discloses biomarkers related to clinical outcomes after hematopoietic stem cell transplantation for acute myeloid leukemia and their applications, specifically relating to the biomedical field.
[0119] Regulator of G-protein Signaling 1 (RGS1) belongs to the G protein family of signaling regulators and negatively regulates the signal transduction of G protein-coupled receptors (GPCRs). RGS1 is expressed in various immune cells, such as monocytes, NK cells, dendritic cells, CD4+ T cells, and CD8+ T cells, playing different roles. Our team found that the expression level of RGS1 in T lymphocytes differed significantly between AML patients who responded to or relapsed after HSCT treatment, suggesting it could serve as a potential prognostic biomarker for AML. Furthermore, T lymphocytes with high RGS1 expression secreted more cytotoxic factors and exhibited stronger anti-tumor effects, suggesting that RGS1 could also be a potential target for cellular immunotherapy.
[0120] Previous studies have mainly focused on comparing T cell populations in AML patients who have relapsed or are in remission after hematopoietic stem cell transplantation using flow cytometry. The results showed no significant difference in the proportions of different T cell subsets between relapsed and remission patients. This suggests that cellular-level classification analysis based on limited molecules is unsuitable for analyzing the classification and characteristics of T cells after AML transplantation. Such methods are insufficient for screening specific functional populations and characteristic molecules of T cells in relapsed / remission patients after transplantation. Higher-resolution molecular-level techniques are needed to address this issue. Considering the large and highly heterogeneous T cell population in the bone marrow of AML patients after transplantation, the rapidly developing single-cell sequencing technology is undoubtedly the best solution. Currently, single-cell sequencing technology has been widely used in hematological disease research, such as: (1) identifying AML cells with immunosuppressive properties; (2) analyzing the clonal heterogeneity of AML cells; (3) elucidating new mechanisms of clonal evolution and drug resistance in hematological cells; (4) identifying new targets for AML treatment; and (5) elucidating the heterogeneity of NK cells under AML disease conditions. In summary, using single-cell sequencing technology to identify the characteristics of T cells after AML transplantation is both cutting-edge and feasible.
[0121] This invention, through detection, found that: if the proportion of RGS1+CD3 T cells among CD3 T cells in the bone marrow mononuclear cells of the tested subject is greater than or equal to 8.8%, the tested subject is an acute myeloid leukemia (AML) patient in remission after haploidentical or fully matched hematopoietic stem cell transplantation; if the proportion of RGS1+CD3 T cells among CD3 T cells in the bone marrow mononuclear cells of the tested subject is less than or equal to 8.8%, the tested subject is a candidate for acute myeloid leukemia (AML) patient in relapse after haploidentical or fully matched hematopoietic stem cell transplantation. If the percentage of RGS1+CD8 T cells in CD8 T cells of the bone marrow mononuclear cells of the tested subject is greater than or equal to 5.28%, the tested subject is an acute myeloid leukemia (AML) patient in remission after haploidentical or fully matched hematopoietic stem cell transplantation. If the percentage of RGS1+CD8 T cells in CD8 T cells of the bone marrow mononuclear cells of the tested subject is less than or equal to 5.28%, the tested subject is a candidate for acute myeloid leukemia (AML) patient in relapse after haploidentical or fully matched hematopoietic stem cell transplantation. If the proportion of RGS1+CD8 TEFF cells among CD8 TEFF cells in the bone marrow blood of the tested subject is greater than or equal to 20.9%, the tested subject is an acute myeloid leukemia (AML) patient in remission after haploidentical or fully matched hematopoietic stem cell transplantation. If the proportion of RGS1+CD8 TEFF cells among CD8 TEFF cells in the bone marrow blood of the tested subject is less than or equal to 20.9%, the tested subject is a candidate for acute myeloid leukemia (AML) patient who has relapsed after haploidentical or fully matched hematopoietic stem cell transplantation.
[0122] By overexpressing the RGS1 gene in CD3 T cells, it was found that CD3 T cells overexpressing the RGS1 gene significantly increased various cell-killing effector factors when fighting tumor cells THP-1. Attached Figure Description
[0123] Figure 1 The first image uses UMAP (Uniform Manifold Approximation and Projection) dimensionality reduction analysis (assuming the data samples are uniformly distributed in the topological space, approximating and mapping these data samples to a low-dimensional space to achieve visualization) to generate a dimensionality reduction clustering diagram (A) of CD3 T cell single-cell sequencing results of AML patients in relapse and remission after hematopoietic stem cell transplantation. The horizontal and vertical axes are the two-dimensional coordinates after UMAP dimensionality reduction, respectively. The second image uses a bar chart (B) showing the proportion of different T cell populations. The vertical axis represents the proportion of cell populations in the relapse / remission samples, and the horizontal axis represents the cell population type.
[0124] Figure 2The first image shows CD8 TEFF cell populations in AML patients who relapsed and were in remission after hematopoietic stem cell transplantation using UMAP (A), with the x and y axes representing two-dimensional coordinates after UMAP dimensionality reduction; and the second image shows a bar chart of the proportion of different cell populations (B), with the y axis representing cell population type and the x axis representing the proportion of cell population in the relapse / remission samples.
[0125] Figure 3 yes Figure 2 A CD8 TEFF cell cluster diagram (A); and a distribution map of high gene expression in subpopulation C4 (i.e., RGS1+ subpopulation) (B), with the horizontal and vertical axes being two-dimensional coordinates after UMAP dimensionality reduction.
[0126] Figure 4 This is a flow cytometry plot of RGS1+CD8 TEFF cells (A), RGS1+CD8 T cells (B), and RGS1+CD3 T cells (C) in 20 AML patients who relapsed after hematopoietic stem cell transplantation and 20 patients in remission. The vertical axis represents the percentage of RGS1-positive cells in the corresponding cell populations, and the horizontal axis represents the patient type: relapsed patients, remission patients; and the percentage of RGS1-positive cells in CD8 TEFF, CD8 T, and CD3 T cells. Figure 4 The ROC curve in D) is shown, where the vertical axis represents sensitivity and the horizontal axis represents 1-specificity. (The t-test is used in the figure to test the significance of the differences in the data, where P-value < 0.0001 is marked as **** and P-value < 0.001 is marked as ***).
[0127] Figure 5 This is a flow cytometry plot of RGS1+CD8 TEFF cells (A), RGS1+CD8 T cells (B), and RGS1+CD3 T cells (C) in 19 AML patients 1–4 months after hematopoietic stem cell transplantation. The vertical axis represents the percentage of RGS1-positive cells in the corresponding cell populations, and the horizontal axis represents the patient prognostic outcomes as of mid-January 2024: relapsed patients and remission patients. ROC curves of RGS1-positive cells in CD8TEFF (D), CD8 T (E), and CD3 T (F) are also shown, with the vertical axis representing sensitivity and the horizontal axis representing 1-specificity. (The t-test was used to examine the significance of the data, with P-value < 0.05 marked as * and P-value < 0.01 marked as **).
[0128] Figure 6The flow cytometry results are as follows: (A) shows the expression of CD107a and Ki67 and the secretion of GZMB, perforin, and IFN-γ factors in RGS1+ and RGS1-CD3 T cells after co-culturing CD3 T cells from healthy donors with the tumor cell line THP-1. The vertical axis represents FSC-A, which is the area value of the forward scattered electrical pulse signal during flow cytometry, representing the cell volume, and the horizontal axis represents the staining status of the corresponding factor in flow cytometry. (B) shows the statistical results of the flow cytometry results. The vertical axis represents the percentage of cells positive for the corresponding factor, and the horizontal axis represents the corresponding factor.
[0129] Figure 7 The first image shows the flow cytometry quality control results of CD3 T cells overexpressing RGS1 from healthy donors (A), with the ordinate representing the percentage of positive RGS1 in CD3 T cells and the abscissa representing different experimental conditions; the second image shows the flow cytometry results of CD3 T cells overexpressing RGS1 after co-culturing with tumor cells THP-1 (B), with the ordinate representing FSC-A, i.e., the area value of the forward scattering electrical pulse signal during flow cytometry, representing cell volume, and the abscissa representing the staining status of the corresponding factor in flow cytometry; and the third image shows the flow cytometry results of CD3 T cells overexpressing RGS1 after co-culturing with tumor cells THP-1 (C), with the ordinate representing the percentage of positive cells for the corresponding factor and the abscissa representing the different factors detected. (The t-test was used in the figure to test the significance of the differences in the data, where P-value < 0.0001 was marked as **** and P-value < 0.001 was marked as ***). Detailed Implementation
[0130] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.
[0131] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.
[0132] The following examples used SPSS 11.5 statistical software to process the data. The experimental results are expressed as mean ± standard deviation. One-way ANOVA was used. P < 0.05 (*) indicates a significant difference, P < 0.01 (**) indicates a highly significant difference, and P < 0.001 (***) indicates a highly significant difference.
[0133] Bone marrow mononuclear cell extraction: After centrifuging whole blood (1500 rpm, 5 min), remove the supernatant plasma; take 4 mL of human leukocyte separation solution and place it in a 15 mL centrifuge tube, dilute the blood cells with PBS and place them on the supernatant of human leukocyte separation solution; after centrifugation (1800 rpm, 18 min, brake off), take the middle mononuclear cell layer and count them.
[0134] Mononuclear cell cryopreservation and resuscitation: Primary cells from patients were cryopreserved using serum-free cryopreservation solution and transferred to liquid nitrogen for storage. After the patient was diagnosed with AML, the cells were resuscitated in a 37°C water bath and transferred to a preheated 37°C resuscitation solution (IMDM with 10% BIT and DNase).
[0135] Example 1
[0136] Patients and Samples
[0137] For single-cell sequencing:
[0138] From September 2021 to April 2022, bone marrow blood was collected from two paired patients with acute myeloid leukemia (AML) who had relapsed or were in remission after haploidentical hematopoietic stem cell transplantation at the Department of Hematology, Peking University People's Hospital (details are shown in Table 1). Mononuclear cell extraction was performed on the bone marrow blood, CD3+ T cells were sorted using flow cytometry, and single-cell sequencing and analysis were conducted. In accordance with the Declaration of Helsinki, all samples were collected from residual tissue after medical testing, and informed consent was obtained from all donors.
[0139] Inclusion criteria for acute myeloid leukemia (AML):
[0140] The diagnostic criteria for AML refer to the WHO 2016 classification of tumors of hematopoietic and lymphoid tissues, or, any of the following criteria must be met for a diagnosis of acute myeloid leukemia (AML):
[0141] 1. Peripheral blood or bone marrow blast cells ≥20%;
[0142] 2. Patients are confirmed to have clonal recurrent cytogenetic abnormalities t(8;21)(q22;q22), inv(16)(p13q22), or t(16;16)(p13;q22) and t(15;17)(q22;q12), even if the number of primitive cells is <20%.
