Application of VPS13A expression promoter in the preparation of drugs for the diagnosis and treatment of depression

Abstract

The present invention relates to the field of biomedicine, and particularly to the application of a VPS13A expression promoter in the preparation of drugs for the diagnosis and treatment of depression. The invention constructed a depression model by specifically knocking down VPS13A in mouse microglia, which led to damage of neurons in the prefrontal cortex and hippocampus of mice, activation of microglia in the prefrontal cortex, and the emergence of depressive-like behaviors. On the other hand, by promoting the expression of VPS13A to activate autophagy, inhibiting the pro-inflammatory activation of microglia, and improving depressive-like behaviors, the feasibility of using it as a drug target was verified. The present invention also provides the application of Xiaoyaosan and ligustilide H in the preparation and prevention of drugs for depression, in order to provide new references for the research on the molecular mechanism of Xiaoyaosan in antidepressant effects and new directions for the research and development of ligustilide H as a new antidepressant drug.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine, and particularly to the application of a VPS13A expression promoter in the preparation of a drug for the diagnosis and treatment of depression. Background Art

[0002] Vacuolar Protein Sorting 13 (VPS13) has a conserved domain in eukaryotes and is a class of high-molecular-weight proteins. The currently discovered members of the VPS13 family include VPS13A (also known as Chorein), VPS13B, VPS13C, and VPS13D. It is reported that the loss of function caused by gene mutations in VPS13 family proteins can lead to hereditary neurological diseases. The VPS13A-D genes are respectively associated with the early onset of chorea-acanthocytosis (ChAc), Cohen syndrome, Parkinson's disease, and spastic ataxia, and are involved in the pathophysiological regulation of neurological diseases. The VPS13A protein is a lipid transport protein composed of 3,174 amino acids encoded by the VPS13A gene, mainly located at the membrane contact sites between the endoplasmic reticulum and other organelles such as mitochondria, and is involved in regulating protein recycling processes such as the recycling transport between endosomes and the Golgi complex, maintaining the integrity of the mitochondrial membrane, and phosphatidylinositol metabolism. Studies have found that VPS13A partially co-localizes with synaptotagmin I in dense core vesicles at the ends of extended neurites of differentiated PC12 cells and mediates the release of dopamine. The functional defect of VPS13A will cause apoptosis of striatal neurons in ChAc model mice and is involved in the control of neurodegenerative diseases. In KD primary mouse prefrontal cortex (PFC) neurons, a higher degree of branched structure and decreased levels of BDNF and PSD-95 can be observed. VPS13A KD mice exhibit ChAc-like movement disorders and mouse cortico-striatal dysfunction, induce a decrease in the release of CX3CL1 neurons, and trigger microglial responses, suggesting that VPS13A is involved in the regulation of synaptic plasticity related to neuronal connections. In addition, VPS13A plays a role in membrane trafficking and phagocytosis in simple organisms such as Saccharomyces cerevisiae and Tetrahymena thermophila, and is involved in the regulation of the actin cytoskeleton in mammalian endothelial cells, red blood cells, and platelets.

[0003] Recent studies have found that VPS13A has a similar structure and function to the autophagy factor Atg2, mediates the transport of liposomes, and there is a conserved interaction between VPS13A and Rab7a. RAB7A is a key participant in endosomal trafficking and the lysosomal pathway. VPS13A is recruited to endocytic vesicles by the autophagy initiation protein complex through its interaction with Rab7A and participates in the movement, maturation of autophagosomes and endocytic vesicles, and their fusion with lysosomes. Defects in the VPS13A protein lead to the accumulation of autophagy markers (such as LC3 I / II, WIPI1, and GFP) and impaired autophagic flux, mitochondrial dysfunction, abnormal lysosomal degradation pathways, and calcium homeostasis disorders. Mitochondrial dysfunction leads to lysosomal damage and the accumulation of autophagic by-products. Conversely, lysosomal deficiency causes mitochondrial functional and morphological defects and ultimately leads to neurodegeneration. Studies have found that overexpression of VPS13A reduces the accumulation of Drosophila p62 homolog and ubiquitin-positive aggregates in the central nervous system, indicating that VPS13A may be involved in the autophagic clearance process of brain neurons. Compared with wild-type mice, in VPS13A - / - mice, there is a decrease in neurons in the cerebral cortex, activation of microglia, activation of the NF-κB signaling pathway, and upregulation of the IL-1β level; studies on the molecular mechanism have found that neuroinflammation in VPS13A - / - mice is related to abnormal autophagic flux and depends on the Beclin-1 pathway. Treatment with nilotinib can restore the autophagic defect in the cerebral cortex of VPS13A - / - mice and thus alleviate neuroinflammation. VPS13A plays an important regulatory role in autophagy and exerts an inhibitory effect on neuroinflammation by regulating autophagy, participating in the functional regulation of the nervous system.

