Polycyclic ketone monooxygenase mutants and their use in the synthesis of chiral lazaroids

Abstract

The present application provides a polycyclic ketone monooxygenase mutant, the amino acid sequence of which is obtained by mutation of the amino acid sequence shown in SEQ ID NO. 2, and discloses a method for asymmetric biocatalytic synthesis of a lrazole drug based on the mutant. The enzyme catalyst developed based on the present application can be used to asymmetrically catalyze the synthesis of (R)-rabeprazole, lansoprazole and other lrazole compounds under mild conditions using a whole cell or enzyme protein catalytic method, without the need for chemical catalysts, and is environmentally friendly, being a green biocatalytic synthesis route.

Description

Technical Field

[0001] The invention belongs to the technical fields of biopharmaceuticals and enzyme catalysis, and particularly relates to a polycyclic ketone monooxygenase mutant and application thereof in the synthesis of chiral prazole drugs. Background Art

[0002] Proton pump inhibitors (PPIs) are a widely used class of first-line medications for the treatment of acidic gastric peptic tract disorders. Key PPIs include omeprazole, launched in Sweden in 1988, rabeprazole in Japan in 1997, and pantoprazole in Germany in 1997. These drugs were initially marketed as racemates and hold a significant market share. In 2001, the first chirally pure PPI, esomeprazole (the L-isomer of omeprazole), was launched in the United States and subsequently remained among the top ten best-selling drugs worldwide for many years. In 2009, dexlansoprazole, the second chiral PPI after esomeprazole, was approved by the US FDA. Furthermore, dexlansoprazole exhibits stronger acid suppression, longer duration of inhibition, and improved bioavailability compared to its chiral isomer. Consequently, chiral PPIs are becoming increasingly effective treatments for acidic gastric peptic tract disorders.

[0003] Currently, chiral PPIs are synthesized industrially by chemical methods. However, problems such as expensive chiral catalysts and poor stereoselectivity are common and cannot be avoided in chemical synthesis. The large amount of peracids, H2O2, organic catalysts, organic solvents and other substances used in chemical synthesis can cause harm to the health of workers and the human living environment. The chemical reaction conditions are relatively harsh, and the requirements for production equipment are also very high, which increases the production input cost.

[0004] In response to the call for green living and green manufacturing, biosynthesis, with its advantages of high catalytic selectivity, mild reaction conditions, and environmentally friendly reaction systems, has gradually become a beneficial supplement to chemical synthesis. Although currently available biocatalysts can catalyze the oxidation of substrates including rabeprazole sulfide and lansoprazole sulfide, their oxidation activity is generally low, and the product sulfoxide is easily further oxidized to form the by-product sulfone, leading to difficulties in downstream separation and purification, and insufficient synthesis yields.

[0005] Polycyclic ketone monooxygenase PockeMO is used to synthesize prazole compounds. The catalytic reaction is as follows:

[0006]

[0007] The enzyme synthesizes a stereospecific product, but the synthesis of right-handed rabeprazole and other compounds has the problems of low efficiency and serious by-product sulfone. Therefore, the application provides a novel engineered enzyme catalyst which can effectively improve the selectivity of the synthesis of lansoprazole drugs and realize green and efficient synthesis of lansoprazole drugs. SUMMARY

[0008] In order to solve the above technical problems, the present application carries out site-directed mutagenesis on the amino acid sequence of polycyclic ketone monooxygenase PockeMO by genetic engineering technology, obtains PockeMO mutant with improved activity and greatly reduced by-product sulfone, and realizes the preparation of optically pure lansoprazole compounds at normal temperature and pressure.

[0009] The polycyclic ketone monooxygenase PockeMO has a gene sequence as shown in SEQ ID No. 1 and an amino acid sequence as shown in SEQ ID No. 2. The mutation mode of the polycyclic ketone monooxygenase PockeMO mutant is to mutate the amino acid residues at the specified positions of the amino acid sequence shown in SEQ ID No. 2.

[0010] The specified positions include any one or more of the 532th, 482th, 452th, 451th, 280th and 287th amino acids of the amino acid sequence shown in SEQ ID No. 2.

[0011] As a possible implementation, further, the amino acid residue mutation at the specified position includes any one or more of T280V, K287T, G451T, V452N, S482V and L532Q. Wherein, the mutant format is XnY, X represents the original amino acid residue, n represents the mutation site of the sequence SEQ ID No. 2, and Y is the amino acid residue after mutation.