[0143] This embodiment includes patients aged 16-60 years who meet the above diagnostic criteria for AML, and who are newly diagnosed AML patients who have not received previous treatment and whose FAB classification is non-acute promyelocytic leukemia (non-M3), i.e. AML patients other than those with the M3 classification.
[0144] If the diagnostic criteria for AML are met, AML can be classified into the following types according to the FAB classification:
[0145] Acute myeloid leukemia, undifferentiated type (M0): Bone marrow characteristics include: absence of azurophilic granules and Auer bodies; MPO and Sudan Black B positive cells <3%; CD33 and CD13 positive; negative for lymphocyte antigen and platelet antigen. Acute myeloid leukemia, undifferentiated type (M1): Myeloblasts account for >90% of non-erythroid nucleated cells (NECs), of which MPO positive cells >3%.
[0146] Partially differentiated acute myeloid leukemia (M2): promyelocytes account for 30%–89% of NEC, other granulocytes > / = 10%, and monocytes <20%.
[0147] Acute promyelocytic leukemia (M3) (APL): Promyelocytic cells account for ≥30% of NEC.
[0148] Acute myeloid-monocytic leukemia (M4): granulocytes > / = 20% and monocytes > / = 20% at all stages.
[0149] Acute monocytic leukemia (M5): Monocytic and promonocytes account for ≥30% of NEC, and monocytic, promonocytes and monocytic cells account for ≥80%.
[0150] Acute erythroleukemia (M6): Nucleated red blood cells > / = 50%, and primitive cells account for > / = 30% of NEC.
[0151] Acute megakaryocytic leukemia (M7): primitive megakaryocytes > / = 30%, platelet antigen positive, platelet peroxidase positive.
[0152] Patient 1: WZH, male, 16 years old, diagnosed with acute myeloid leukemia, FAB classification M2: acute granulocytic partially differentiated leukemia.
[0153] Patient 2: ZSL, male, 45 years old, diagnosed with acute myeloid leukemia, FAB classification M2: acute granulocytic partially differentiated leukemia.
[0154] Patient 3: CJ, male, 19 years old, diagnosed with acute myeloid leukemia, FAB classification M2: acute granulocytic partially differentiated leukemia.
[0155] Patient 4: LHF, male, 47 years old, diagnosed with acute myeloid leukemia, FAB classification M2: acute granulocytic partially differentiated leukemia.
[0156] Patient 1 received a haploidentical hematopoietic stem cell transplant in June 2020. Patient 2 received a haploidentical hematopoietic stem cell transplant in December 2020. Patient 3 received a haploidentical hematopoietic stem cell transplant in August 2019. Patient 4 received a haploidentical hematopoietic stem cell transplant in April 2021.
[0157] Inclusion criteria for patients with relapsed acute myeloid leukemia (AML) after treatment (also known as relapsed patients):
[0158] According to the "Guidelines for the Diagnosis and Treatment of Relapsed and Refractory Acute Myeloid Leukemia in China (2023 Edition)," acute myeloid leukemia (AML) is defined as AML that has been diagnosed as AML according to the inclusion criteria. After complete remission (CR) of AML, leukemia cells reappear in the peripheral blood, ≥5% of primitive cells in the bone marrow (excluding other causes such as bone marrow regeneration after consolidation chemotherapy), or leukemia cell infiltration appears in the extramedullary space.
[0159] Complete remission was defined as meeting the following criteria: bone marrow smear showed a blast cell percentage of <5%; peripheral blood smear showed no blast cells; no Auer bodies were found in the blast cells; there were no extramedullary lesions; and the absolute neutrophil count in peripheral blood was >1.0 × 10⁻⁶. 9 / L (1000 / μL); peripheral blood platelet count >100×10 9 / L (100,000 / μL); not dependent on red blood cell transfusion.
[0160] In the above text, the treatment mentioned is hematopoietic stem cell transplantation. Hematopoietic stem cell transplantation is haploidentical hematopoietic stem cell transplantation.
[0161] In the above text, complete remission of AML is defined as having 5% or less of blast cells in the bone marrow.
[0162] In the above text, the diagnostic criteria for relapse patients are defined as those diagnosed more than one year after treatment.
[0163] In the above text, the relapsed patients were aged 16-45 years. Specifically, 16 years and 45 years old.
[0164] Inclusion criteria for patients with acute myeloid leukemia (AML) who have achieved remission after treatment (also known as patients in remission):
[0165] Patients diagnosed with acute myeloid leukemia (AML) according to the inclusion criteria and achieving complete remission after treatment are considered to have AML. Complete remission is defined as meeting the following criteria: bone marrow smear showing <5% blast cells; no blast cells observed in peripheral blood smears; no Auer bodies among blast cells; no extramedullary lesions; and an absolute neutrophil count >1.0 × 10⁻⁶ in peripheral blood. 9 / L (1000 / μL); peripheral blood platelet count >100×10 9 / L (100,000 / μL); not dependent on red blood cell transfusion.
[0166] In the above text, the treatment mentioned is hematopoietic stem cell transplantation. Hematopoietic stem cell transplantation is haploidentical hematopoietic stem cell transplantation.
[0167] In the above text, complete remission of AML is defined as having 5% or less of blast cells in the bone marrow.
[0168] In the above text, the diagnostic time for remission in the judgment criteria is more than one year after treatment.
[0169] In the above text, the patients in remission were aged 19-47 years. Specifically, 19 years old and 47 years old.
[0170] In this application, the time frame of patients with acute myeloid leukemia (AML) who have achieved remission after haploidentical hematopoietic stem cell transplantation (referred to as remission patients in this application) is compared with that of patients who have relapsed.
[0171] Patients who were in remission after transplantation and matched with patients who had experienced their first hematologic relapse more than one year after transplantation during the period from June 2020 to April 2022 were included in this study. (Matching refers to patients with the same gender, disease type, transplant type (half-matched / fully matched), graft source (bone marrow / peripheral blood), and conditioning regimen; and patients of similar age).
[0172] Patient 1: WZH, was diagnosed with AML in August 2019, underwent haploidentical hematopoietic stem cell transplantation in June 2020, and relapsed in December 2021 (collection date was December 2021).
[0173] Patient 2: ZSL, diagnosed with AML in May 2020, underwent haploidentical hematopoietic stem cell transplantation in December 2020, and relapsed in March 2022 (collection date: March 2022).
[0174] Patient 3: CJ, was diagnosed with AML in March 2019 and underwent haploidentical hematopoietic stem cell transplantation in August 2019. She was in remission as of the sample collection date (December 15, 2021).
[0175] Patient 4: LHF, diagnosed with AML in September 2020, underwent haploidentical hematopoietic stem cell transplantation in April 2021, and was in remission as of the sample collection date (April 7, 2022).
[0176] Table 1
[0177]
[0178] For clinical testing:
[0179] 1. Used for clinical diagnostic verification
[0180] From May 2021 to August 2023 (sampling times in Table 2), bone marrow samples were collected from 20 patients with acute myeloid leukemia (AML) who had relapsed or were in remission after hematopoietic stem cell transplantation at the Department of Hematology, Peking University People's Hospital (details are shown in Table 2). Mononuclear cells were extracted from the bone marrow, and the expression of RGS1 in CD8 TEFF, CD8 T, and CD3 T cells was detected using flow cytometry. In accordance with the Declaration of Helsinki, all samples were collected from residual tissue after medical testing, and informed consent was obtained from all donors. Patients in Table 2 were diagnosed as remission or relapsed at the times specified in Table 2 for relapsed / remission patients and their diagnosis dates. The diagnostic methods are detailed below.
[0181] Patients with acute myeloid leukemia (AML) listed in Table 2 were diagnosed with AML according to the inclusion criteria for AML. The inclusion criteria for AML are as described above.
[0182] Inclusion criteria for patients with relapsed acute myeloid leukemia (AML) after treatment (also known as relapsed patients):
[0183] According to the "Guidelines for the Diagnosis and Treatment of Relapsed and Refractory Acute Myeloid Leukemia in China (2023 Edition)," acute myeloid leukemia (AML) is defined as AML that has been diagnosed as AML according to the inclusion criteria. After complete remission (CR) of AML, leukemia cells reappear in the peripheral blood, ≥5% of primitive cells in the bone marrow (excluding other causes such as bone marrow regeneration after consolidation chemotherapy), or leukemia cell infiltration appears in the extramedullary space.
[0184] Complete remission was defined as meeting the following criteria: bone marrow smear showed a blast cell percentage of <5%; peripheral blood smear showed no blast cells; no Auer bodies were found in the blast cells; there were no extramedullary lesions; and the absolute neutrophil count in peripheral blood was >1.0 × 10⁻⁶. 9 / L (1000 / μL); peripheral blood platelet count >100×10 9 / L (100,000 / μL); not dependent on red blood cell transfusion.
[0185] In the above text, the treatment mentioned refers to hematopoietic stem cell transplantation. Hematopoietic stem cell transplantation can be either haploidentical or fully matched.
[0186] In the above text, complete remission of AML is defined as having 5% or less of blast cells in the bone marrow.
[0187] In the above criteria, the diagnosis time for patients with relapse is one month or more after treatment.
[0188] In the above text, the relapsed patients were aged 21-60 years. See Table 2 for details.
[0189] Inclusion criteria for patients with acute myeloid leukemia (AML) who have achieved remission after treatment (also known as patients in remission):
[0190] Patients diagnosed with acute myeloid leukemia (AML) according to the inclusion criteria and achieving complete remission after treatment are considered to have AML. Complete remission is defined as meeting the following criteria: bone marrow smear showing <5% blast cells; no blast cells observed in peripheral blood smears; no Auer bodies among blast cells; no extramedullary lesions; and an absolute neutrophil count >1.0 × 10⁻⁶ in peripheral blood. 9 / L (1000 / μL); peripheral blood platelet count >100×10 9 / L (100,000 / μL); not dependent on red blood cell transfusion.
[0191] In the above text, the treatment mentioned refers to hematopoietic stem cell transplantation. Hematopoietic stem cell transplantation can be either haploidentical or fully matched.
[0192] In the above text, complete remission of AML is defined as having 5% or less of blast cells in the bone marrow.
[0193] In the above criteria, the diagnostic time for remission is one month or more after treatment.
[0194] In the above text, the age of patients in remission ranged from 22 to 63 years old. See Table 2 for details.
[0195] Table 2. Detailed information of patients who relapsed / recovered.
