Molecular markers tightly linked to major gene loci of soybean plant height and their uses

Abstract

The present invention belongs to the technical field of soybean molecular breeding, and specifically discloses a molecular marker closely linked to a major effect gene locus of soybean plant height. The major effect gene locus is located between 39901295-39990704 of chromosome 13, and the molecular marker is Gm13_39977464_A_G; the nucleotide sequence of Gm13_39977464_A_G is shown in SEQ ID NO: 1 or SEQ ID NO: 2. The present invention identifies a molecular marker related to soybean plant height in the QTL positioning interval, which can be used for soybean plant height trait selection.

Description

Technical Field

[0001] The invention belongs to the technical field of soybean molecular breeding, and specifically discloses a molecular marker tightly linked to a major effect gene locus of soybean plant height and a use thereof. Background Art

[0002] Soybean is an important crop used as both food and oil for feed in my country, and plays an important strategic role in the development of the national economy. Soybean has a 5,000-year history of cultivation in China. It is produced in Northeast China, North China, Shaanxi, Sichuan and the lower reaches of the Yangtze River. It is mostly cultivated in the Yangtze River Basin and Southwest China, and the quality of soybeans in Northeast China is the best. Due to its high nutritional value, soybean is called "the king of beans", "meat in the field", "green milk", etc. It is the most respected food among hundreds of natural foods by nutritionists.

[0003] Soybean plant height (PH) is one of the important factors in plant type composition and an important agronomic trait that affects yield. Traditional genetic studies have shown that an increase in soybean plant height within a certain range can lead to an increase in yield. Therefore, studying soybean plant height is of great significance for soybean high-yield breeding. However, soybean plant height is a quantitative genetic trait and is greatly affected by environmental factors, so there are certain limitations in the study of soybean yield traits. From the perspective of traditional quantitative genetics, it is difficult to determine the number, genetic effect and location of quantitative trait loci (QTLs) that control the corresponding traits when conducting genetic analysis of these yield traits. However, with the completion of soybean whole genome sequencing, molecular biology and molecular marker technologies such as SSR (simple sequence repeats) and SNP (single nucleotide polymorphism) have gradually improved, and many QTLs related to soybean plant height have been found, but only a few related genes have been cloned, and the analysis of the regulatory mechanism of soybean plant height has progressed slowly. Based on the preliminary laboratory work, the present invention further precisely locates and mines plant height-related genes, studies gene functions, and analyzes related regulatory pathways, providing theoretical guidance for creating new high-yield soybean varieties and exploring the soybean yield code. Summary of the invention

[0004] In view of the above technical problems, the present invention provides a molecular marker closely linked to the major gene locus of soybean plant height, so as to carry out molecular marker-assisted selection breeding for soybean plant height, and can also be applied to mining soybean plant height regulatory genes.

[0005] In a first aspect, the present invention provides a molecular marker tightly linked to a major gene locus of soybean plant height, wherein the major gene locus is located between 39901295-39990704 of chromosome 13, and the molecular marker is Gm13_39977464_A_G;

[0006] The nucleotide sequence of Gm13_39977464_A_G is shown in SEQ ID NO: 1 or SEQ ID NO: 2.

[0007] In a second aspect, the present invention provides a primer for the molecular marker.

[0008] The forward primer sequence of Gm13_39977464_A_G is shown in SEQ ID NO: 3; the reverse primer sequence is shown in SEQ ID NO: 4.

[0009] The third aspect of the present invention provides a use of the primers in the positioning and detection of soybean plant height-related gene Glyma.04G253500.

[0010] The fourth aspect of the present invention provides a use of the molecular marker or the primer in the breeding of soybean plant height traits.

[0011] A fifth aspect of the present invention provides a method for breeding soybean plant height traits, comprising the following steps:

[0012] Using the genomic DNA of the F2 population produced by the hybridization of the female parent Changnong 16 and the male parent Jilin Cailihua as a template and the primers as primers, PCR amplification is performed;

[0013] The PCR amplification products were sequenced and analyzed. If the molecular marker Gm13_39977464_A_G-F / R existed in the F2 generation population, and when the 38th position from the 5' end of the amplification product of Gm13_39977464_A_G-F / R was G in the female parent Changnong 16, the plant was short; if the molecular marker Gm13_39977464_A_G-F / R existed in the F2 generation population, and when the 38th position from the 5' end of the amplification product of Gm13_39977464_A_G-F / R was A in the male parent Jilin Cailihua, the plant was tall.

