Lysine amine dehydrogenase mutant and application thereof in synthesis of chiral amine compounds

Abstract

The present application belongs to the technical field of biotechnology and enzyme engineering, and particularly relates to a lysine amine dehydrogenase mutant and application thereof in synthesis of chiral amine compounds. Specifically, the present application takes lysine amine dehydrogenase LE-AmDH-v1 (i.e. LysEDH F173A) from Geobacillus stearothermophilus (Vasilis Tseliou et al, 2019) as a female parent, and through semi-rational modification and site-directed mutation, a lysine amine dehydrogenase mutant with improved catalytic performance, significantly improved soluble expression and improved temperature stability is screened, and the lysine amine dehydrogenase mutant is used as a catalyst, so that cheap and easily available alpha-tetralone can be used as a substrate to synthesize chiral R-1-tetralylamine with high stereoselectivity and high conversion rate, and therefore the present application has good practical application value.

Description

Technical Field

[0001] This invention belongs to the fields of biotechnology and enzyme engineering technology, specifically relating to a lysine amine dehydrogenase mutant and its application in the synthesis of chiral amine compounds. Background Technology

[0002] The information disclosed in this background section is intended only to enhance understanding of the overall background of the invention and is not necessarily to be construed as an admission or in any way implying that such information constitutes prior art known to those skilled in the art.

[0003] Chiral amines are important intermediates in the synthesis of pharmaceuticals, natural products, fine chemicals, and other valuable compounds. In the United States, approximately 40% of commonly used drugs contain chiral amines as core groups. R-1-Tetrahydronaphthylamine is an important intermediate in the synthesis of organic compounds, and due to its unique chemical structure, it has very high application value in fields such as biology, medicine, pesticides, and new materials. For example, R-1-tetrahydronaphthylamine is an important intermediate in the synthesis of apoptosis protein inhibitors. Apoptosis is one of the mechanisms of cell death, and therefore, this effect can be utilized to play an important role in the treatment of cancer, Alzheimer's disease, and autoimmune diseases. Many researchers have long been interested in its synthesis. Currently, the preparation of R-1-tetrahydronaphthylamine generally involves first preparing the racemic 1-tetrahydronaphthylamine (USP2001003136.2001-07-07; Bio.Med.Chem.2004.12(15):

[0004] 4189-4196) and then resolving it. There are also methods that use asymmetric catalytic reactions to obtain optically pure 1-tetrahydronaphthylamine (J.Org.Chem.2006.71.6859-6862; Tetrahedron Asym.1998.9,4369-4379). However, these methods all have problems such as low product yield and poor optical purity of the final product. In patent publication number CN 104263797A, a method for the chemical catalytic synthesis of chiral R-1-tetrahydronaphthylamine was improved. Although the product yield (over 90%) and optical purity (ee value 99%) are higher than previous methods, the method still suffers from problems such as harsh reaction conditions and cumbersome steps (requiring four steps to obtain the final product). Biocatalytic methods, with their mild reaction conditions, simple steps, high stereoselectivity, and environmental friendliness, are considered an attractive option for overcoming these shortcomings.

[0004] Currently, Vasilis Tseliou et al. (Vasilis Tseliou et al., 2019) have used a one-step enzymatic catalytic reaction to reduce and amination the inexpensive and readily available α-tetrahydronaphthylone to R-1-tetrahydronaphthylamine, achieving an ee > 99% and high stereoselectivity, but the substrate conversion rate is only 79%. Therefore, it is essential to develop a green, efficient, highly stereoselective, and highly convertible method for synthesizing chiral amine compounds, especially R-1-tetrahydronaphthylamine. Summary of the Invention

[0005] To address the problems existing in the prior art, this invention provides a lysine amine dehydrogenase mutant and its application in the synthesis of chiral amine compounds. Specifically, this invention uses the lysine amine dehydrogenase LE-AmDH-v1 (Vasilis Tseliou et al., 2019) from *Geobacillus stearothermophilus* as the parent material. Through semi-rational modification and site-directed mutagenesis, a lysine amine dehydrogenase mutant with improved catalytic performance, significantly improved soluble expression, and improved temperature stability was screened. Using the lysine amine dehydrogenase mutant as a catalyst, chiral R-1-tetrahydronaphthylamine with high stereoselectivity and high conversion rate can be synthesized using inexpensive and readily available α-tetrahydronaphthylone as a substrate. Based on the above research results, this invention is thus completed.