[0004] As one of the important causes of the global disease burden, depression is characterized by high incidence, high suicide, disability and recurrence rates, affecting the physical and mental health of more than 350 million people globally. Depression involves multiple pathological mechanisms such as neuroendocrine disorders, reduced neurotransmitters, decreased neural plasticity, and neuroinflammatory damage. The disease has a long course, slow clinical treatment effect, certain adverse reactions, and poor prognosis. Therefore, the exploration of the molecular mechanism of depression and the research on antidepressant drug targets have important scientific significance and clinical value. Studies have shown that there are changes in the expression levels of autophagy markers in the brains and peripheral blood of depression patients, and a variety of antidepressants can mediate an increase in autophagy levels, and can relieve depressive symptoms by reducing the level of neuroinflammation. Depression causes neuronal damage, loss and dysfunction in multiple brain regions such as the prefrontal cortex (PFC), hippocampus (HP) and limbic system. Autophagy plays a therapeutic role in depression by controlling axonal endoplasmic reticulum to regulate presynaptic neurotransmission and preventing neurodegeneration associated with the accumulation of cytoplasmic aggregated proteins, and mediating neural plasticity. VPS13A is involved in the autophagolysosomal degradation pathway and mediates the synthesis and activity regulation of the NOD-like receptor thermal protein domain associated protein 3 (NLRP3) inflammasome complex. The changes in its expression level and functional effects play an important role in the level of neuroinflammation and behavior in depression.

[0005] Depression is mainly characterized by significant and persistent low mood, belonging to the category of "depressive syndrome" in traditional Chinese medicine, which is a disease caused by emotional discomfort and qi stagnation. In "Classified Treatises on Patterns and Their Treatment - Depressive Syndrome", it is said that "depression caused by internal emotional factors first damages qi, then necessarily affects blood, and finally leads to consumption." When emotions are stagnated, qi and blood are out of balance, the spirit is weak, diet is irregular, and sleep is disrupted. The famous Qing Dynasty doctor He Mengyao mentioned in "Medical Insights": "When there is depression, there is discomfort, and it is all a disease of the liver wood." When the liver qi is stagnated and qi movement is not smooth, qi and blood are not flowing smoothly, and the zang-fu organs are out of harmony. The clinical treatment of depression mainly focuses on soothing the liver and relieving depression. Xiao Yao San was first recorded in "Taiping Huimin Heji Jufang" compiled by the Imperial Medical Bureau in the Song Dynasty. It consists of eight traditional Chinese medicines: Bupleurum chinense, Angelica sinensis, Paeonia lactiflora, Atractylodes macrocephala, Poria cocos, Zingiber officinale, Mentha haplocalyx, and Glycyrrhiza glabra preparata, and has the effects of soothing the liver and relieving depression, strengthening the spleen and nourishing blood, and is commonly used in the clinical treatment of depression. Clinical data show that compared with the antidepressant treatment of western medicine, Xiao Yao San has a more obvious improvement effect on the HDRS and SDS scale scores. Moreover, when Xiao Yao San is combined with antidepressants (such as fluoxetine, venlafaxine, escitalopram, etc.) in the treatment of post-stroke depression, it also shows a better therapeutic effect than using antidepressants alone. In addition, relevant basic research on Xiao Yao San shows that the active ingredients of Xiao Yao San, saikosaponins A, B2, D, and H, can exert antidepressant activity by inhibiting neuroinflammation and promoting neurogenesis. The extracted components of Atractylodes macrocephala, atractylenolide-I and atractylenolide-III, can improve the depressive and anxiety-like behaviors of rats induced by lipopolysaccharide (LPS) and chronic unpredictable mild stress, and reduce the expression level of pro-inflammatory cytokines. It is found that the active ingredient of Angelica sinensis, senkyunolide H, has significant anti-inflammatory activity and can inhibit inflammatory damage through the NF-kB signaling pathway to play a neuroprotective role. Although the basic research and clinical research on Xiao Yao San have revealed its antidepressant effect, the mechanism of action and material basis of Xiao Yao San in antidepressant treatment are still unclear.