[0014] Preferably, the PCR amplification reaction system is: 4 μl of 20 ng / μl DNA, 0.5 μl of rTaq enzyme, 15 μl of 3×GC Buffer I, 2.5 μl of 2.5 mM dNTPs, 2.5 μl of 2 μM forward and reverse primers, and ddH2O to make up to 30 μl.

[0015] Preferably, the PCR reaction program is: first 94°C for 5 min, then 94°C for 30 s, 58°C for 40 s, 72°C for 70 s, amplification for 35 cycles, and finally extension at 72°C for 10 min, and insulation at 4°C.

[0016] A sixth aspect of the present invention provides a soybean plant height typing detection kit, comprising the primers.

[0017] A seventh aspect of the present invention provides a use of the detection kit in soybean plant height trait breeding.

[0018] Compared with the prior art, the beneficial effects of the present invention are:

[0019] 1. The present invention locates a QTL site related to soybean plant height for the first time in soybean, the LOD value of the site is 4.1, the phenotypic contribution rate is 16.1%, and the site is located at 39901295-39990704 on chromosome 13. Therefore, whether from the location of QTL or the contribution rate of QTL to phenotype, this interval is an important site for soybean plant height regulation.

[0020] 2. The present invention identified a molecular marker related to soybean plant height in the QTL positioning interval, which can be used for soybean plant height trait selection. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 It is the difference in plant height between the parents;

[0022] Figure 2 is the normal distribution diagram of individual phenotypes of the F2 generation;

[0023] Figure 3 It is the QTL location map related to plant height;

[0024] Figure 4 It is a schematic diagram of fine positioning;

[0025] Figure 5 is the sequence alignment result. DETAILED DESCRIPTION

[0026] In order to clearly illustrate the technical features of this solution, the present invention is described in detail below through specific implementation methods and in conjunction with the accompanying drawings. The scope of the present invention is not limited to the following embodiments. Professionals in the field can understand that various changes and modifications can be made to the present invention without departing from the spirit and scope of the present invention.

[0027] The instruments, reagents, materials, etc. involved in the following embodiments, unless otherwise specified, are all conventional instruments, reagents, materials, etc. in the prior art and can be obtained through regular commercial channels. The experimental methods, detection methods, etc. involved in the following embodiments, unless otherwise specified, are all conventional experimental methods, detection methods, etc. in the prior art.

[0028] Example 1

[0029] Obtaining QTL and Molecular Markers Related to Soybean Plant Height

[0030] 1. Genetic population construction

[0031] A plant height segregating population was prepared by hybridization using a pair of parents with significant differences in plant height (the female parent Changnong 16 and the male parent Jilin Cailihua (the male parent material is recorded in "Yuqiu Li, Yingshan Dong, et al. Positional Cloning of the Flowering Time QTLqFT12-1 Reveals the Link Between the Clock Related PRR Homolog WithPhotoperiodic Response in Soybeans[J]. Frontiers in Plant Science, 2019, 10", which is available to the public from Jilin Academy of Agricultural Sciences)). The individuals in the F2 generation population showed a normal distribution, as shown in Figure 2. Figures 1-2 shown.

[0032] 2. Genetic map construction

[0033] 100 individuals were selected from F2, and the DNA of parents and individual leaves was extracted using the CTAB method. The samples were sequenced using the Illumina platform SoySNP8k iSelectBead Chip chip, which contained 7189 SNP sites. The data was sorted and redundant markers were removed. 2407 markers were polymorphic in the parental set. The genetic map was performed using Ici QTLMapping 3.2 software, with a total length of 3425.7cM, an average distance between markers of 1.45cM, and an average of 120 markers on each linkage group. Among them, the A2 linkage group had the largest number of markers, with 256 SNP markers, a genetic distance of 179.2cM, and an average distance between markers of 0.7cM (Table 1). There were 153 markers on the I linkage group, with the smallest average spacing of 0.64cM. The H linkage group (chromosome 12) had the smallest marker density, a genetic distance of 293.23cM, 100 SNP markers, and an average distance of 2.93cM. The B2 and L linkage groups had the least number of markers, both with 62 markers, and the average spacing was 1.35 cM and 1.6 cM, respectively.