[0006] Specifically, the present invention relates to the following technical solutions:

[0007] In a first aspect, the present invention provides a lysine amine dehydrogenase mutant, which is obtained by mutating one or more amino acid sites from the 156th, 157th, 158th, 169th, 181st, 182nd, 217th, 219th, 220th, 221st, 222nd, and 238th amino acid sites of lysine amine dehydrogenase LE-AmDH-v1 (i.e., LysEDH F173A), wherein the amino acid sequence of the lysine amine dehydrogenase LE-AmDH-v1 is shown in SEQ ID NO.3.

[0008] Furthermore, the lysine amine dehydrogenase variant is a mutation based on the above-mentioned lysine amine dehydrogenase LE-AmDH-v1, and the lysine amine dehydrogenase variant is selected from any one or more mutants in the following group: V156A, G157A, G158A, Y169A, H181A, Y182A, F217A, T219A, S220A, G221A, G222A, H181A / Y238A, F217A / Y238A, S220A / Y238A.

[0009] In a second aspect, the present invention provides a deoxyribonucleic acid molecule, said deoxyribonucleic acid molecule being the parent of the above-mentioned lysine amine dehydrogenase mutant.

[0010] A third aspect of the present invention provides a recombinant expression vector containing the deoxyribonucleic acid molecule described in the second aspect above, or a DNA sequence mutated from the deoxyribonucleic acid molecule as the parent.

[0011] In a fourth aspect, the present invention provides a host cell capable of expressing the recombinant expression vector described in the third aspect or a chromosome integrated with the deoxyribonucleic acid molecule described in the second aspect.

[0012] A fifth aspect of the present invention provides a method for preparing the above-mentioned lysine amine dehydrogenase variant, comprising: culturing the host cells described in the fourth aspect above to express the lysine amine dehydrogenase variant protein; and isolating and purifying the lysine amine dehydrogenase variant pure enzyme.

[0013] A sixth aspect of the present invention provides the application of the lysine amine dehydrogenase variant described in the first aspect, the deoxyribonucleic acid molecule described in the second aspect, the recombinant expression vector described in the third aspect, and the host cell described in the fourth aspect in the field of chiral amine synthesis.

[0014] The chiral amine may be R-1-tetrahydronaphthylamine.

[0015] A seventh aspect of the present invention provides a method for synthesizing a chiral amine, the method comprising adding the above-mentioned lysine amine dehydrogenase mutant to a mixed system containing a ketone substrate, an amino donor and a coenzyme regeneration system to carry out a reductive amination reaction to obtain a chiral amine.

[0016] An eighth aspect of the present invention provides a method for detecting the preparation of chiral amines from the above-mentioned lysine amine dehydrogenase mutant, the method comprising: adding a strong base to the catalytic reaction system to terminate the reaction, adding an extractant to extract the substrate and product in the reaction system, adding a dehydrating agent to remove excess water, and detecting the substrate and product using a gas chromatograph.

[0017] A ninth aspect of the present invention provides a method for improving the temperature stability of the lysine amine dehydrogenase mutant, the method comprising: adding glycerol to a (liquid) system containing the lysine amine dehydrogenase mutant, thereby improving its temperature stability.

[0018] The beneficial technical effects of one or more of the above technical solutions:

[0019] The above technical solution provides a lysine amine dehydrogenase mutant derived from the genome of Geobacillus stearothermophilus. This mutant protein significantly improves the catalytic activity of the sterically hindered substrate α-tetrahydronaphthone, with a substrate conversion rate >90% and an ee value of >99% for the product. Compared with the 79% substrate conversion rate of the enzyme mutant F173A in the existing study, the enzyme mutant in the above technical solution significantly improves the substrate conversion rate.

[0020] The lysine amine dehydrogenase mutant provided by the above technical solution showed good soluble expression, and the amount of inclusion bodies was significantly reduced compared with the enzyme mutant F173A in the existing study.