[0196]
[0197]
[0198]
[0199]
[0200] 2. Used for clinical prognosis prediction
[0201] From July to December 2023 (sampling times in Table 3), bone marrow samples were collected from 19 patients with acute myeloid leukemia (AML) who underwent hematopoietic stem cell transplantation 1-3 months after the procedure at the Department of Hematology, Peking University People's Hospital (details shown in Table 3). Mononuclear cells were extracted from the bone marrow, and the expression of RGS1 in CD8 TEFF, CD8 T, and CD3 T cells was detected using flow cytometry. In accordance with the Declaration of Helsinki, all samples were collected from residual tissue after medical testing, and informed consent was obtained from all donors. The time listed in Table 3 for "Prognosis as of February 2024" represents the last sampling time. Patients were diagnosed based on this sampling time as either in remission or relapse (relapsed patients were considered relapsed, and patients in remission were considered remission). The diagnostic methods are detailed below.
[0202] Patients with acute myeloid leukemia (AML) listed in Table 3 were diagnosed with AML according to the inclusion criteria for AML. The inclusion criteria for AML are as described above.
[0203] Inclusion criteria for patients with acute myeloid leukemia (AML) who have achieved remission after treatment (also known as patients in remission):
[0204] Patients diagnosed with acute myeloid leukemia (AML) according to the inclusion criteria and achieving complete remission after treatment are considered to have AML. Complete remission is defined as meeting the following criteria: bone marrow smear showing <5% blast cells; no blast cells observed in peripheral blood smears; no Auer bodies among blast cells; no extramedullary lesions; and an absolute neutrophil count >1.0 × 10⁻⁶ in peripheral blood. 9 / L (1000 / μL); peripheral blood platelet count >100×10 9 / L (100,000 / μL); not dependent on red blood cell transfusion.
[0205] In the above text, the treatment mentioned refers to hematopoietic stem cell transplantation. Hematopoietic stem cell transplantation can be either haploidentical or fully matched.
[0206] In the above text, complete remission of AML is defined as having 5% or less of blast cells in the bone marrow.
[0207] In the above criteria, the diagnostic time for remission is 1-4 months after treatment.
[0208] In the above text, the age of patients in remission ranged from 17 to 60 years old. See Table 3 for details.
[0209] Inclusion criteria for patients with relapsed acute myeloid leukemia (AML) after treatment (also known as relapsed patients):
[0210] According to the "Guidelines for the Diagnosis and Treatment of Relapsed and Refractory Acute Myeloid Leukemia in China (2023 Edition)," acute myeloid leukemia (AML) is defined as AML that has been diagnosed as AML according to the inclusion criteria. After complete remission (CR) of AML, leukemia cells reappear in the peripheral blood, ≥5% of primitive cells in the bone marrow (excluding other causes such as bone marrow regeneration after consolidation chemotherapy), or leukemia cell infiltration appears in the extramedullary space.
[0211] Complete remission was defined as meeting the following criteria: bone marrow smear showed a blast cell percentage of <5%; peripheral blood smear showed no blast cells; no Auer bodies were found in the blast cells; there were no extramedullary lesions; and the absolute neutrophil count in peripheral blood was >1.0 × 10⁻⁶. 9 / L (1000 / μL); peripheral blood platelet count >100×10 9 / L (100,000 / μL); not dependent on red blood cell transfusion.
[0212] In the above text, the treatment mentioned refers to hematopoietic stem cell transplantation. Hematopoietic stem cell transplantation can be either haploidentical or fully matched.
[0213] In the above text, complete remission of AML is defined as having 5% or less of blast cells in the bone marrow.
[0214] In the above criteria, the diagnosis time for patients with relapse is 1-5 months after treatment.
[0215] In the above text, the relapsed patients were aged 23-55 years. See Table 3 for details.
[0216] Table 3. Detailed information of patients included 1-4 months post-transplantation.
[0217]
[0218]
[0219] The specific steps are as follows:
[0220] (1) Extraction of bone marrow mononuclear cells from patients 1-4: Bone marrow blood from patients 1-4 (blood collected on the collection day) was centrifuged (parameters: 1500 rpm, 5 min) and the supernatant plasma was removed; 4 mL of human lymphocyte separation medium (Solarbio LIFE SCIENCE, catalog number P8610) was placed in a 15 mL centrifuge tube, and the blood cells were diluted with PBS buffer (ThermoFisher SCIENTIFIC, catalog number 10010023) and placed on the supernatant of human leukocyte separation medium; after centrifugation (parameters: 1800 rpm, 18 min, brake off), the middle mononuclear cell layer was taken and counted to obtain bone marrow mononuclear cells from patients 1-4.
[0221] (2) Mononuclear cell cryopreservation and resuscitation: Bone marrow mononuclear cells from patients 1-4 were cryopreserved using serum-free cryopreservation solution and transferred to liquid nitrogen for storage. Before use, the cells were transferred to a preheated resuscitation solution at 37°C [IMDM medium (Gibco, catalog number 12440053) with 10% (v / v) BIT 9500 Serum Substitut (STEMCELL Technologies, catalog number 09500) and DNase I Solition (STEMCELL Technologies, catalog number 07900) added to achieve a final concentration of 0.1 mg / mL] and resuscitated in a 37°C water bath to obtain bone marrow mononuclear cell resuscitation solution from patients 1-4. The concentration of bone marrow mononuclear cells in the resuscitation solution from patients 1-4 was approximately 1-2 × 10⁻⁶. 6 / ml.
[0222] (3) T cell extraction: T cells were extracted from bone marrow mononuclear cells using CD3 MicroBeads human-luophilized (Miltenyi Biotec product number 130-097-043). Specific steps are detailed in the user manual provided by the company, and are briefly described below:
[0223] 20 μL of CD3 MicroBeads were mixed with the bone marrow mononuclear cell resuscitation solution from patients 1-4, respectively, to achieve a bone marrow mononuclear cell count of 10. 7 Bone marrow mononuclear cell mixtures were obtained from 1-4 patients and incubated at 2-8°C in the dark for 15 minutes. The cell mixture was then added to an LS Columns sorting column (Miltenyi Biotec, catalog number 130-042-401) and placed on a MidiMACS Separator (Miltenyi Biotec, catalog number 130-042-302) and a MACS MultiStand (Miltenyi Biotec, catalog number 130-042-303) rack for sorting. The cells were then sorted using a MACS Rinsing Solution (Miltenyi Biotec, catalog number 130-091-376) diluted 1:20 with MACS SSA Stock Solution (Miltenyi Biotec, catalog number 130-091-376). Biotec (product number 130-091-222) was washed twice, 0.5-1 mL each time, to obtain the washing solution. Then, 0.5-1 mL of the above washing solution was used to wash away CD3 cells in the magnetic column to obtain T cells from patients 1-4.
[0224] (4) After sorting, single-cell sequencing was performed using the 10X Genomics platform, and T cells were grouped according to gene expression using unsupervised clustering analysis. The results showed that the proportion of CD8TEFF cells in bone marrow mononuclear cells was significantly higher in AML patients who had achieved remission after hematopoietic stem cell transplantation than in those who had relapsed. Figure 1 ; Figure 1 In the middle section (B), Recurrence refers to AML patients who relapsed after hematopoietic stem cell transplantation, and Remission refers to AML patients who achieved remission after hematopoietic stem cell transplantation.
[0225] The classification criteria for the five subgroups are specific gene expression.
[0226] Further cluster analysis of the CD8 TEFF population divided it into 5 subgroups. The results showed that the C4 subgroup had the greatest difference between relapsed / responding patients and was the dominant subgroup for remission. Figure 2 Genes specifically highly expressed in C4 were extracted, and it was found that RGS1 had high expression levels and its expression distribution was most concentrated in C4. Figure 3 The C4 subgroup can be defined as RGS1+CD8 TEFF.
[0227] The RGS1 gene sequence is shown in Sequence 3. The CDS sequence of the RGS1 gene is shown in Sequence 1, and the protein it encodes is named RGS1 protein. The amino acid sequence of the RGS1 protein is shown in Sequence 2.
[0228] Sequence 1 is as follows:
[0229] ATGCGCGCAGCAGCCATCTCCACTCCAAAGTTAGACAAAATGCCAGGAATGTTCTTCTCTGCTAACCCAAAGGAATTGAAAGGAACCACTCATTCACTTCTAGACGACAAAATGCAAAAAAGGAGGCCAAAGACTTTTGGAATGGATATGAAAGCATACCTGAGATCTATGATCCCACATCTGGAATCTGGAATGAAATCTTCCAAGTCCAAGGATGTACTTTCTGCTGCTGAAGTAATGCAATGGTCTCAATCTCTGGAAAAACTTCTTGCCAACCAAACTGGTCAAAATGTCTTTGGAAGTTTCCTAAAGTCTGAATTCAGTGAGGAGAATATTGAGTTCTGGCTGGCTTGTGAAGACTATAAGAAAACAGAGTCTGATCTTTTGCCCTGTAAAGCAGAAGAGATATATAAAGCATTTGTGCATTCAGATGCTGCTAAACAAATCAATATTGACTTCCGCACTCGAGAATCTACAGCCAAGAAGATTAAAGCACCAACCCCCACGTGTTTTGATGAAGCACAAAAAGTCATATATACTCTTATGGAAAAGGACTCTTATCCCAGGTTCCTCAAATCAGATATTTACTTAAATCTTCTAAATGACCTGCAGGCTAATAGCCTAAAGTGA。
[0230] The specific sequence 2 is as follows:
[0231] MRAAAISTPKLDKMPGMFFSANPKELKGTTHSLLDDKMQKRRPKTFGMDMKAYLRSMIPHLESGMKSSKSKDVLSAAEVMQWSQSLEKLLANQTGQNVFGSFLKSEFSEENIEFWLACEDYKKTESDLLPCKAEEIYKAFVHSDAAKQINIDFRTRESTAKKIKAPTPTCFDEAQKVIYTLMEKDSYPRFLKSDIYLNLLNDLQANSLK。
[0232] The specific sequence 3 is as follows:
[0233]
[0234] Example 2: Clinical Case Verification
[0235] 1. Used for auxiliary diagnosis of clinical cases
[0236] Based on the aforementioned differences in T cell populations, this embodiment collects clinical case specimens to detect the proportion of RGS1+ T cells in the bone marrow of AML patients who have relapsed or are in remission after hematopoietic stem cell transplantation, and evaluates its significance for the prognostic diagnosis of AML patients after transplantation.
[0237] (1) Extraction of bone marrow mononuclear cells: Take bone marrow blood from patients listed in Table 2 (sampling time in Table 2), centrifuge (parameters: 1500 rpm, 5 min), and remove the upper plasma layer; take 4 mL of human lymphocyte separation medium (Solarbio LIFE SCIENCE, catalog number P8610) and place it in a 15 mL centrifuge tube, dilute the blood cells with PBS and place them on the upper layer of human leukocyte separation medium; centrifuge (parameters: 1800 rpm, 18 min, brake off), take the middle mononuclear cell layer and count it to obtain bone marrow mononuclear cells.