[0034] Table 1 Distribution of SNPs in the JLCLH×CN16 F2 segregating population on the genetic linkage map

[0035]

[0036] 3. Preliminary positioning of QTL

[0037] 100 individuals were selected from F2 for Soy6K_MSU_SNP chip sequencing, and genetic map analysis and QTL initial positioning were performed using IciQTLMapping 3.2 software. A plant height-related locus was located between 39990704-40017050 on chromosome 13. The LOD value of this locus was 4.1, the phenotypic contribution rate was 16.1%, and the interval length was 26.3 kb (Table 2, Figure 3 ).

[0038] Table 2 QTL related information

[0039] Features chromosome LOD PVE(%) Add Dom Chromosome location Interval length Plant height 13 4.12 16.08 -8.6976 -4.4815 Gm13:39990704-40017050 26.3kb

[0040] 4. Fine positioning

[0041] In the initial positioning interval and its flanking regions, SNP primers were designed, primer encryption was performed to identify genotypes, recombinants were screened in the F3:5 generation genetic population, and further fine positioning was performed based on the recombinant phenotypes. Seven recombinants were screened from more than 2,000 individuals in the F3:5 generation. Through the combined identification of recombinant phenotypes and genotypes, the interval was finally determined to be 39901295-39990704, with a physical distance of 89.4kb. Figure 3 .

[0042] 5. Candidate gene identification

[0043] There are 15 genes in the fine-mapping interval. Through comparative analysis between the parents, it was found that 6 genes had single base, insertion and deletion differences between the parents, namely Glyma.13G301600, Glyma.13G301700, Glyma.13G302300, Glyma.13G302500, Glyma.13G302600, and Glyma.13G302800 genes. Through analysis and comparison, Glyma.13G302800 may be involved in regulating plant height, so all variant sites on this gene were sequenced. It was found that the 39977464 site had a mutation from A to G, resulting in a change in amino acid from Val to Ala, Table 3, Figures 4-5 .

[0044] Table 3 15 genes in the fine-mapping interval

[0045]

[0046]

[0047] Example 2

[0048] Molecular markers and their applications

[0049] The whole genome DNA of 123 individuals in the F2 generation population produced by the hybridization of the female parent Changnong 16 and the male parent Jilin Chalihua was extracted at the seedling stage and used as a template. PCR amplification was performed using the primers with the SNP molecular marker Gm13_39977464_A_G-F / R as amplification primers.

[0050] PCR reaction amplification system: DNA 4μl (20ng / μl), rTaq enzyme 0.5μl, 3×GC BufferⅠ15μl, 2.5mM dNTPs 2.5μl, forward and reverse primers (F / R) 2.5μl each (2μM), ddH2O to 30μl.

[0051] PCR reaction program: first 94°C for 5 min; then 94°C for 30 s, 58°C for 40 s, 72°C for 70 s, amplification for 35 cycles; finally extension at 72°C for 10 min, and insulation at 4°C.

[0052] The obtained PCR products were subjected to 1% agarose gel electrophoresis at 140 V for 20 min.

[0053] The amplified product of Gm13_39977464_A_G-F / R was subjected to PCR sequencing analysis.

[0054] If the molecular marker Gm13_39977464_A_G-F / R exists in the F2 generation population, and when the 38th position from the 5' end of the amplified product of Gm13_39977464_A_G-F / R is G in the maternal parent Changnong 16, the plant will be short.

[0055] If the molecular marker Gm13_39977464_A_G-F / R exists in the F2 generation population, and when the 38th position from the 5' end of the amplified product of Gm13_39977464_A_G-F / R is A in the male parent Jilin Cailihua, the plant is tall.

[0056] The results showed that the accuracy of Gm13_39977464_A_G was 92.6%. Therefore, the SNP molecular marker Gm13_39977464_A_G can be used as a co-dominant molecular marker for soybean plant height.