[0021] The above-mentioned technical solution provides a lysine amine dehydrogenase mutant that exhibits a higher substrate conversion rate at various time points of the enzymatic reaction compared to the existing mutant F173A. In other words, to achieve the same conversion rate, the lysine amine dehydrogenase mutant of this invention requires a shorter enzymatic reaction time, which makes it possible to effectively reduce time costs for large-scale industrial production.

[0022] The catalytic reaction system and reaction conditions provided by the above technical solution enable the mutant F173A to increase the conversion rate of the substrate α-tetrahydronaphthone from 79% in existing studies to 85.85%.

[0023] In summary, the above-mentioned technical solution provides a simple reaction procedure for synthesizing chiral pure R-1-tetrahydronaphthylamine, requiring only one step. The substrate α-tetrahydronaphthone is inexpensive and readily available, which effectively reduces the raw material cost for large-scale industrial production and thus has good practical application value. Attached Figure Description

[0024] The accompanying drawings, which form part of this invention, are used to provide a further understanding of the invention. The illustrative embodiments of the invention and their descriptions are used to explain the invention and do not constitute an improper limitation of the invention.

[0025] Figure 1 Agarose gel electrophoresis image of E. coli BL21(DE3) / (pET-24a(+)-LysEDH) transformants verified by PCR;

[0026] Figure 2 Agarose gel electrophoresis image of E. coli BL21(DE3) / (pET-24a(+)-LysEDH)F173A transformant verified by PCR;

[0027] Figure 3Transformants of mutants V156A, G157A, G158A, Y169A, H181A, Y182A, F217A, T219A, S220A, G221A, and G222A were constructed and verified by PCR, and the resulting agarose gel electrophoresis images were obtained.

[0028] Figure 4 Transformants constructed from H181A / Y238A, F217A / Y238A, and S220A / Y238A combined mutants were verified by PCR and agarose gel electrophoresis.

[0029] Figure 5 Protein expression diagram;

[0030] Figure 6 Inclusion body diagram;

[0031] Figure 7 : Substrate conversion at different times catalyzed by mutants F173A / S220A and F173A. Detailed Implementation

[0032] It should be noted that the following detailed descriptions are illustrative and intended to provide further explanation of this application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application pertains.

[0033] It should be noted that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit the exemplary embodiments according to this application. As used herein, the singular form is intended to include the plural form as well, unless the context clearly indicates otherwise. Furthermore, it should be understood that when the terms "comprising" and / or "including" are used in this specification, they indicate the presence of features, steps, operations, devices, components, and / or combinations thereof. Experimental methods in the following specific embodiments, unless specific conditions are specified, are generally performed according to conventional methods and conditions in molecular biology within the art, which are fully explained in the literature. See, for example, the techniques and conditions described in Sambrook et al., *Molecular Cloning: A Laboratory Manual*, or according to the conditions recommended by the manufacturer.

[0034] In a typical embodiment of the present invention, a lysine amine dehydrogenase mutant is provided. The lysine amine dehydrogenase mutant is obtained by mutating any one or more amino acid sites from 156, 157, 158, 169, 181, 182, 217, 219, 220, 221, and 222, based on lysine amine dehydrogenase LE-AmDH-v1. The amino acid sequence of the lysine amine dehydrogenase LE-AmDH-v1 is shown in SEQ ID NO.3.

[0035] In another specific embodiment of the present invention, the amino acid sequence of the lysine amine dehydrogenase mutant has at least 80% homology with SEQ ID NO.3; more preferably, it has at least 90% homology; most preferably, it has at least 95% homology; such as having at least 95%, 96%, 97%, 98%, or 99% homology.

[0036] In another specific embodiment of the present invention, the lysine amine dehydrogenase variant is a mutation based on the above-mentioned lysine amine dehydrogenase LE-AmDH-v1, and the lysine amine dehydrogenase variant is selected from any one or more mutants in the following group: V156A, G157A, G158A, Y169A, H181A, Y182A, F217A, T219A, S220A, G221A, G222A, H181A / Y238A, F217A / Y238A, S220A / Y238A.

[0037] In another specific embodiment of the present invention, the number of mutation sites in the lysine amine dehydrogenase variant is 1-5, more preferably 1-3, such as 1, 2 or 3.