[0012] As a possible implementation, further, the mutation mode of the polycyclic ketone monooxygenase mutant specifically includes any one of the following amino acid residue replacement modes (the polycyclic ketone monooxygenase mutant is represented by MU x , wherein x represents the number of common mutation sites):

[0013] 1) Single-point mutant MU 1-1 : T280V;

[0014] 2) Single-point mutant MU 1-2 : K287T;

[0015] 3) Single-point mutant MU 1-3 : G451T;

[0016] 4) Single-point mutant MU 1-4 : V452N;

[0017] 5) Single point mutant MU 1-5 :S482V;

[0018] 6) Single point mutant MU 1-6 :L532Q;

[0019] 7) Quadruple-point mutant MU4: K287T / G451T / V452N / L532Q.

[0020] The polycyclic ketone monooxygenase mutant can be used in the synthesis of chiral prazole drugs, wherein the chiral prazole drugs include rabeprazole, lansoprazole and the like.

[0021] The present invention also provides a method for enzymatically synthesizing a chiral prazole compound, comprising:

[0022] Prazole sulfide compounds, NADP + , chiral prazole compounds are synthesized by catalysis of the above-mentioned polycyclic ketone monooxygenase mutant and carbonyl reductase.

[0023] As a possible implementation manner, further, the prazole sulfide compound includes rabeprazole sulfide, lansoprazole sulfide, etc.

[0024] As a possible implementation manner, further, the carbonyl reductase is KRED, the amino acid sequence of KRED is shown in SEQ ID NO.4, and the gene sequence encoding KRED is shown in SEQ ID NO.3.

[0025] As a preferred embodiment, preferably, the enzyme reaction is carried out in Tris-HCl buffer.

[0026] As a possible embodiment, further, the polycyclic ketone monooxygenase mutant and KRED are derived from recombinant Escherichia coli whole cells or cell fragments that co-express the polycyclic ketone monooxygenase mutant and KRED by genetic engineering means, or are recombinant Escherichia coli whole cells or cell fragments that express the polycyclic ketone monooxygenase mutant and KRED separately.

[0027] Furthermore, any of the aforementioned PockeMO mutants was co-expressed with the carbonyl reductase (KRED) in the same cell to catalyze the synthesis of prazole compounds. Taking MU4 as an example, a recombinant expression vector pET-mu4-RBS-lkkred was constructed and transformed into competent E. coli BL21(DE3) cells for culture. Engineered bacteria co-expressing MU4 and KRED were constructed and detected by SDS-PAGE. The bacteria were resuspended in an appropriate amount of Tris-HCl (50mM, pH 8.0) to a 250mg / mL stock solution to obtain a whole-cell suspension of MU4 / KRED.

[0028] The reaction conditions for synthesizing prazole drugs by the above enzyme mutants are as follows: 70g of Escherichia coli whole cells or broken liquid (MU4 / KRED), Tris-HCl buffer (50mM and pH 8.0, 630mL), NADP + The resulting mixture (final concentration of 0.3 mM) was added to a 1-L reactor equipped with four baffles and a two-stage propeller stirrer. The resulting mixture slurry was stirred at 30°C and 500 rpm with an aeration rate of 1 vvm. The reaction was then initiated by adding 5 g of the prazole thioether substrate dissolved in 70 mL of isopropanol. The reaction solution was analyzed for conversion using HPLC, which showed that 99% of the substrate was converted to the prazole compound within 5 hours.

[0029] The polycyclic ketone monooxygenase mutant obtained by the present invention has significantly higher activity than the wild type, and the production of sulfone as a by-product of peroxidation is significantly reduced. x ), build MU x A KRED / KRED Escherichia coli co-expression system was developed and applied to catalyze the oxidation of prazole thioether substrates to synthesize dextrorotatory rabeprazole and dextrorotatory lansoprazole. The carbonyl reductase (KRED) catalyzes the dehydrogenation of isopropanol to regenerate the coenzyme NADPH. These two enzymatic reactions are carried out within the same system to synthesize the target products. This bioenzymatic method for synthesizing prazole drugs offers advantages such as simple operation, low pollution, high synthesis efficiency, and minimal byproduct formation.

[0030] The beneficial effects of the present invention are:

[0031] The polycyclic ketone monooxygenase mutant provided by the present invention has high catalytic activity towards prazole sulfide substrates, low content of the peroxidation byproduct sulfone, a broad substrate spectrum, and good thermal stability. The enzyme catalyst developed by the present invention can be used in asymmetric synthesis reactions of various prazole drugs, thereby achieving the preparation of optically pure prazole drugs. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] 图1 The structure of the complex of PockeMO enzyme and substrate rabeprazole sulfide;

[0033] 图2 The expression combination of PockeMO mutant MU4 and carbonyl reductase KRED and the results of protein electrophoresis detection are shown;

[0034] 图3 This is an HPLC analysis of the reaction solution using chiral column AD-H. The reaction time was 3 hours, and the detection wavelength was 254 nm. The substrate rabeprazole sulfide peaked at 11.2 minutes, (R)-rabeprazole peaked at 15.5 minutes, and the byproduct rabeprazole sulfone peaked at 16.9 minutes. The product isomer (S)-rabeprazole did not elute. DETAILED DESCRIPTION

[0035] To make the objectives, technical solutions, and advantages of the embodiments of the present invention more clear, the technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. All other embodiments obtained by ordinary technicians in this field based on the embodiments of the present invention without making any creative efforts shall fall within the scope of protection of the present invention.