[0238] (2) Mononuclear cell cryopreservation and resuscitation: Bone marrow mononuclear cells from patients were cryopreserved using serum-free cryopreservation solution and transferred to liquid nitrogen for storage. Before use, the cells were transferred to a preheated resuscitation solution (IMDM medium (Gibco, catalog number 12440053) with 10% (v / v) BIT 9500 Serum Substitut (STEMCELL Technologies, catalog number 09500) and DNase I Solition (STEMCELL Technologies, catalog number 07900) added to achieve a final concentration of 0.1 mg / mL) at 37°C and resuscitated in a 37°C water bath to obtain a bone marrow mononuclear cell resuscitation solution with a mononuclear cell concentration of 2-4 × 10⁻⁴ cells / mL. 6 per milliliter.
[0239] (3) After bone marrow mononuclear cell resuscitation, the following antibodies were used for labeling: 5 μl of each of the following antibodies were selected: CD3-percp (Biolegend, catalog number 300427), CD8-BV421 (Biolegend, catalog number 344747), CD45RO-APC (Biolegend, catalog number 304210), CD45RA-PE-Cy7 (Biolegend, catalog number 304125), and CCR7-FITC (Biolegend, catalog number 304125). The reagents were 353215) and RGS1-PE (RGS1-PE is a conjugate antibody for flow cytometry detection of RGS1 antibody coupled with PE / R-Phycoerythrin; RGS1 antibody was purchased from Abcam, catalog number ab154973; PE / R-Phycoerythrin was purchased from Abcam, catalog number ab102918. The conjugation procedure was performed according to the instruction manual provided with the PE / R-Phycoerythrin conjugation kit (catalog number ab102918)). 40 μl of BD Horizon reagent was used. TM Antibody mixtures were prepared using Brilliant Stain Buffer Plus (BD Biosciences, catalog number 566385). 2-4 ml of the bone marrow mononuclear cell mixture was centrifuged at 1500 rpm for 5 minutes, the supernatant was discarded, and the bone marrow mononuclear cell pellet was resuspended in approximately 50-60 μl of the previously prepared antibody mixture. After resuspending, the antibody and cells were incubated together at room temperature in the dark for 15 minutes, centrifuged (1500 rpm, 5 minutes), and resuspended in 1 mL of PBS buffer (ThermoFisher SCIENTIFIC, catalog number 10010023). The cells were centrifuged (1500 rpm, 5 minutes), the supernatant was discarded, and this process was repeated twice. Analysis was then performed using a FACSCanto flow cytometer. In the assay, PE represents phycoerythrin, PerCP represents chlorophyll protein, APC represents phycocyanin, BV421 is a polymer dye, FITC is fluorescein isothiocyanate, and Cy7 is a cyanine dye fluorescent reagent.
[0240] First, use CD3+CD8+CD45RA+CCR7- to identify the CD8 TEFF cell population (cells that are positive for percp, BV421, and APC, and negative for FITC, as determined by flow cytometry). The cells with CD3+CD8+CD45RA+CCR7- are called CD8 TEFF cells. CD8 TEFF cells are T cells with CD3+CD8+CD45RA+CCR7- (T cells that are positive for CD3, CD8, and CD45RA, and negative for CCR7).
[0241] Then, using RGS1 expression data, the RGS1+ positive population was identified (cells with PE positivity were sorted from CD8 TEFF cells by flow cytometry as described above), and these were named RGS1+CD8 TEFF cells. RGS1+CD8 TEFF cells are T cells that are positive for CD3, CD8, CD45RA, and RGS1, and negative for CCR7.
[0242] The proportion of RGS1+CD8TEFF cells in CD8TEFF cells was analyzed in specimens from patients who relapsed or were in remission after AML hematopoietic stem cell transplantation, and this proportion was referred to as the RGS1+CD8TEFF cell / CD8TEFF cell ratio.
[0243] The results showed that the ratio of RGS1+CD8 TEFF cells to CD8 TEFF cells in the bone marrow of AML patients in remission after hematopoietic stem cell transplantation was significantly higher than that in AML patients who relapsed after hematopoietic stem cell transplantation. Figure 4 In the diagram, the horizontal axis represents patient type, and the vertical axis represents the ratio of RGS1+CD8 TEFF cells to CD8 TEFF cells.
[0244] First, use CD3+CD8+ to identify the CD8 T cell population (cells that are positive for percp and BV421 were sorted by flow cytometry as described above). These CD3+CD8+ cells are then called CD8 T cells. CD8 T cells are CD3+CD8+ cells (cells that are positive for both CD3 and CD8).
[0245] Then, using RGS1 expression data, the RGS1+ positive population was identified (cells with PE positive were sorted from CD8 T cells by flow cytometry as described above), and these were named RGS1+CD8 T cells. RGS1+CD8 T cells are cells that are positive for CD3, CD8, and RGS1.
[0246] The proportion of RGS1+CD8 T cells in CD8 T cells was analyzed in specimens from patients who relapsed or were in remission after AML hematopoietic stem cell transplantation, and this proportion was referred to as the RGS1+CD8 T cell / CD8 T cell ratio.
[0247] The results showed that the ratio of RGS1+CD8 T cells to CD8 T cells in the bone marrow of AML patients in remission after hematopoietic stem cell transplantation was significantly higher than that in AML patients who relapsed after hematopoietic stem cell transplantation. Figure 4 In the diagram, B represents the patient type on the horizontal axis and the ratio of RGS1+CD8 T cells to CD8 T cells on the vertical axis.
[0248] First, use CD3+ cells to identify the CD3 T cell population (cells that are positive for percp were sorted by flow cytometry as described above). These CD3+ cells are then called CD3 T cells. CD3 T cells are CD3+ cells (CD3-positive cells).
[0249] Then, using RGS1 expression data, the RGS1+ positive population was identified (cells with PE positive were sorted from CD3 T cells by flow cytometry as described above), and these were named RGS1+CD3 T cells. RGS1+CD3 T cells are cells that are positive for both CD3 and RGS1.
[0250] The proportion of RGS1+CD3 T cells in CD3 T cells was analyzed in specimens from patients who relapsed or were in remission after AML hematopoietic stem cell transplantation, and this proportion was referred to as the RGS1+CD3 T cell / CD3 T cell ratio.
[0251] The results showed that the ratio of RGS1+CD3 T cells to CD3 T cells in the bone marrow of AML patients in remission after hematopoietic stem cell transplantation was significantly higher than that in AML patients who relapsed after hematopoietic stem cell transplantation. Figure 4 In the diagram, the horizontal axis represents patient type, and the vertical axis represents the ratio of RGS1+CD3 T cells to CD3 T cells.
[0252] Prognostic results (see Table 2):
[0253] Inclusion criteria for acute myeloid leukemia (AML):
[0254] The diagnostic criteria for AML refer to the WHO 2016 classification of tumors of hematopoietic and lymphoid tissues, or, any of the following criteria must be met for a diagnosis of acute myeloid leukemia (AML):
[0255] 1. Peripheral blood or bone marrow blast cells ≥20%;
[0256] 2. Patients are confirmed to have clonal recurrent cytogenetic abnormalities t(8;21)(q22;q22), inv(16)(p13q22), or t(16;16)(p13;q22) and t(15;17)(q22;q12), even if the number of primitive cells is <20%.
[0257] Inclusion criteria for patients with relapsed acute myeloid leukemia (AML) after treatment (also known as relapsed patients):
[0258] According to the "Guidelines for the Diagnosis and Treatment of Relapsed and Refractory Acute Myeloid Leukemia in China (2023 Edition)," acute myeloid leukemia (AML) is defined as AML that has been diagnosed as AML according to the inclusion criteria. After complete remission (CR) of AML, leukemia cells reappear in the peripheral blood, ≥5% of primitive cells in the bone marrow (excluding other causes such as bone marrow regeneration after consolidation chemotherapy), or leukemia cell infiltration appears in the extramedullary space.
[0259] Complete remission was defined as meeting the following criteria: bone marrow smear showed a blast cell percentage of <5%; peripheral blood smear showed no blast cells; no Auer bodies were found in the blast cells; there were no extramedullary lesions; and the absolute neutrophil count in peripheral blood was >1.0 × 10⁻⁶. 9 / L (1000 / μL); peripheral blood platelet count >100×10 9 / L (100,000 / μL); not dependent on red blood cell transfusion.
[0260] In the above text, the treatment mentioned refers to hematopoietic stem cell transplantation. Hematopoietic stem cell transplantation can be either haploidentical or fully matched.
[0261] In the above text, complete remission of AML is defined as having 5% or less of blast cells in the bone marrow.
[0262] In the above text, the diagnostic time for relapsed patients is one month or more after treatment.
[0263] In the above text, the relapsed patients were aged 21-60 years. See Table 2 for details.
[0264] Inclusion criteria for patients with acute myeloid leukemia (AML) who have achieved remission after treatment (also known as patients in remission):
[0265] Patients diagnosed with acute myeloid leukemia (AML) according to the inclusion criteria and achieving complete remission after treatment are considered to have AML. Complete remission is defined as meeting the following criteria: bone marrow smear showing <5% blast cells; no blast cells observed in peripheral blood smears; no Auer bodies among blast cells; no extramedullary lesions; and an absolute neutrophil count >1.0 × 10⁻⁶ in peripheral blood. 9 / L (1000 / μL); peripheral blood platelet count >100×10 9 / L (100,000 / μL); not dependent on red blood cell transfusion.
[0266] In the above text, the treatment mentioned refers to hematopoietic stem cell transplantation. Hematopoietic stem cell transplantation can be either haploidentical or fully matched.
[0267] In the above text, complete remission of AML is defined as having 5% or less of blast cells in the bone marrow.
[0268] In the above criteria, the diagnostic time for remission is one month or more after treatment.
[0269] In the above text, the age of patients in remission ranged from 22 to 63 years old. See Table 2 for details.
[0270] Establishing the ROC curve
[0271] The receiver operating characteristic (ROC) curve is a curve plotted using a series of different binary classification methods (cutoff values or decision thresholds), with sensitivity (true positive rate) on the ordinate and 1-specificity (true negative rate) on the abscissa. The area under the ROC curve is an important indicator of test accuracy; the larger the area under the ROC curve, the greater the diagnostic value of the test.
[0272] Sensitivity (true positive rate): The percentage of people who actually have the disease but are correctly diagnosed as having the disease according to the test criteria. The higher the sensitivity, the better. The ideal sensitivity is 100%.
[0273] 1- Specificity (true negative rate): The percentage of people who are actually disease-free but are correctly judged as disease-free according to the test criteria. The higher the specificity, the better. The ideal specificity is 100%.