[0038] In another specific embodiment of the present invention, a deoxyribonucleic acid molecule is provided, wherein the deoxyribonucleic acid molecule is the parent of the above-mentioned lysine amine dehydrogenase mutant.

[0039] In another specific embodiment of the present invention, a recombinant expression vector is provided, wherein the recombinant expression vector contains the above-mentioned deoxyribonucleic acid molecule or a DNA sequence mutated from the deoxyribonucleic acid molecule as the parent.

[0040] In another specific embodiment of the present invention, the recombinant expression vector is obtained by effectively linking the above-mentioned deoxyribonucleic acid molecules to the expression vector. The expression vector is any one or more of a viral vector, plasmid, bacteriophage, phage particle, granule, or artificial chromosome. The viral vector may include adenovirus vector, retrovirus vector, or adeno-associated virus vector. The artificial chromosome includes bacterial artificial chromosome, bacteriophage P1-derived vector, yeast artificial chromosome, or mammalian artificial chromosome. Preferably, the expression vector is a plasmid. In one specific embodiment of the present invention, the plasmid is pET24a.

[0041] In another specific embodiment of the present invention, a host cell is provided, wherein the host cell contains the above-mentioned recombinant expression vector or the above-mentioned deoxyribonucleic acid molecule is integrated into the chromosome.

[0042] The host cell can be a prokaryotic cell or a eukaryotic cell.

[0043] In another specific embodiment of the present invention, the host cell is any one or more of bacterial cells and fungal cells;

[0044] The bacterial cells mentioned therein are any species within the genera Escherichia, Agrobacterium, Bacillus, Streptomyces, Pseudomonas, or Staphylococcus;

[0045] In another specific embodiment of the present invention, the bacterial cells are Escherichia coli (such as Escherichia coli BL21(DE3)), Agrobacterium tumefaciens (such as GV3101), Agrobacterium rhizogenes, Lactococcus lactis, Bacillus subtilis, Bacillus cereus, or Pseudomonas fluorescens.

[0046] The fungal cells include yeasts (such as Pichia pastoris).

[0047] In another specific embodiment of the present invention, a method for preparing the above-mentioned lysine amine dehydrogenase variant is provided, comprising the steps of: culturing the above-mentioned host cells of the present invention to express the lysine amine dehydrogenase variant protein; and isolating and purifying the lysine amine dehydrogenase variant pure enzyme.

[0048] In another specific embodiment of the present invention, the application of the above-mentioned lysine amine dehydrogenase variant, deoxyribonucleic acid molecule, recombinant expression vector, and host cell in the field of chiral amine synthesis is provided.

[0049] The chiral amine may be R-1-tetrahydronaphthylamine.

[0050] In another specific embodiment of the present invention, a method for synthesizing a chiral amine is provided, the method comprising adding the above-mentioned lysine amine dehydrogenase mutant into a mixed system containing a ketone substrate, an amino donor and a coenzyme regeneration system to carry out a reductive amination reaction to obtain a chiral amine.

[0051] The ketone substrate may be α-tetrahydronaphthone (Formula I).

[0052]

[0053] The chiral amine may be R-1-tetrahydronaphthylamine (Formula II).

[0054]

[0055] The specific reaction of the reductive amination is shown in Formula III:

[0056]

[0057] The coenzyme regeneration system uses formate dehydrogenase as the coenzyme regeneration enzyme and ammonium formate as the coenzyme regeneration substrate, and includes NADH and NAD. + The formate dehydrogenase coenzyme regeneration system.

[0058] In another specific embodiment of the present invention, the amino donor is an ammonia / ammonium formate buffer solution, 1M-2M.

[0059] In another specific embodiment of the present invention, the amount of formate dehydrogenase added is 5-20 μM.

[0060] In another specific embodiment of the present invention, the cofactor NAD + The amount added is 0.5-1 mM.

[0061] In another specific embodiment of the present invention, the temperature of the reductive amination reaction is 20-70°C, and the pH value of the reaction system is 7-10.

[0062] In another specific embodiment of the present invention, the substrate concentration of the reductive amination reaction is 10 mM to 100 mM.

[0063] In another specific embodiment of the present invention, the amount of lysine amine dehydrogenase added is 30-100 μM.