[0006] The clinical diagnosis of depression mainly relies on symptom evaluation supplemented by scale scoring. Clinicians comprehensively evaluate based on the mental and physical symptoms, life experiences, and social status reported by the patients, combined with self-rating / other-rating scale scores to determine whether the patient has a mental disorder and its dialectical classification. Due to the subjectivity of clinicians and the economic and educational differences in different regions, there are certain limitations in the clinical diagnosis of depression, which are prone to misdiagnosis and missed diagnosis of depression. Specific diagnostic markers are of great clinical significance for the objective evaluation of depression.

[0007] The clinical treatment of depression mainly focuses on relieving depressive symptoms, supplemented by social activities and psychological counseling. Antidepressant drug treatment (such as selective serotonin reuptake inhibitors, tricyclic antidepressants, and new drugs, etc.) and psychotherapy are the main treatment means for depression at present. However, studies have found that clinical antidepressant drugs have a slow onset and insufficient efficacy, and have certain adverse reactions on the cardiovascular system, endocrine system, and central nervous system. Exploring the action targets of antidepressant drugs and developing new, highly effective, and safe antidepressant targeted drugs have important scientific significance and clinical application value. Summary of the Invention

[0008] In view of this, the present invention provides a diagnostic marker and an antidepressant treatment target for depression and their applications. Specifically, it is found that specifically knocking down VPS13A in microglia of mice can lead to damage of PFC and HP neurons, activation of PFC microglia, and production of depressive-like behaviors. On the other hand, by promoting the expression of VPS13A to activate autophagy and inhibiting the pro-inflammatory activation of microglia, depressive-like behaviors can be improved. Accordingly, the present invention provides:

[0009] VPS13A as a marker for depression;

[0010] The application of VPS13A in inducing depression and establishing a depression model;

[0011] The application of VPS13A as an antidepressant action target in the treatment of depression.

[0012] In addition, the present invention also provides the applications of Xiaoyaosan (XYS) and Senkyunolide H (SNH) in the preparation and prevention and treatment of depression drugs, which play antidepressant and neuroprotective roles by regulating the expression of VPS13A to promote autophagy-mediated microglial phenotype changes.

[0013] In order to achieve the above-mentioned invention purposes, the present invention provides the following technical solutions:

[0014] The present invention provides the marker VPS13A.

[0015] The present invention also provides the application of the above marker in the preparation of a diagnostic reagent or diagnostic device for depression.

[0016] The present invention also provides a product for diagnosing depression, including a reagent or a device, with VPS13A as a marker.

[0017] The present invention also provides the application of VPS13A as a target in the preparation of a drug for preventing or treating depression.

[0018] The present invention also provides a diagnostic method, which is based on diagnosing with VPS13A as a marker.

[0019] The present invention also provides a method for diagnosing depression, which is based on diagnosing using VPS13A as a biomarker.

[0020] The present invention also provides the use of Xiaoyaosan or ligustilide H in any of the following:

[0021] (i) Preparing an autophagy regulator;

[0022] (ii) Preparing a regulator for inhibiting microglial activation;

[0023] (iii) Preparing a drug for improving neuroinflammation.

[0024] The present invention also provides the use of Xiaoyaosan or ligustilide H in the preparation of an antidepressant drug targeting VPS13A;

[0025] The antidepressant drug activates autophagy by promoting the expression of VPS13A, inhibits the polarization of microglia into a pro-inflammatory type, improves neuroinflammation, reduces depressive-like behaviors, and improves depression.

[0026] The present invention also provides a treatment method based on promoting the expression of VPS13A for treatment.

[0027] The present invention also provides a method for treating depression, which is based on promoting the expression of VPS13A for treatment.

[0028] The present invention also provides the use of VPS13A in the construction of an animal model of depression.

[0029] In some specific embodiments of the present invention, the construction in the above application includes the step of knocking down the expression of VPS13A in Cx3cr1-CreERT2 mice.

[0030] The present invention also provides a method for constructing an animal model of depression, which obtains an animal model of depression by knocking down the expression of VPS13A in Cx3cr1-CreERT2 mice.

[0031] In some specific embodiments of the present invention, in the above method, the knocking down is mediated by AAV (Adeno-associated virus, AAV).

[0032] The present invention also provides the construction of VPS13A through genetic modification KD Cx3cr1-CreERT2 transgenic mouse model.

[0033] The present invention also provides the application of Xiaoyaosan and its active ingredient ligustilide H in promoting VPS13A autophagy-mediated microglial phenotype transformation and antidepressant effects in mice by regulating the expression of VPS13A. KD ​

[0034] In some specific embodiments of the present invention, in the above application, Xiaoyao San and its active ingredient ligustilide H regulate VPS13A KD The expression of VPS13A in Cx3cr1-CreERT2 transgenic mice promotes autophagy, mediates the phenotypic transformation of microglia, and improves the depressive phenotype.