[0274] Patients with acute myeloid leukemia (AML) who achieved remission after haploidentical or fully matched hematopoietic stem cell transplantation were defined as the disease-free population, while patients with AML who relapsed after haploidentical or fully matched hematopoietic stem cell transplantation were defined as the diseased population. The percentage of RGS1+CD8 TEFF cells among CD8 TEFF cells in bone marrow mononuclear cells (RGS1+CD8TEFF cells / CD8 TEFF cells ratio) was analyzed using SPSS 16.0 software using ROC curve analysis, with an area under the curve (AUC) of 1.0 (e.g., ...). Figure 4 As shown in Figure D, the vertical axis represents sensitivity (true positive rate), and the horizontal axis represents 1-specificity (false positive rate). The percentage of RGS1+CD8 T cells among CD8 T cells in mononuclear cells (RGS1+CD8 T cells / CD8 T cells ratio) was analyzed using SPSS 16.0 software using ROC curve analysis, and the area under the curve (AUC) was 0.8588. Figure 4 As shown in Figure D, the vertical axis represents sensitivity (true positive rate), and the horizontal axis represents 1-specificity (false positive rate). The proportion of RGS1+CD3 T cells among CD3 T cells in mononuclear cells (RGS1+CD3 T cells / CD3 T cells ratio) was analyzed by ROC curve analysis using SPSS 16.0 software, and the area under the curve (AUC) was 0.8650 (e.g., Figure 4As shown in Figure D, the vertical axis represents sensitivity (true positive rate), and the horizontal axis represents 1 - specificity (false positive rate).
[0275] RGS1+CD8 TEFF cells / CD8 TEFF cells ratio:
[0276] At this point, the threshold for determining whether a patient with acute myeloid leukemia (AML) in remission after haploidentical hematopoietic stem cell transplantation is a patient expressing the RGS1 gene with a percentage of RGS1-expressing cells greater than or equal to 20.25% is used as the detection index. The sensitivity is 1, the specificity is 1, and the Youden index is 1 (see Table 4 for details). This indicates that the percentage of RGS1+CD8 TEFF cells among CD8 TEFF cells in bone marrow mononuclear cells can be used as an auxiliary diagnostic criterion for determining whether an AML patient is in remission or has relapsed after haploidentical hematopoietic stem cell transplantation.
[0277] Based on the above results, the criteria for determining the test results are as follows: If the proportion of RGS1+CD8 TEFF cells among CD8 TEFF cells in the bone marrow blood of the test subject is greater than or equal to 20.25%, the test subject is a patient with acute myeloid leukemia (AML) in remission after haploidentical hematopoietic stem cell transplantation; if the proportion of RGS1+CD8 TEFF cells among CD8 TEFF cells in the bone marrow blood of the test subject is less than or equal to 20.25%, the test subject is a candidate patient with acute myeloid leukemia (AML) who has relapsed after haploidentical hematopoietic stem cell transplantation.
[0278] RGS1+CD8 T cell / CD8 T cell ratio:
[0279] At this point, the threshold for determining whether a patient with acute myeloid leukemia (AML) in remission after haploidentical hematopoietic stem cell transplantation is a patient expressing the RGS1 gene at a rate greater than or equal to 5.28%, with a sensitivity of 0.95, a specificity of 0.65, and a Youden index of 0.6 (see Table 4). This indicates that the percentage of RGS1+ CD8 T cells in CD8 T cells of bone marrow mononuclear cells can serve as an auxiliary diagnostic criterion for determining whether an AML patient is in remission or has relapsed after haploidentical hematopoietic stem cell transplantation.
[0280] Based on the above results, the criteria for determining the test results are as follows: If the proportion of RGS1+CD8 T cells in CD8 T cells in the bone marrow mononuclear cells of the test subject is greater than or equal to 5.28%, the test subject is a patient with acute myeloid leukemia (AML) in remission after haploidentical hematopoietic stem cell transplantation; if the proportion of RGS1+CD8 T cells in CD8 T cells in the bone marrow mononuclear cells of the test subject is less than or equal to 5.28%, the test subject is a candidate patient with acute myeloid leukemia (AML) who has relapsed after haploidentical hematopoietic stem cell transplantation.
[0281] RGS1+CD3 T cell / CD3 T cell ratio:
[0282] At this point, the percentage of RGS1+CD3 T cells among CD3 T cells in bone marrow mononuclear cells was used as a detection index to determine whether a patient with acute myeloid leukemia (AML) in remission after haploidentical hematopoietic stem cell transplantation had an RGS1 gene expression threshold of 8.8% or greater. The sensitivity was 0.75, the specificity was 0.9, and the Youden index was 0.65 (see Table 4). This indicates that the percentage of RGS1+CD3 T cells among CD3 T cells in bone marrow mononuclear cells can be used as an auxiliary diagnostic criterion for determining whether an AML patient is in remission or has relapsed after haploidentical hematopoietic stem cell transplantation.
[0283] Based on the above results, the criteria for determining the test results are as follows: If the proportion of RGS1+CD3 T cells in CD3 T cells of mononuclear cells in the bone marrow blood of the test subject is greater than or equal to 8.8%, the test subject is an acute myeloid leukemia (AML) patient in remission after haploidentical hematopoietic stem cell transplantation; if the proportion of RGS1+CD3 T cells in CD3 T cells of mononuclear cells in the bone marrow blood of the test subject is less than or equal to 8.8%, the test subject is a candidate acute myeloid leukemia (AML) patient in relapse after haploidentical hematopoietic stem cell transplantation.
[0284] Table 4
[0285]
[0286] 2. Used for predicting the prognosis of clinical cases.
[0287] Based on the aforementioned differences in T cell populations, this embodiment collects clinical case specimens to detect the proportion of RGS1+ T cells in the bone marrow of AML patients 1-4 months after hematopoietic stem cell transplantation, and tracks the patients' prognosis until mid-January 2024. The ability to predict the prognosis of AML patients after transplantation is evaluated by combining the patient's test results at that time with whether they meet the diagnostic criteria for acute myeloid leukemia relapse.
[0288] (1) Extraction of bone marrow mononuclear cells: Take bone marrow blood from patients listed in Table 3 (sampling time in Table 3), centrifuge (parameters: 1500 rpm, 5 min), and remove the upper plasma layer; take 4 mL of human lymphocyte separation medium (Solarbio LIFE SCIENCE, catalog number P8610) and place it in a 15 mL centrifuge tube, dilute the blood cells with PBS and place them on the upper layer of human leukocyte separation medium; centrifuge (parameters: 1800 rpm, 18 min, brake off), take the middle mononuclear cell layer and count it to obtain bone marrow mononuclear cells.
[0289] (2) Mononuclear cell cryopreservation and resuscitation: Bone marrow mononuclear cells from patients were cryopreserved using serum-free cryopreservation solution and transferred to liquid nitrogen for storage. Before use, the cells were transferred to a preheated resuscitation solution (IMDM medium (Gibco, catalog number 12440053) with 10% (v / v) BIT 9500 Serum Substitut (STEMCELL Technologies, catalog number 09500) and DNase I Solition (STEMCELL Technologies, catalog number 07900) added to achieve a final concentration of 0.1 mg / mL) at 37°C and resuscitated in a 37°C water bath to obtain a bone marrow mononuclear cell resuscitation solution with a mononuclear cell concentration of 2-4 × 10⁻⁴ cells / mL. 6 per milliliter.
[0290] (3) After bone marrow mononuclear cell resuscitation, the following antibodies were used for labeling: 5 μl of each of the following antibodies were selected: CD3-percp (Biolegend, catalog number 300427), CD8-BV421 (Biolegend, catalog number 344747), CD45RO-APC (Biolegend, catalog number 304210), CD45RA-PE-Cy7 (Biolegend, catalog number 304125), and CCR7-FITC (Biolegend, catalog number 304125). The reagents were 353215) and RGS1-PE (RGS1-PE is a conjugate antibody for flow cytometry detection of RGS1 antibody coupled with PE / R-Phycoerythrin; RGS1 antibody was purchased from Abcam, catalog number ab154973; PE / R-Phycoerythrin was purchased from Abcam, catalog number ab102918. The conjugation procedure was performed according to the instruction manual provided with the PE / R-Phycoerythrin conjugation kit (catalog number ab102918)). 40 μl of BD Horizon reagent was used. TMAntibody mixtures were prepared using Brilliant Stain Buffer Plus (BD Biosciences, catalog number 566385). 2-4 ml of the bone marrow mononuclear cell mixture was centrifuged at 1500 rpm for 5 minutes, the supernatant was discarded, and the bone marrow mononuclear cell pellet was resuspended in approximately 50-60 μl of the previously prepared antibody mixture. After resuspending, the antibody and cells were incubated together at room temperature in the dark for 15 minutes, centrifuged (1500 rpm, 5 minutes), and resuspended in 1 mL of PBS buffer (ThermoFisher SCIENTIFIC, catalog number 10010023). The cells were centrifuged (1500 rpm, 5 minutes), the supernatant was discarded, and this process was repeated twice. Analysis was then performed using a FACSCanto flow cytometer. In the assay, PE represents phycoerythrin, PerCP represents chlorophyll protein, APC represents phycocyanin, BV421 is a polymer dye, FITC is fluorescein isothiocyanate, and Cy7 is a cyanine dye fluorescent reagent.
[0291] First, use CD3+CD8+CD45RA+CCR7- to identify the CD8 TEFF cell population (cells that are positive for percp, BV421, and APC, and negative for FITC, as determined by flow cytometry). The cells with CD3+CD8+CD45RA+CCR7- are called CD8 TEFF cells. CD8 TEFF cells are T cells with CD3+CD8+CD45RA+CCR7- (T cells that are positive for CD3, CD8, and CD45RA, and negative for CCR7).
[0292] Then, using RGS1 expression data, the RGS1+ positive population was identified (cells with PE positivity were sorted from CD8 TEFF cells by flow cytometry as described above), and these were named RGS1+CD8 TEFF cells. RGS1+CD8 TEFF cells are T cells that are positive for CD3, CD8, CD45RA, and RGS1, and negative for CCR7.
[0293] The proportion of RGS1+CD8 TEFF cells in CD8 TEFF cells was analyzed in specimens from patients after AML hematopoietic stem cell transplantation, and this proportion was referred to as the RGS1+CD8 TEFF cell / CD8 TEFF cell ratio.
[0294] The results showed that the ratio of RGS1+CD8 TEFF cells to CD8 TEFF cells was significantly higher in AML patients who underwent hematopoietic stem cell transplantation and were followed up for remission than in patients who underwent relapse. Figure 5 In the middle A, the horizontal axis represents the patient's follow-up outcome type, and the vertical axis represents the ratio of RGS1+CD8 TEFF cells to CD8 TEFF cells.