[0064] In another specific embodiment of the present invention, a method for detecting the preparation of chiral amines by the above-mentioned lysine amine dehydrogenase mutant is provided. The method comprises: adding a strong base to the catalytic reaction system to terminate the reaction, adding an extractant to extract the substrate and product in the reaction system, adding a dehydrating agent to remove excess water, and using a gas chromatograph to detect the substrate and product.

[0065] In another specific embodiment of the present invention, the strong base is KOH, 5M-10M.

[0066] In another specific embodiment of the present invention, the extractant is dichloromethane, 100μl-1000μl.

[0067] In another specific embodiment of the present invention, the dehydrating agent is anhydrous magnesium sulfate, 0.1g-1g.

[0068] In another specific embodiment of the present invention, a method for improving the temperature stability of the lysine amine dehydrogenase mutant is provided, the method comprising: adding glycerol to a (liquid) system containing the lysine amine dehydrogenase mutant, thereby improving its temperature stability.

[0069] In another specific embodiment of the present invention, the amount of glycerol added is 10% to 50% of the total system volume.

[0070] In another specific embodiment of the present invention, the improved temperature stability is manifested in an increase in the Tm value of 4-6°C.

[0071] The following examples further illustrate the present invention, but do not constitute a limitation thereof. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the invention.

[0072] Example 1: Construction of recombinant engineered E. coli BL21(DE3) / (pET-24a(+)-LysEDH)

[0073] The gene sequence of lysine amine dehydrogenase (LysEDH) was submitted to our company for codon optimization for the *E. coli* expression system and full-length synthesis was performed. The optimized gene sequence is shown in SEQ ID NO.2. Primers were designed based on the sequence in SEQ ID NO.2: pET24a-LysEDH-F: GGATCCATGAAAGTTCTGGTTCTGGGCG.

[0074] pET24a-LysEDH-R:GAGCTCTTCCAGGCTGTGAACGGTAC, LysEDH was ligated to the pET-24a(+) plasmid (with a His-tag purification tag added to the C-terminus) to construct the recombinant plasmid pET-24a(+)-LysEDH. This recombinant plasmid was transformed into E. coli BL21(DE3) competent cells, and positive clones were screened by colony PCR. Figure 1 The recombinant engineered bacteria E. coli BL21(DE3) / (pET-24a(+)-LysEDH) containing the LysEDH gene was obtained by sequencing and verification.

[0075] Example 2: Construction of the mutant E. coli BL21(DE3) / (pET-24a(+)-LysEDH)F173A

[0076] Using the recombinant plasmid pET-24a(+)-LysEDH as a template, primers were designed (see Table 1). The recombinant plasmid pET-24a(+)-LysEDH F173A was constructed using the overlap extension PCR method. This recombinant plasmid was then transformed into E. coli BL21(DE3) competent cells, thus obtaining the mutant E. coli BL21(DE3) / (pET-24a(+)-LysEDH)F173A( Figure 2 ).

[0077] Table 1 Primers used for constructing mutant E. coli BL21(DE3) / (pET-24a(+)-LysEDH)F173A Table 1 Primers used for constructing mutant E. coli BL21(DE3) / (pET-24a(+)-LysEDH)F173A

[0078]

[0079] Example 3: Semi-rational design for screening mutants that improve the conversion rate of α-tetrahydronaphthol

[0080] By site-directed mutagenesis of amino acids near the substrate pocket to alanine, which has a smaller side chain, the substrate pocket space is increased, thereby improving the conversion rate of the sterically hindered substrate α-tetrahydronaphthylone. In the steric structure of LysEDH F173A, as shown in SEQ ID NO.3, amino acid residues V156, G157, G158, Y169, H181, Y182, F217, T219, S220, G221, and G222 are located around the α-tetrahydronaphthylone binding site. Based on the F173A mutant, site-directed mutagenesis was used to mutate these amino acid residues to alanine.

[0081] The template used was the recombinant plasmid pET-24a(+)-LysEDH F173A.

[0082] The primers used are shown in Table 2:

[0083] Table 2 Primers used for constructing mutants near the substrate binding pocket.