[0035] The present invention also provides a method for improving anhedonia and despair behavior in depressive symptoms, the method comprising the following steps: adding an effective amount of a VPS13A expression promoter to a system in need thereof;

[0036] The VPS13A expression promoter promotes the expression of VPS, activates autophagy, inhibits the polarization of microglia into a pro-inflammatory type, improves neuroinflammation, reduces depressive-like behavior, and improves depression.

[0037] The marker, therapeutic target and their applications of the present invention have the following effects:

[0038] In the study of the LPS-induced inflammatory mouse model of the present invention, it was found that the mice showed depressive-like behaviors such as reduced activity in the central area of the open field, reduced sugar water intake, and prolonged immobility time in forced swimming and tail suspension swimming, and LPS induced neuronal damage and a decrease in the expression level of VPS13A in the PFC and HP of the mice. Treatment with Xiaoyao San and the pharmacologically active ingredient ligustilide H of Xiaoyao San can improve the depressive behavior of the mice, up-regulate the expression level of VPS13A, and improve the neuronal damage of the mice by promoting autophagy. Further, stereotaxic injection of AAV was performed on CX3CR1-CreERT2 tool mice, and the behavioral results showed that VPS13A KD can induce depressive-like behavior and microglial activation in mice. Treatment with XYS and SNH can significantly improve the depressive-like behavior of the mice. Intervention with an autophagy inhibitor reversed the therapeutic effects of XYS and SNH on depression, indicating that VPS13A KD activates microglia by inhibiting autophagy, and XYS and SNH activate autophagy by promoting the expression of VPS13A, inhibit the pro-inflammatory activation of microglia, thereby improving depression. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for the description of the embodiments or the prior art.

[0040] Figure 1Show the effects of XYS and SNH on the behavior of LPS model mice. Among them, A shows the trajectory diagram of the open field test, B shows the total movement distance in the open field test, C shows the residence time in the central area of the open field test, D shows the residence time in the open arms of the elevated plus maze test, E shows the number of entries into the open arms of the elevated plus maze test, F shows the first feeding time of novel object suppressed feeding, G shows the immobile time in the tail suspension test, E shows the immobile time in the forced swimming test, and I shows the sucrose preference rate;

[0041] Figure 2 Show Nissl staining (400×). Among them, A shows the representative diagram of Nissl staining in the PFC, B shows the quantitative diagram of Nissl staining in the PFC, C shows the representative diagram of Nissl staining in the HP, and D shows the quantitative diagram of Nissl staining in the HP;

[0042] Figure 3 Show the effects of XYS and SNH on cell phenotypes (400×). Among them, A shows the representative immunofluorescence diagram of iNOS+ / Iba-1+, B shows the quantitative immunofluorescence diagram of iNOS+, and C shows the quantitative immunofluorescence diagram of iNOS+ / Iba-1+;

[0043] Figure 4 Show the representative TEM micrographs of cell microstructure (upper panel 6000×, lower panel 1500×);

[0044] Figure 5 Show immunohistochemistry (400×). Among them, A shows the representative immunohistochemistry diagram of VPS13A in the PFC area, B shows the quantitative immunohistochemistry diagram of VPS13A in the PFC area, C shows the representative immunohistochemistry diagram of VPS13A in the HP area, and D shows the quantitative immunohistochemistry diagram of VPS13A in the HP area;

[0045] Figure 6 Show the effects of XYS and SNH on the behavior of CSDS model mice. Among them, A shows the trajectory diagram of the open field test, B shows the total movement distance in the open field test, C shows the immobile time in the tail suspension test, D shows the immobile time in the forced swimming test, E shows the residence time in the open arms of the elevated plus maze test, and F shows the sucrose preference rate;

[0046] Figure 7 Show stereotaxic injection of AAV into the brain. Among them, A shows the stereotaxic injection diagram of AAV into the brain, and B shows the fluorescence diagram after AAV injection;

[0047] Figure 8 Show the expression of VPS13A and the immunofluorescence diagram of microglia (400×). Among them, A shows the representative protein band diagram of VPS13A, B shows the quantitative protein band diagram of VPS13A, and C shows the immunofluorescence diagram of microglia;

[0048] Figure 9To show the effects of XYS and SNH on the behaviors of VPS13A KD model mice, where A shows the trajectory map of the open field test, B shows the total moving distance of the open field test, C shows the immobile time of the tail suspension test, D shows the immobile time of the forced swimming test, E shows the residence time in the open arms of the elevated plus maze, and F shows the sucrose preference rate. Detailed implementation manners

[0049] The present invention discloses a diagnostic biomarker and an antidepressant treatment target for depression and their applications. Those skilled in the art can draw on the content of this article and appropriately improve the process parameters to achieve. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art, and they are all regarded as included in the present invention. The methods and applications of the present invention have been described through preferred embodiments, and those related can obviously make changes or appropriate alterations and combinations to the methods and applications described herein without departing from the content, spirit and scope of the present invention to implement and apply the technology of the present invention.