[0036] Example 1: Site-directed mutagenesis of PockeMO

[0037] Protein homology modeling was performed based on the amino acid sequence of PockeMO (SEQ ID NO. 2). The structural model of the PockeMO-coenzyme-substrate complex was constructed by molecular docking. The amino acid residues within 5 angstroms of the FAD and NADP ligand binding regions and the key amino acid residues for substrate channel binding to the substrate were investigated (see Appendix). 图1 ), by mutating amino acid residues at key positions through site-directed mutagenesis to enhance the activity of PockeMO in substrate oxidation. The site-directed mutagenesis involves mutation of one or more sites within the amino acid sequence of SEQ ID NO. 2, including amino acids 532, 482, 452, 451, 280, and 287. The primers used for the site-directed mutagenesis are listed in Table 1.

[0038] Table 1. Primer sequence list

[0039] 引物 序列 T280V-F GGCGCCGTGGCAATTCAGGTTGTTCC T280V-R CTGAATTGCCACGGCGCCGGTACCAAT K287T-F GTTCCGACCCTGGCGAAATACGCA K287T-R CGCCAGGGTCGGAACAACCTGAAT G451T-F CGATGGTAAAACCGTTGATGCAGCAAATCCG G451T-R GCTGCATCAACGGTTTTACCATCGGTATCAAC V452N-F TGGTAAAGGTAACGATGCAGCAAATCCG V452N-R TGCTGCATCGTTACCTTTACCATCGGT S482V-F ACCCCGGTGATTGGTGGTGGTAGCCC S482V-R ACCACCAATCACCGGGGTAACATAACCGGT L532F-F ACCCCGTTTAGCCAGAGCAGCC L532F-R CTGGCTAAACGGGGTAAAAAACAGATT

[0040] The mutation method of the present invention is described here using the example of a lysine 287 to threonine residue. Plasmid PCR was performed using the PockeMO gene (SEQ ID NO. 1) as a template, K287T-F and K287T-R as upstream and downstream primers, and Takara's PrimerStar polymerase. The reaction system was as follows: plasmid template (50 ng / μL), 1 μL each of upstream and downstream primers (10 ng / μL), 2 μL of ddH2O, and 5 μL of 2× PrimeStar. The PCR reaction procedure was as follows: 95°C initial denaturation for 3 minutes, 98°C denaturation for 30 seconds, 60°C annealing for 15 seconds, and 72°C extension for 5 minutes, for 20 cycles, followed by a final extension at 72°C for 5 minutes and a 10-minute incubation at 25°C. Add 1L of Takara's DpnI and digest the template plasmid for 2 hours. Then, 10L of the digested product was transformed into E. coli BL21 (DE3) competent cells, spread on a plate containing 50mg / L kanamycin, and cultured in a 37℃ incubator overnight. Pick a single clone of the transformant and inoculate it into 2.5mL of LB medium containing kanamycin (50mg / L). Wait until the OD value of the bacterial solution reaches 0. 600 After reaching 0.6, 0.1mM IPTG was used to induce protein expression and the conversion activity of the bacteria to rabeprazole sulfide substrate was measured. The transformants with improved activity were sent to a sequencing company for nucleic acid sequencing confirmation. The expressed polycyclic ketone monooxygenase PockeMO mutant was a single point mutant MU 1-2 The mutation methods for other sites are similar to those in this embodiment.

[0041] Example 2: Substrate spectrum determination of whole-cell catalysis of polycyclic ketone monooxygenase PockeMO mutant

[0042] PockeMO and MU4 were induced to express in E. coli, and 250 μL of 100 g / L cell suspension (resuspended in 100 mM Tris-HCl buffer, pH 9.0) was added with 50 μL of 200 mM substrate solution (final concentration 20 mM, solubilized with isopropanol), 0.5 μL of 200 mM NADP + 30L of crude KRED enzyme solution and 170μL of buffer were mixed and incubated at 30°C, 200rpm for 2h. The product yield was determined by HPLC and the conversion rate was calculated. Reaction analysis conditions: The reaction products were analyzed using a Chiralcel AD-H column (4.6mm×250mm) with a mobile phase of isopropanol and n-hexane (10:90 ratio) at a flow rate of 0.8mL / min, an injection volume of 10μL, a column oven temperature of 35°C, and a detection wavelength of 254nm.