[0084]

[0085]

[0086] Using DpnI site-directed mutagenesis:

[0087] PCR (50 μl): Phanta Max Super-Fidelity DNA Polymerase 1 μl, 2×Phanta Max Buffer 25 μl, Primer F: 2 μl, Primer R: 2 μl, Template: 2 μl, dNTPs: 1 μl, ddH2O: 17 μl; Program: 95℃ for 3 min, 30 cycles (95℃ for 15 sec, 55℃ for 15 sec, 72℃ for 3 min and 15 sec), 72℃ for 5 min, 4℃ ±∞.

[0088] DpnI enzyme digestion at 37℃ for 30-60 min (30 μl): ddH2O 17 μl, 10× Buffer 2 μl, PCR product 10 μl, DpnI enzyme 1 μl.

[0089] After DpnI enzyme digestion, 10 μl was transferred into E. coli BL21(DE3) competent cells, and colony PCR was used for verification. Figure 3 ), and preserve the positive transformants corresponding to each mutation site.

[0090] Example 4 Construction of Combined Mutants

[0091] Based on the transformation efficiency results of the single-point mutants in Example 3, the F173A / H181A, F173A / F217A, and F173A / S220A mutants with improved transformation efficiency were selected for further combined mutagenesis. Using the recombinant plasmids pET-24a(+)-LysEDH F173A / H181A, pET-24a(+)-LysEDH F173A / F217A, and pET-24a(+)-LysEDH F173A / S220A as templates, the tyrosine at position 238 was mutated to alanine to construct the three-point combined mutants F173A / H181A / Y238A, F173A / F217A / Y238A, and F173A / S220A / Y238A. Figure 4 ).

[0092] The primers used are shown in Table 3:

[0093] Table 3 Primers for combined mutations

[0094]

[0095] The DpnI site-directed mutagenesis method was used, as detailed in Example 3.

[0096] Example 5 Protein Expression and Purification

[0097] Each mutant was cultured in LB medium at 37°C and 200 rpm until OD. 600 Between 0.6 and 0.8, IPTG inducer was added to a final concentration of 0.5 mM, and the cells were cultured at 16°C and 100 rpm for 16 h. Cells were collected at 6000 rpm and 4°C for 10 min. The cells were then disrupted using high-pressure polymerization at 12000 rpm and 4°C for 30 min. The supernatant was filtered through a 0.22 μm filter and purified using a conventional nickel column purification method. Figure 5 ).Depend on Figure 5 It can be seen that the mutants of this invention exhibit good soluble expression, combined with Figure 6 It can be seen that the inclusion bodies produced by the mutant F173A / S220A are significantly fewer than those produced by F173A.

[0098] Example 6: Gas phase detection of the conversion rate of mutant protein to α-tetrahydronaphthol

[0099] Enzymatic reaction (500 μl): α-Tetrahydronaphthol 10 mM, LysEDH mutant protein 90 μM, formate dehydrogenase 19 μM, NAD +1 mM HCOONH4 / NH3 buffer (2 M, pH 9.0), 50 °C, 80 rpm, 48 h. The reaction was terminated by adding 100 μl KOH (10 M), extracted with 600 μl dichloromethane, and excess water was removed with anhydrous magnesium sulfate. The substrate conversion was detected by gas chromatography. The results are shown in Table 4. Figure 7 As shown in Table 4, compared to F173A, the conversion rate of the mutant F173A / S220A to the substrate is significantly improved. Furthermore, the conversion rate of F173A to the substrate in this invention is 85.85%, which is significantly higher than the 79% in existing studies, indicating that the catalytic reaction system and conditions provided by this invention can also significantly improve the conversion rate. According to... Figure 7 It is known that the mutant F173A / S220A exhibits a higher substrate conversion rate at various time points of the enzymatic reaction compared to the existing mutant F173A. In other words, the lysine amine dehydrogenase mutant of this invention requires a shorter enzymatic reaction time to achieve the same conversion rate, which provides a possibility for effectively reducing time costs in large-scale industrial production.