[0057] The nucleotide sequence of the molecular marker Gm13_39977464_A_G is shown in SEQ ID NO: 1:

[0058] tgctgcttttgtaaccaacctcaaagcagaggttaatacaccggatgctgccaaaccagcaaggaaagactaacaataaaaccatgttaaataaattcataagctgaagaatgaagatatcttcaataccactacataataactatatcattgatgctcacttgaatgaattctggtttcatgtaggagaggtctcccaccattccaccttgaacatgagcatctgcaactccaaaagcaccactaagtgcacatataccgatgaaagttccaagtcctcctttaccagatgttgctgaattcaactatggcaaattggtaggaaaaataaaataaaaaaccatcctaaaggaattaattactcctagttcacaaacaaatgaataggacttacaattaacaccaacaaagtgcttatgaaaaaaagtatatatccaaacagattccttagtcgagtattgagtttggcctcattatatgccagtatcgcaagtgttccaactgcgaatggctgatatacaagagtaagcaccctagaggggtggtatttctgcacaagga; or as shown in SEQ ID NO: 2:

[0059] tgctgcttttgtaaccaacctcaaagcagaggttaatgcaccggatgctgccaaaccagcaaggaaagactaacaataaaaccatgttaaataaattcataagctgaagaatgaagatatcttcaataccactacataat aactatatcattgatgctcacttgaatgaattctggtttcatgtaggagaggtctcccaccattccaccttgaacatgagcatctgcaactccaaaagcaccactaagtgcacatataccgatgaaagttccaagtcctc ctttaccagatgttgctgaattcaactatggcaaattggtaggaaaaataaaataaaaaccatcctaaaggaattaattactcctagttcacaaacaaatgaataggacttacaattaacaccaacaaagtgcttatga aaaaaagtatatatccaaacagattccttagtcgagtattgagtttggcctcattatatgccagtatcgcaagtgttccaactgcgaatggctgatatacaagagtaagcaccctagaggggtggtatttctgcacaagga

[0060] The amplification primers are:

[0061] Gm13_39977464_A_G-F: 5'TGCTGCTTTTGTAACCAACCT3', as shown in SEQ ID NO: 3;

[0062] Gm13_39977464_A_G-R: 5'TCCTTGTGCAGAAATACCACC3', as shown in SEQ ID NO: 4;

[0063] The above specific implementation manner cannot be used as a limitation on the protection scope of the present invention. For those skilled in the art, any substitution, improvement or change made to the implementation manner of the present invention falls within the protection scope of the present invention.

[0064] The matters not described in detail in the present invention are all known technologies to those skilled in the art.

Claims

1. Use of a molecular marker tightly linked to a major gene locus of soybean plant height in soybean plant height trait breeding, characterized in that: The major gene locus is located between 39901295-39990704 on chromosome 13, and the molecular marker is Gm13_39977464_A_G; The nucleotide sequence of Gm13_39977464_A_G is shown in SEQ ID NO: 1 or SEQ ID NO: 2; the polymorphism of the 38th position from the 5' end of Gm13_39977464_A_G is A or G.

2. The use according to claim 1, characterized in that The method for breeding soybean plant height traits comprises the following steps: The genomic DNA of the F2 population generated by the hybridization of the female parent Changnong 16 and the male parent Jilin Cailihua was used as a template for PCR amplification; the amplification primers included a forward primer and a reverse primer, the forward primer sequence was shown in SEQ ID NO: 3; the reverse primer sequence was shown in SEQ ID NO: 4; The PCR amplification products were sequenced and analyzed. If the molecular marker Gm13_39977464_A_G existed in the F2 generation population, and when the 38th base from the 5' end of Gm13_39977464_A_G was G, the plant was short; if the molecular marker Gm13_39977464_A_G existed in the F2 generation population, and when the 38th base from the 5' end of Gm13_39977464_A_G was A, the plant was tall.

3. The use according to claim 2, characterized in that: The PCR amplification reaction system was: 4 μl of 20 ng / μl DNA, 0.5 μl of rTaq enzyme, 15 μl of 3×GC Buffer Ⅰ, 2.5 μl of 2.5 mM dNTPs, 2.5 μl of 2 μM forward and reverse primers, and ddH2O to make up to 30 μl.

4. The use according to claim 3, characterized in that The PCR reaction program was as follows: 94°C for 5 min, then 94°C for 30 s, 58°C for 40 s, and 72°C for 70 s, for 35 cycles, and finally for 10 min at 72°C and insulation at 4°C.

Images