[0043] Table 2 Activity test results of PockeMO and its mutants on different substrates

[0044]

[0045] The determination results show that the mutant MU4 significantly enhances the activity of rabeprazole sulfide and lansoprazole sulfide, indicating that the polycyclic ketone monooxygenase PockeMO is improved in the synthesis efficiency of the lazole compound after the technical transformation of the application. In particular, the by-product peroxide sulfone, the wild type PockeMO produces 9.092% rabeprazole sulfone, while the mutant MU4 only generates 0.468% by-product sulfone, and the conversion rate is also improved compared with the wild type PockeMO, indicating that the enzyme molecule modification implemented in the application has significantly improved the catalytic selectivity of the enzyme, reduced the generation of by-products, and the generated rabeprazole product is in the (R) configuration with better pharmacological effect (ee>99%).

[0046] Example 3: Monooxygenase MU4 catalyzed synthesis of optically pure (R)-rabeprazole

[0047] The polycyclic ketone monooxygenase mutant MU4 (amino acid sequence as shown in SEQ ID NO. 6) is encoded by the gene mu4 (gene sequence as shown in SEQ ID NO. 5), and the carbonyl reductase KRED, whose amino acid sequence is shown in SEQ ID NO. 4, is encoded by the gene lkkred (gene sequence as shown in SEQ ID NO. 3). An RBS base fragment is added between the two genes, and the RBS base sequence is TAAGGAGG. The recombinant expression plasmid pET-mu4-RBS-lkkred is constructed according to the standard operation of molecular biology. The recombinant plasmid is transformed into Escherichia coli BL21(DE3) to construct an expression recombinant strain, and is coated on a kanamycin-resistant plate. The Luria-Bertani liquid medium is enlarged and cultured, and the co-expression of MU4 and KRED proteins is induced (see 图2 ). The bacterial cells are resuspended in Tris-HCl buffer (100 mM, pH 8.0) to a wet cell concentration of 200 g / L to prepare a whole-cell catalyst. 350 mL of the whole-cell catalyst is added to a 1 L glass reactor, 0.2 mM of NADP + isopropanol (final concentration 19 mM), and compressed air (0.6 L / min) is introduced. The stirring speed is 600 rpm, and the temperature is controlled at 30°C. The reaction is started. The conversion rate is determined by liquid chromatography analysis at different time points. The conversion rate is 93.0% after 3 h of reaction, and the conversion rate is 99.0% after 5 h of reaction.

[0048] The present application is supported by the Key Project of Fujian Provincial Natural Science Foundation (No. 2021J02022).

[0049] The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit the same. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the various embodiments of the present invention.

Claims

1. A polycyclic ketone monooxygenase mutant, characterized in that The mutation mode of the polycyclic ketone monooxygenase mutant is that the amino acid residue at the specified position of the amino acid sequence shown in SEQ ID No. 2 is mutated; the amino acid residue mutation at the specified position is K287T, G451T, V452N and L532Q.

2. Use of the polycyclic ketone monooxygenase mutant according to claim 1 in the synthesis of chiral prazole drugs, wherein the chiral prazole drugs include rabeprazole or lansoprazole.

3. A method for enzymatically synthesizing a chiral prazole compound, characterized in that: include: Prazole sulfide compounds and NADP + The chiral prazole compound is synthesized by catalysis of the polycyclic ketone monooxygenase mutant according to claim 1 and carbonyl reductase; the prazole thioether compound includes rabeprazole thioether or lansoprazole thioether.

4. The method for enzymatically synthesizing a chiral prazole compound according to claim 3, wherein: The carbonyl reductase is KRED, the amino acid sequence of KRED is shown in SEQ ID NO.4, and the gene sequence encoding KRED is shown in SEQ ID NO.

3.

5. The method for enzymatically synthesizing a chiral prazole compound according to claim 3, wherein: The enzyme reaction was carried out in Tris-HCl buffer.

6. The method for enzymatically synthesizing a chiral prazole compound according to claim 4, wherein: The polycyclic ketone monooxygenase mutant and KRED are derived from recombinant Escherichia coli whole cells or cell fragments co-expressing the polycyclic ketone monooxygenase mutant and KRED by genetic engineering, or are recombinant Escherichia coli whole cells or cell fragments expressing the polycyclic ketone monooxygenase mutant and KRED separately.

Images