[0295] First, use CD3+CD8+ to identify the CD8 T cell population (cells that are positive for percp and BV421 were sorted by flow cytometry as described above). These CD3+CD8+ cells are then called CD8 T cells. CD8 T cells are CD3+CD8+ cells (cells that are positive for both CD3 and CD8).
[0296] Then, using RGS1 expression data, the RGS1+ positive population was identified (cells with PE positive were sorted from CD8 T cells by flow cytometry as described above), and these were named RGS1+CD8 T cells. RGS1+CD8 T cells are cells that are positive for CD3, CD8, and RGS1.
[0297] The proportion of RGS1+CD8 T cells in CD8 T cells was analyzed in specimens from patients after AML hematopoietic stem cell transplantation, and this proportion was referred to as the RGS1+CD8 T cell / CD8 T cell ratio.
[0298] The results showed that the ratio of RGS1+CD8 T cells to CD8 T cells was significantly higher in AML patients who underwent hematopoietic stem cell transplantation and were followed up for remission than in patients who underwent relapse. Figure 5 In the middle B, the horizontal axis represents the patient's follow-up outcome type, and the vertical axis represents the ratio of RGS1+CD8 T cells to CD8 T cells.
[0299] First, use CD3+ cells to identify the CD3 T cell population (cells that are positive for percp were sorted by flow cytometry as described above). These CD3+ cells are then called CD3 T cells. CD3 T cells are CD3+ cells (CD3-positive cells).
[0300] Then, using RGS1 expression data, the RGS1+ positive population was identified (cells with PE positive were sorted from CD3 T cells by flow cytometry as described above), and these were named RGS1+CD3 T cells. RGS1+CD3 T cells are cells that are positive for both CD3 and RGS1.
[0301] The proportion of RGS1+CD3 T cells in CD3 T cells was analyzed in specimens from patients who relapsed or were in remission after AML hematopoietic stem cell transplantation, and this proportion was referred to as the RGS1+CD3 T cell / CD3 T cell ratio.
[0302] The results showed that the ratio of RGS1+CD3 T cells to CD3 T cells was significantly higher in AML patients who underwent hematopoietic stem cell transplantation and were followed up for remission than in patients who underwent relapse. Figure 5 In the middle (C), the horizontal axis represents the patient's follow-up outcome type, and the vertical axis represents the ratio of RGS1+CD3 T cells to CD3 T cells.
[0303] Prognostic results (specific times and results are shown in Table 3):
[0304] Inclusion criteria for acute myeloid leukemia (AML):
[0305] The diagnostic criteria for AML refer to the WHO 2016 classification of tumors of hematopoietic and lymphoid tissues, or, any of the following criteria must be met for a diagnosis of acute myeloid leukemia (AML):
[0306] 1. Peripheral blood or bone marrow blast cells ≥20%;
[0307] 2. Patients are confirmed to have clonal recurrent cytogenetic abnormalities t(8;21)(q22;q22), inv(16)(p13q22), or t(16;16)(p13;q22) and t(15;17)(q22;q12), even if the number of primitive cells is <20%.
[0308] Inclusion criteria for patients with acute myeloid leukemia (AML) who have achieved remission after treatment (also known as patients in remission):
[0309] Patients diagnosed with acute myeloid leukemia (AML) according to the inclusion criteria and achieving complete remission after treatment are considered to have AML. Complete remission is defined as meeting the following criteria: bone marrow smear showing <5% blast cells; no blast cells observed in peripheral blood smears; no Auer bodies among blast cells; no extramedullary lesions; and an absolute neutrophil count >1.0 × 10⁻⁶ in peripheral blood. 9 / L (1000 / μL); peripheral blood platelet count >100×10 9 / L (100,000 / μL); not dependent on red blood cell transfusion.
[0310] In the above text, the treatment mentioned refers to hematopoietic stem cell transplantation. Hematopoietic stem cell transplantation can be either haploidentical or fully matched.
[0311] In the above text, complete remission of AML is defined as having 5% or less of blast cells in the bone marrow.
[0312] In the above criteria, the diagnostic time for remission is 1-4 months after treatment.
[0313] In the above text, the age of patients in remission ranged from 17 to 60 years old. See Table 3 for details.
[0314] Inclusion criteria for patients with relapsed acute myeloid leukemia (AML) after treatment (also known as relapsed patients):
[0315] According to the "Guidelines for the Diagnosis and Treatment of Relapsed and Refractory Acute Myeloid Leukemia in China (2023 Edition)," acute myeloid leukemia (AML) is defined as AML that has been diagnosed as AML according to the inclusion criteria. After complete remission (CR) of AML, leukemia cells reappear in the peripheral blood, ≥5% of primitive cells in the bone marrow (excluding other causes such as bone marrow regeneration after consolidation chemotherapy), or leukemia cell infiltration appears in the extramedullary space.
[0316] Complete remission was defined as meeting the following criteria: bone marrow smear showed a blast cell percentage of <5%; peripheral blood smear showed no blast cells; no Auer bodies were found in the blast cells; there were no extramedullary lesions; and the absolute neutrophil count in peripheral blood was >1.0 × 10⁻⁶. 9 / L (1000 / μL); peripheral blood platelet count >100×10 9 / L (100,000 / μL); not dependent on red blood cell transfusion.
[0317] In the above text, the treatment mentioned refers to hematopoietic stem cell transplantation. Hematopoietic stem cell transplantation can be either haploidentical or fully matched.
[0318] In the above text, complete remission of AML is defined as having 5% or less of blast cells in the bone marrow.
[0319] In the above criteria, the diagnosis time for patients with relapse is 1-5 months after treatment.
[0320] In the above text, the relapsed patients were aged 23-55 years. See Table 3 for details.
[0321] Patients listed in Table 3 underwent continuous sampling and testing at the prognostic timeframes (as of February 2024). The prognostic criteria for inclusion were as follows: Postoperative patients (those in Table 3) underwent continuous prognostic testing up to February 2024 (specific testing times are shown in Table 3). Patients whose test results met the inclusion criteria for acute myeloid leukemia (AML) at least once were considered to have a relapsed outcome (relapsed patients); those who did not meet the inclusion criteria for AML were considered to have a remission outcome (remission patients). The sampling times in Table 3 are the routine testing time points 1-3 months after hematopoietic stem cell transplantation, and these time points are prior to the prognostic outcome assessment time.
[0322] Establishing the ROC curve
[0323] The receiver operating characteristic (ROC) curve is a curve plotted using a series of different binary classification methods (cutoff values or decision thresholds), with sensitivity (true positive rate) on the ordinate and 1-specificity (true negative rate) on the abscissa. The area under the ROC curve is an important indicator of test accuracy; the larger the area under the ROC curve, the greater the diagnostic value of the test.
[0324] Sensitivity (true positive rate): The percentage of people who actually have the disease but are correctly diagnosed as having the disease according to the test criteria. The higher the sensitivity, the better. The ideal sensitivity is 100%.
[0325] 1- Specificity (true negative rate): The percentage of people who are actually disease-free but are correctly judged as disease-free according to the test criteria. The higher the specificity, the better. The ideal specificity is 100%.
[0326] Patients with acute myeloid leukemia (AML) who achieved remission after haploidentical or fully matched hematopoietic stem cell transplantation were defined as the disease-free population, while patients with AML who relapsed after haploidentical or fully matched hematopoietic stem cell transplantation were defined as the disease-affected population. The percentage of RGS1+CD8 TEFF cells among CD8 TEFF cells in bone marrow mononuclear cells (RGS1+CD8 TEFF cells / CD8 TEFF cells ratio) was analyzed using SPSS 16.0 software using ROC curve analysis, with an area under the curve (AUC) of 0.8750 (e.g., ...). Figure 5 As shown in Figure D, the vertical axis represents sensitivity (true positive rate), and the horizontal axis represents 1-specificity (false positive rate). The proportion of RGS1+CD8 T cells among CD8 T cells in mononuclear cells (RGS1+CD8 T cells / CD8 T cells ratio) was analyzed by ROC curve analysis using SPSS 16.0 software, and the area under the curve (AUC) was 0.9455. Figure 5 As shown in Figure E, the vertical axis represents sensitivity (true positive rate), and the horizontal axis represents 1-specificity (false positive rate). The proportion of RGS1+CD3 T cells among CD3 T cells in mononuclear cells (RGS1+CD3 T cells / CD3 T cells ratio) was analyzed by ROC curve analysis using SPSS 16.0 software, and the area under the curve (AUC) was 0.8533 (e.g., Figure 5 As shown in Figure F, the vertical axis represents sensitivity (true positive rate), and the horizontal axis represents 1 - specificity (false positive rate).
[0327] RGS1+CD8 TEFF cells / CD8 TEFF cells ratio:
[0328] At this point, the threshold for determining whether a patient with acute myeloid leukemia (AML) expects remission after haploidentical hematopoietic stem cell transplantation is an RGS1-expressing cell percentage among CD8 TEFF cells in bone marrow mononuclear cells is greater than or equal to 5.96%, with a sensitivity of 0.6, a specificity of 0.875, and a Youden index of 0.48 (see Table 5). This indicates that the percentage of RGS1-CD8 TEFF cells among CD8 TEFF cells in bone marrow mononuclear cells can serve as an auxiliary predictor or predictive indicator for whether an AML patient will be in remission or relapse after haploidentical hematopoietic stem cell transplantation.
[0329] Based on the above results, the criteria for determining the test results are as follows: If the proportion of RGS1+CD8 TEFF cells among CD8 TEFF cells in the bone marrow blood of the tested subject is greater than or equal to 5.96%, the tested subject is an acute myeloid leukemia (AML) patient expected to be in remission after haploidentical hematopoietic stem cell transplantation; if the proportion of RGS1+CD8 TEFF cells among CD8 TEFF cells in the bone marrow blood of the tested subject is less than or equal to 5.96%, the tested subject is an acute myeloid leukemia (AML) patient expected to relapse after haploidentical hematopoietic stem cell transplantation.
[0330] RGS1+CD8 T cell / CD8 T cell ratio:
[0331] At this point, the threshold for determining whether a patient with acute myeloid leukemia (AML) expects remission after haploidentical hematopoietic stem cell transplantation is a patient expressing the RGS1 gene at a rate greater than or equal to 3.66%, using the percentage of RGS1-expressing cells among CD8 T cells in bone marrow mononuclear cells as a detection index. The sensitivity is 0.8, the specificity is 0.91, and the Youden index is 0.88 (see Table 5 for details). This indicates that the percentage of RGS1+ CD8 T cells among CD8 T cells in bone marrow mononuclear cells can serve as an auxiliary predictor or predictive indicator for whether an AML patient will be in remission or relapse after haploidentical hematopoietic stem cell transplantation.