[0100] Table 4 Substrate Conversion Rate

[0101]

[0102] Example 7: Determination of the melting temperature (Tm) of the LysEDH mutant

[0103] The Tm value of the LysEDH mutant was detected by differential fluorescence scanning using a Roche 480 qPCR instrument in HCOONH3 / NH4 buffer (pH 9, 2M). Each reaction solution (20 μl) contained SYPRO (20x) and enzyme (2 μg). For selected measurements, coenzyme NAD+ was added. + The enzyme was prepared using either 100 μM glycerol or 100 μM ligand (α-tetrahydronaphthone). Fluorescence data were collected from continuous standard melting curves from 25–95 °C (1 °C / min, holding at 25 °C for 2 min, then at 95 °C for 2 min). Four replicates were prepared for each condition, and an enzyme-free negative control was also prepared. The results are summarized in Table 5. Table 5 shows that the mutant F173A / S220A did not affect the protein's inherent temperature stability; on the contrary, the Tm value increased by 0.6–2.6 °C. Furthermore, the addition of glycerol effectively increased the protein's Tm value.

[0104] Table 5 Tm value detection

[0105]

[0106] Amino acid and nucleotide sequence information used in this invention

[0107] SEQ ID NO.1

[0108] MKVLVLGAGLMGKEAARDLVQSQDVEAVTLADVDLAKAEQTVRQLHSKKLAAVRVDAGDPQQLAAAMKGHDVVVNALFYQFNETVAKTAIETGVHSVDLGGHIGHITDRVLELHERAQAAGVTIIPDLGVAPGMINILSGYGASQLDEVESILLYVGGIPVRPEPPLEYNHVFSLEGLLDHYTDPALIIRNGQKQEVPSLSEVEPIYFDRFGPLEAFHTSGGTSTLSRSFPNLKRLEYKTIRYRGHAEKCKLLVDLTLTRHDVEVEINGCRVKPRDVLLSVLKPLLDLKGKDDVVLLRVIVGGRKDGKETVLEYETVTFNDRENKVTAMARTTAYTISAVAQLIGRGVITKRGVYPPEQIVPGDVYMDEMKKRGVLISEKRTVHSLE

[0109] SEQ ID NO.2

[0110] ATGAAAGTTCTGGTTCTGGGCGCGGGTCTGATGGGTAAAGAAGCGGCGCGTGATCTGGTTCAGAGCCAGGATGTTGAAGCGGTTACTCTGGCTGACGTTGATCTGGCGAAAGCCGAACAGACCGTTCGTCAGCTGCATAGCAAAAAACTGGCGGCTGTTCGTGTTGATGCGGGTGACCCGCAGCAGCTGGCTGCGGCGATGAAAGGCCACGATGTTGTTGTTAACGCACTGTTCTATCAGTTCAACGAAACCGTTGCTAAAACCGCGATTGAAACCGGCGTTCATTCTGTTGATCTGGGCGGTCACATCGGTCACATTACCGATCGTGTTCTGGAACTGCACGAACGCGCGCAGGCGGCAGGCGTTACCATCATCCCGGATCTGGGCGTTGCACCGGGTATGATTAACATCCTGAGCGGTTACGGTGCTAGCCAGCTGGATGAAGTTGAATCTATCCTGCTGTACGTTGGTGGTATCCCGGTTCGTCCGGAACCGCCGCTGGAATACAACCACGTTTTCAGCCTGGAAGGCCTGCTGGATCACTACACCGATCCGGCGCTGATCATCCGTAACGGTCAGAAACAGGAAGTGCCGTCCCTGTCTGAAGTTGAACCGATCTACTTCGATCGTTTCGGTCCGCTGGAAGCTTTCCACACCTCTGGTGGTACCTCCACCCTGAGCCGTTCTTTCCCGAACCTGAAACGTCTGGAATATAAAACCATTCGTTATCGTGGTCACGCGGAAAAATGTAAACTGCTGGTTGATCTGACCCTGACCCGTCATGATGTTGAAGTTGAAATCAACGGCTGTCGTGTTAAACCGCGTGATGTTCTGCTGAGCGTGCTGAAACCGCTGCTGGATCTGAAAGGTAAAGATGATGTTGTTCTGCTGCGTGTTATCGTTGGCGGCCGTAAAGATGGTAAAGAAACCGTTCTGGAATACGAAACCGTTACCTTCAACGATCGTGAAAACAAAGTTACCGCGATGGCTCGTACCACCGCTTATACCATCTCTGCTGTTGCGCAGCTGATCGGCCGTGGCGTTATCACCAAACGTGGTGTTTACCCGCCGGAACAGATCGTTCCGGGTGATGTTTACATGGATGAAATGAAAAAACGTGGTGTTCTGATCTCTGAAAAACGTACCGTTCACAGCCTGGAA