[0332] Based on the above results, the criteria for determining the test results are as follows: If the proportion of RGS1+CD8 T cells in CD8 T cells in the bone marrow mononuclear cells of the tested subject is greater than or equal to 3.66%, the tested subject is an acute myeloid leukemia (AML) patient expected to be in remission after haploidentical hematopoietic stem cell transplantation; if the proportion of RGS1+CD8 T cells in CD8 T cells in the bone marrow mononuclear cells of the tested subject is less than or equal to 3.66%, the tested subject is an acute myeloid leukemia (AML) patient expected to relapse after haploidentical hematopoietic stem cell transplantation.
[0333] RGS1+CD3 T cell / CD3 T cell ratio:
[0334] At this point, the percentage of RGS1+CD3 T cells among CD3 T cells in bone marrow mononuclear cells was used as a detection index to determine whether patients with acute myeloid leukemia (AML) expected to be in remission after haploidentical hematopoietic stem cell transplantation had an RGS1 gene expression threshold of 1.45%. The sensitivity was 0.80, the specificity was 0.87, and the Youden index was 0.6 (see Table 5 for details). This indicates that the percentage of RGS1+CD3 T cells among CD3 T cells in bone marrow mononuclear cells can serve as an auxiliary predictor or predictive indicator of whether AML patients will be in remission or relapse after haploidentical hematopoietic stem cell transplantation.
[0335] Based on the above results, the criteria for determining the test results are as follows: If the proportion of RGS1+CD3 T cells in CD3 T cells of the bone marrow mononuclear cells of the tested subject is greater than or equal to 1.45%, the tested subject is an acute myeloid leukemia (AML) patient expected to be in remission after haploidentical hematopoietic stem cell transplantation; if the proportion of RGS1+CD3 T cells in CD3 T cells of the bone marrow mononuclear cells of the tested subject is less than or equal to 1.45%, the tested subject is an acute myeloid leukemia (AML) patient expected to relapse after haploidentical hematopoietic stem cell transplantation.
[0336] Table 5
[0337]
[0338]
[0339] Example 3
[0340] CD3 T cells: Fresh bone marrow blood samples were collected from discarded samples with the informed consent of the subjects (healthy donors) and without affecting case diagnosis, clinical testing and treatment. After centrifuging bone marrow blood (1500 rpm, 5 min), the supernatant plasma was removed. 4 mL of human lymphocyte separation medium (Solarbio LIFE SCIENCE, catalog number P8610) was placed in a 15 mL centrifuge tube. The blood cells were diluted with PBS buffer (ThermoFisher SCIENTIFIC, catalog number 10010023) and placed on top of the human leukocyte separation medium. After centrifugation (1800 rpm, 18 min, brake off), the middle mononuclear cell layer was collected, washed once with an equal volume of PBS buffer, and counted. After centrifugation (1500 rpm, 5 min) to obtain the cell pellet, bone marrow mononuclear cells were obtained for later use. CD3-positive T cells (CD3 T cells) were extracted from the obtained bone marrow mononuclear cells using CD3 MicroBeads human-luophilized (Miltenyi Biotec, catalog number 130-097-043). Detailed procedures are described in the user manual provided by the company.
[0341] The method is briefly described below: 20 μL CD3 MicroBeads and 10 7 Bone marrow mononuclear cells were mixed and incubated at 2-8°C in the dark for 15 minutes. The cell mixture was then added to an LS Columns sorting column (Miltenyi Biotec, catalog number 130-042-401) and placed on a MidiMACS Separator (Miltenyi Biotec, catalog number 130-042-302) and a MACS MultiStand (Miltenyi Biotec, catalog number 130-042-303) rack for sorting. The cells were then sorted using MACS Rinsing Solution (Miltenyi Biotec, catalog number 130-091-376) diluted 1:20 with MACS BSA Stock Solution (Miltenyi Biotec). (Biotec, catalog number 130-091-222) Wash twice, 0.5-1 mL each time. Then use 0.5-1 mL of the above washing solution to elute CD3-positive cells in the magnetic column. Centrifuge (1500 rpm, 5 minutes) to collect cells in the eluent to obtain CD3-positive cells from healthy donors, i.e., CD3 T cells.
[0342] THP-1 tumor cells: purchased from ATCC, catalog number TIB-202, the number of THP-1 tumor cells was adjusted to 10. 5 / mL is used for subsequent experiments.
[0343] Co-culture experiment:
[0344] The above CD3 T cells were administered at a rate of 1-4 × 10⁴. 5 Cells / mL were added to Dynabeads containing T cell activation and expansion. TM Human T activator CD3 / CD28 (Thermo Fisher Scientific, catalog number 11161D, 2μL / 8*10) 4 The CD3 T cells were cultured overnight in IMDM medium (Gibco, catalog number 12440053) with 10% (v / v) BIT 9500 Serum Substitut (STEMCELL Technologies, catalog number 09500) and 10 ng / mL IL-2 cytokine (PEPROTECH, catalog number P60568). The CD3 T cells were then mixed with THP-1 tumor cells at a ratio of 1:5 and seeded into 96-well round-bottom plates. Each well contained approximately 1-2 × 10⁶ CD3 T cells. 4 THP-1 cells 5-10×10 4 .
[0345] Each group was set up with 5 replicates, and 0.5 μl of Golgi inhibitor (BD Biosciences, catalog number 555029) was added to each well. The mixture was then co-incubated at 37°C in a 5% CO2 incubator for 5 hours.
[0346] After co-culture, cells in each group were treated with cell rupture and fixation solution (Thermo Fisher Scientific, catalog number 00-5523-00) according to the manufacturer's instructions. Then, 60 μl of BD Horizon solution was added to each group. TMBrilliant Stain Buffer Plus (BD Biosciences, catalog number 566385) diluted antibody mixture (containing 4 μl of CD8-BV510 (Biolegend, catalog number 344731), CD107a-PerCP-Cy5 (Biolegend, catalog number 121625), TNFα-BV605 (Biolegend, catalog number 502935), GZMB-RB705 (BD Biosciences, catalog number 570275), IFNγ-PE-Cy7 (BD Biosciences, catalog number 560741), IL-2-BV421 (Biolegend, catalog number 500327), Ki67-APC (Biolegend, catalog number 350513), preforin-APC-Cy7 (Biolegend, catalog number 308127), 2 μl of... RGS1-PE (RGS1-PE is a flow cytometry conjugate antibody for RGS1 antibody coupled with PE / R-Phycoerythrin. The RGS1 antibody was purchased from Abcam (catalog number ab154973); the PE / R-Phycoerythrin was purchased from Abcam (catalog number ab102918). The conjugate assay was performed according to the manual provided with the PE / R-Phycoerythrin conjugate kit (catalog number ab102918). Cells were incubated at room temperature in the dark for 15 minutes, centrifuged (1500 rpm, 5 minutes), resuspended in 1 mL of PBS buffer (ThermoFisher SCIENTIFIC, catalog number 10010023), centrifuged (1500 rpm, 5 minutes), and the supernatant was discarded. This process was repeated twice. Analysis was then performed using a FACS Canto flow cytometer.
[0347] The results showed that after co-culturing with tumor cells, RGS1-positive CD3 T cells (RGS1+CD3 T cells) expressed CD107a and Ki67; and secreted significantly more GZMB, perforin, and IFN-γ factors than RGS1-CD3 T cells, as evidenced by an increase in the number of cells positive for these factors in flow cytometry analysis (results were...). Figure 6 In the middle A), the proportion of positive staining cells was significantly increased after statistical analysis. Figure 6 In the diagram, the vertical axis represents the percentage of positive cells, and the horizontal axis represents CD107a, GZNB, perforin, IFN-γ, and KI67. RGS1+ indicates RGS1-positive cells, and RGS1- indicates RGS1-negative cells.
[0348] Acquisition of overexpressed virus:
[0349] The GFP-labeled RGS1 overexpressing lentivirus and the negative control lentivirus were purchased from Sangon Biotech (Shanghai) with catalog number SGXM2022LA881.
[0350] The build process is briefly described below:
[0351] 1. Preparation of RGS1 overexpression plasmid with GFP label:
[0352] The following sequence (Sequence 1) was prepared: an RGS1 CDS sequence with an Xma1 restriction endonuclease (NEW ENGLAND Biolabs, catalog number R0180V) restriction site added to the 5' end and a BamH1 restriction endonuclease (NEW ENGLAND Biolabs, catalog number R3136V) restriction site added to the 3' end. The pLVX-mCMV-ZsGreen1-Puro vector (provided by Sangon Biotech (Shanghai)) containing both Xma1 and BamH1 restriction endonuclease restriction site sequences at the multiple cloning site was digested with Xma1 and BamH1 restriction endonucleases (according to the restriction endonuclease instructions). Ligation was then performed using T4 DNA Ligase (NEW ENGLAND Biolabs, catalog number M0202V) (according to the ligase instructions). The ligation product was transfected into *E. coli* competent cells DH5α (ThermoFisher SCIENTIFIC, catalog number EC0112) for amplification (transfection and amplification were performed according to the competent cell instructions). Plasmids were extracted using a plasmid extraction kit (endotoxin-free plasmid medium-quantity extraction kit, TIANGEN, catalog number DP108) (according to the plasmid extraction kit instructions). Sequencing was performed, and the plasmid with the correct results was named pLVX-mCMV-RGS1-ZsGreen1-Puro.
[0353] 2. Preparation of RGS1 overexpression lentivirus:
[0354] The target plasmid pLVX-mCMV-RGS1-ZsGreen1-Puro (RGS1 overexpression plasmid) was combined with psPAX2 (purchased from Solarbio LIFE SCIENCES, catalog number VT000195; the product is DH5α competent cells containing the psPAX2 plasmid, which must be transfected and amplified before plasmid extraction to obtain the target plasmid; transfection, amplification, and plasmid extraction are described above) and pMD2.G packaging plasmid (purchased from Solarbio LIFE). SCIENCES, product code VT015719, is a product for DH5α competent cells containing the pMD2.G plasmid. It requires transfection and amplification before plasmid extraction to obtain the target plasmid. (See above for transfection, amplification, and plasmid extraction instructions.) Mix the plasmid in a 4:3:1 ratio (10 μg total plasmid per 10 cm cell culture dish), dilute with DMEM medium (Gibco, product code 12440053) (800 μl per 10 cm cell culture dish), and then add Lipofectamine 3000 transfection reagent (ThermoFisher SCIENTIFIC, product code L3000008), following the reagent's instructions. Add this mixture to 293T lentiviral packaging cell lines that have reached 50-70% confluence and incubate for 6 hours. After 6 hours, the 293T cells were replaced with fresh culture medium, and after another 48-60 hours, the lentivirus solution (293T culture medium) was collected.
[0355] The lentiviral solution was filtered through a 0.45 μm disposable filter (Merck Millipore, catalog number SLHV033RB), and then centrifuged at 20,000-40,000 rcf for 1-1.5 hours at 4°C to concentrate the lentiviral solution. After centrifugation, the supernatant was discarded, and the viral particle precipitate was resuspended in the target cell culture medium (IMDM medium for T cells) and stored at -80°C for later use.
[0356] Preparation of RGS1-overexpressing CD3 T cells:
[0357] The aforementioned CD3 T cells were added to Dynabeads containing activated and expanded T cells. TM Human T activator CD3 / CD28 (Thermo Fisher Scientific, catalog number 11161D, 2μL / 8*10) 4T cells were cultured overnight in IMDM medium (Gibco, catalog number 12440053) supplemented with 10% (v / v) BIT 9500 Serum Substitut (STEMCELL Technologies, catalog number 09500) and 10 ng / mL IL-2 cytokine (PEPROTECH, catalog number P60568) at a ratio of 1-2 × 10⁻⁶ cells / mL. 5 Cells were plated at a density of / mL and incubated with RGS1-overexpressing lentivirus and negative control lentivirus (purchased from Sangon Biotech (Shanghai), catalog number SGXM2022LA881). The cells were then infected with the Easy-T Lentiviral Infection Kit (Shanghai Jikai Gene, catalog number LCR601B) according to the kit instructions. After infection, the cells were cultured for 2-3 days to obtain RGS1-overexpressing CD3 T cells and negative control CD3 T cells.
[0358] Flow cytometry was used to detect the expression of RGS1 in RGS1-overexpressing CD3 T cells and negative control CD3 T cells, and GFP expression was also detected to determine the infection efficiency (results are shown in the figure). Figure 7 (A) The above-mentioned RGS1-overexpressing CD3 T cells (also known as RGS1-overexpressing CD3 T cells, which are T cells that are positive for both RGS1 and CD3 and overexpress RGS1); The above-mentioned negative control lentivirus differs from the RGS1-overexpressing lentivirus only in that it does not contain the RGS1 gene, and will not cause CD3 T cells to overexpress RGS1 after infecting them. The above-mentioned negative control CD3 T cells do not express RGS1. The amino acid sequence of the RGS1 protein is shown in Sequence 2.
[0359] THP-1 tumor cells: purchased from ATCC, catalog number TIB-202, the number of THP-1 tumor cells was adjusted to 10. 5 / mL is used for subsequent experiments.
[0360] RGS1-overexpressing CD3 T cell co-culture experiment:
[0361] The experiment was divided into two groups: the RGS1 overexpression group and the control group. The experimental group used RGS1 overexpressing CD3 T cells, while the control group used negative control CD3 T cells.
[0362] RGS1 performed the following operations in the overexpression group:
[0363] The RGS1-overexpressing CD3 T cells were added to THP-1 tumor cells at a ratio of 1:5. The mixture was then seeded into 96-well plates with 200 μl of culture medium per well. The RGS1 overexpression group contained approximately 1-2 × 10T RGS1-overexpressing CD3 T cells. 4 THP-1 cells 5-10×10 4 .
[0364] Five replicates were set up for each group. The medium contained 10% (v / v) BIT in IMDM medium with the addition of Golgi inhibitor (BD Biosciences, catalog number 555029) and was co-cultured at 37°C in a 5% CO2 incubator for 5 hours.
[0365] After co-culture, cells in each group were treated with cell rupture and fixation solution (Thermo Fisher Scientific, catalog number 00-5523-00) according to the manufacturer's instructions. Then, 60 μl of BD Horizon solution was added to each group. TMBrilliant Stain Buffer Plus (BD Biosciences, catalog number 566385) diluted with 4 μl of CD8-BV510 (Biolegend, catalog number 344731), CD107a-PerCP-Cy5 (Biolegend, catalog number 121625), TNFα-BV605 (Biolegend, catalog number 502935), GZMB-RB705 (BD Biosciences, catalog number 570275), IFNγ-PE-Cy7 (BD Biosciences, catalog number 560741), IL-2-BV421 (Biolegend, catalog number 500327), Ki67-APC (Biolegend, catalog number 350513), and preforin-APC-Cy7 (Biolegend, catalog number 308127), 2 μl RGS1-PE (RGS1-PE is a flow cytometry conjugate antibody for RGS1 antibody coupled with PE / R-Phycoerythrin. The RGS1 antibody was purchased from Abcam (catalog number ab154973); the PE / R-Phycoerythrin was purchased from Abcam (catalog number ab102918). The conjugate assay was performed according to the antibody mixture in the PE / R-Phycoerythrin conjugate kit (catalog number ab102918), incubated at room temperature in the dark for 15 minutes, and centrifuged (1500 rpm, 5 minutes). Cells were resuspended in 1 mL of PBS buffer (ThermoFisher SCIENTIFIC, catalog number 10010023), centrifuged (1500 rpm, 5 minutes), and the supernatant was discarded. This process was repeated twice. Analysis was then performed using a FACS Canto flow cytometer.)
[0366] Control group:
[0367] The difference between the control group and the RGS1 overexpression group was that the RGS1 overexpressing CD3 T cells were replaced with negative control CD3 T cells, and the rest of the operation was the same as that in the RGS1 overexpression group.
[0368] The results showed that after co-culturing with tumor cells, RGS1-positive CD3 T cells (RGS1+CD3 T cells) expressed CD107a and secreted IFN-γ significantly higher levels than the control group (CD3 T cells expressing negative control IFN-γ), as evidenced by an increase in the number of cells positive for these factors in flow cytometry (see results for example). Figure 6 According to statistics, the proportion of cells positive for the above-mentioned factors was significantly increased (B). Figure 7In the diagram, the vertical axis represents the percentage of positive cells, and the horizontal axis represents CD107a, IL-2, IFN-γ, TNFα, GZNB, perforin, and Ki67; the control group represents the control group, and the RGS1 overexpression group represents the RGS1 overexpression group.
[0369] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.
Claims
1. The use of a biomarker or a substance for detecting the biomarker in the preparation of a prognostic product for patients with acute myeloid leukemia after hematopoietic stem cell transplantation; wherein the biomarker is RGS1 protein.
2. The application as described in claim 1, characterized in that, The substance is a reagent for detecting the RGS1 protein of claim 1 on the cell peripheral membrane.
3. The application as described in claim 1, characterized in that, The product is a reagent, reagent kit, chip, or device.
4. The application as described in claim 1, characterized in that, The test sample for the product was bone marrow mononuclear cells.
5. The application as described in claim 4, characterized in that, The bone marrow mononuclear cells are at least one of CD8 TEFF cells, CD8 T cells, and CD3 T cells.
6. A computer-readable storage medium storing a computer program that causes a computer to perform the following steps: 1) Obtain the ratio of RGS1+CD8 TEFF cells / CD8 TEFF cells, the ratio of RGS1+CD8 T cells / CD8 T cells, and / or the ratio of RGS1+CD3 T cells / CD3 T cells in the subjects; 2) Predict the prognosis of acute myeloid leukemia patients after hematopoietic stem cell transplantation based on the aforementioned ratios; the RGS1+CD8TEFF cell / CD8 TEFF cell ratio is the ratio of the number of RGS1+CD8 TEFF cells to the number of CD8 TEFF cells in bone marrow mononuclear cells; the RGS1+CD8 T cell / CD8 T cell ratio is the ratio of the number of RGS1+CD8 T cells to the number of CD8 T cells in bone marrow mononuclear cells; the RGS1+CD3 T cell / CD3 T cell ratio is the ratio of the number of RGS1+CD3 T cells to the number of CD3 T cells in bone marrow mononuclear cells; the CD8 TEFF cells are lymphocytes that are positive for CD3, CD8, and CD45RA and negative for CCR7; the RGS1+CD8 TEFF cells are lymphocytes that are positive for CD3, CD8, CD45RA, and RGS1 ... The T cells are lymphocytes that are positive for CD3, CD8 and RGS1. The CD8 T cells are lymphocytes that are positive for both CD3 and CD8. The RGS1+CD3 T cells are lymphocytes that are positive for both CD3 and RGS1. The CD3 T cells are lymphocytes that are positive for CD3.
7. A device for predicting the prognosis of patients with acute myeloid leukemia after hematopoietic stem cell transplantation. Its features are: The device includes: 1) RGS1+CD8 TEFF cell / CD8 TEFF cell ratio, and / or RGS1+CD8 T cell / CD8 T cell ratio, and / or RGS1+CD3 T cell / CD3 T cell ratio acquisition module: used to obtain the RGS1+CD8 TEFF cell / CD8 TEFF cell ratio, and / or RGS1+CD8 T cell / CD8 T cell ratio, and / or RGS1+CD3 T cell / CD3 T cell ratio of the test subjects; 2) Prognostic module: Used to predict the prognosis of patients with acute myeloid leukemia after hematopoietic stem cell transplantation based on the ratio of RGS1+CD8 TEFF cells / CD8 TEFF cells, and / or the ratio of RGS1+CD8 T cells / CD8 T cells, and / or the ratio of RGS1+CD3 T cells / CD3 T cells. The ratios are the ratio of the number of RGS1+CD8 TEFF cells to the number of CD8 TEFF cells in bone marrow mononuclear cells, and / or the ratio of the number of RGS1+CD8 T cells to the number of CD8 T cells in bone marrow mononuclear cells, and / or the ratio of the number of RGS1+CD3 T cells to the number of CD3 T cells in bone marrow mononuclear cells. The CD8 TEFF cells are lymphocytes that are positive for CD3, CD8, and CD45RA and negative for CCR7. The RGS1+CD8 TEFF cells are lymphocytes that are positive for CD3, CD8, CD45RA, and RGS1 and negative for CCR7. The RGS1+CD8 T cells are lymphocytes that are positive for CD3, CD8, and RGS1. The CD8 T cells are lymphocytes that are positive for CD3 and CD8. The RGS1+CD3 T cells are lymphocytes that are positive for both CD3 and RGS1. The CD3 T cells are CD3-positive lymphocytes.
8. The application of a biomarker in the preparation of a product that enhances the killing power of effector T cells against human monocytic leukemia cells after hematopoietic stem cell transplantation in patients with acute myeloid leukemia, wherein the biomarker is RGS1 protein.
Citation Information
Patent Citations
Acute B-lymphocyte leukemia initiated cell phenetic classification kit and application thereof
CN103175966A
Method for screening of immunological tolerance associated disease gene RGS1 based on immunological tolerance dendritic cell
CN1840707A