[0111] SEQ ID NO.3

[0112] MKVLVLGAGLMGKEAARDLVQSQDVEAVTLADVDLAKAEQTVRQLHSKKLAAVRVDAGDPQQLAAAMKGHDVVVNALFYQFNETVAKTAIETGVHSVDLGGHIGHITDRVLELHERAQAAGVTIIPDLGVAPGMINILSGYGASQLDEVESILLYVGGIPVRPEPPLEYNHVASLEGLLDHYTDPALIIRNGQ KQEVPSLSEVEPIYFDRFGPLEAFHTSGGTSTLSRSFPNLKRLEYKTIRYRGHAEKCKLLVDLTLTRHDVEVEINGCRVKPRDVLLSVLKPLLDLKGKDDVVLLRVIVGGRKDGKETVLEYETVTFNDRENKVTAMARTTAYTISAVAQLIGRGVITKRGVYPPEQIVPGDVYMDEMKKRGVLISEKRTVHSLE

[0113] Finally, it should be noted that the above descriptions are merely preferred embodiments of the present invention and are not intended to limit the present invention. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or make equivalent substitutions for some of the technical features. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A lysine amine dehydrogenase mutant, characterized in that, The lysine amine dehydrogenase mutant was obtained by mutating the 220th amino acid site on the basis of lysine amine dehydrogenase LE-AmDH-v1, wherein the amino acid sequence of the lysine amine dehydrogenase LE-AmDH-v1 is shown in SEQ ID NO.3; The lysine amine dehydrogenase mutant is a mutation based on the above-mentioned lysine amine dehydrogenase LE-AmDH-v1, and the lysine amine dehydrogenase mutant is selected from S220A.

2. A deoxyribonucleic acid molecule, characterized in that, The deoxyribonucleic acid molecule encodes the lysine amine dehydrogenase mutant of claim 1.

3. A recombinant expression vector, characterized in that, The recombinant expression vector contains the deoxyribonucleic acid molecule as described in claim 2.

4. A host cell, characterized in that, The host cell is capable of expressing the recombinant expression vector of claim 3 or the deoxyribonucleic acid molecule of claim 2 integrated into a chromosome.

5. A method for preparing the lysine amine dehydrogenase mutant of claim 1, characterized in that, include: The host cells of claim 4 are cultured to express the lysine amine dehydrogenase mutant protein; Additionally, the lysine amine dehydrogenase mutant was isolated and purified.

6. The application of the lysine amine dehydrogenase mutant of claim 1, the deoxyribonucleic acid molecule of claim 2, the recombinant expression vector of claim 3, and the host cell of claim 4 in the field of chiral amine synthesis; The chiral amine is R-1-tetrahydronaphthylamine.

7. A method for synthesizing a chiral amine, characterized in that, The synthesis method includes adding the lysine amine dehydrogenase mutant of claim 1 into a mixed system containing a ketone substrate, an amino donor and a coenzyme regeneration system to carry out a reductive amination reaction to obtain a chiral amine; The ketone substrate is α-tetrahydronaphthone (Formula I); Formula I The chiral amine is R-1-tetrahydronaphthylamine (Formula II); Formula II The specific reaction of the reductive amination is shown in Formula III; Formula III.

8. A method for detecting the preparation of chiral amines, characterized in that, The method includes: adding a strong base to the catalytic reaction system of the synthesis method of claim 7 to terminate the reaction, adding an extractant to extract the substrate and product in the reaction system, adding a dehydrating agent to remove excess water, and using a gas chromatograph to detect the substrate and product.

9. A method for improving the temperature stability of the lysine amine dehydrogenase mutant according to claim 1, characterized in that, The method includes adding glycerol to a system containing the lysine amine dehydrogenase mutant.

10. A method for improving the temperature stability of a lysine amine dehydrogenase mutant as described in claim 9, characterized in that, The amount of glycerol added is 10% to 50% of the total system volume.

Images