[0050] It should be understood that the expression "one or more of..." individually includes each of the objects recited after the expression and various different combinations of two or more of the recited objects, unless otherwise understood from the context and usage. The expression "and / or" in combination with three or more recited objects should be understood to have the same meaning, unless otherwise understood from the context.

[0051] The terms "comprising", "having" or "containing", including the use of their grammatical synonyms, should generally be understood as open and non-restrictive, for example, not excluding other unrecited elements or steps, unless otherwise specifically stated or understood from the context.

[0052] It should be understood that as long as the present invention is still operable, the order of steps or the order of performing certain actions is not important. In addition, two or more steps or actions can be carried out simultaneously.

[0053] The use of any and all examples or exemplary language such as "for example" or "including" in this article is only intended to better illustrate the present invention and does not limit the scope of the present invention unless a claim is made. Any language in this specification should not be construed as indicating that any unclaimed element is essential for the practice of the present invention.

[0054] In addition, the numerical ranges and parameters used to define the present invention are approximate values. The relevant numerical values in the specific embodiments have been presented as precisely as possible herein. However, any numerical value inherently and inevitably contains standard deviations caused by individual testing methods. Therefore, unless otherwise clearly stated, it should be understood that all ranges, quantities, numerical values, and percentages used in this disclosure are modified by the term "about". Herein, "about" generally means that the actual value is within plus or minus 10%, 5%, 1%, or 0.5% of a specific numerical value or range.

[0055] Unless otherwise specified, the raw materials, reagents, consumables, and instruments involved in the present invention are all ordinary commercially available products and can be purchased from the market.

[0056] The present invention will be further described below in conjunction with embodiments:

[0057] Example 1

[0058] 1. Animal grouping and drug intervention

[0059] (1) XYS and SNH improve depressive-like behaviors in LPS-induced mice by promoting autophagy: 8-week-old specific pathogen-free (SPF) male C57 mice were numbered according to body weight by the random number table method and randomly grouped. There were 12 mice in the normal group (CTL), 12 mice in the model group (LPS), 12 mice in the model group + XYS (LPS + XYS), 12 mice in the model group + XYS + 3-methyladenine (3-MA) (LPS + XYS + 3-MA), 12 mice in the model group + SNH (LPS + SNH), 12 mice in the model group + SNH + 3-MA (LPS + SNH + 3-MA), and 12 mice in the model group + minocycline (Mino) (LPS + Mino). Mice in the CTL group were allowed to eat and drink freely. Mice in the LPS + XYS group, LPS + SNH group, and LPS + Mino group were given intragastric administration of 0.658 g / kg XYS, intraperitoneal injection of 15 mg / kg SNH, and 50 mg / kg Mino at 9:00 every day for 21 days. Mice in the LPS + XYS + 3-MA group and LPS + SNH + 3-MA group were given intraperitoneal injection of 30 mg / kg 3-MA. Except for the CTL group, the remaining groups of mice were given intraperitoneal injection of 0.5 mg / kg LPS.

[0060] (2) XYS and SNH improve depressive-like behaviors in CSDS-induced mice by promoting autophagy: 8-week-old SPF-grade male C57 mice were numbered according to body weight by the random number table method and randomly divided into groups. There were 12 mice in the normal group (CTL), 12 mice in the model group (CSDS), 12 mice in the model group + XYS (CSDS + XYS), 12 mice in the model group + XYS + 3-MA (CSDS + XYS + 3-MA), 12 mice in the model group + SNH (CSDS + SNH), 12 mice in the model group + SNH + 3-MA (CSDS + SNH + 3-MA), and 12 mice in the model group + Fluoxetine (FLX) (CSDS + FLX). Mice in the CTL group were allowed free access to food and water. Mice in the CSDS + XYS group, CSDS + SNH group, and CSDS + FLX group were given intragastric administration of 0.658 g / kg XYS, intraperitoneal injection of 15 mg / kg SNH, and 10 mg / kg FLX at 9:00 every day for 21 days. Mice in the CSDS + XYS + 3-MA group and CSDS + SNH + 3-MA group were given intraperitoneal injection of 30 mg / kg 3-MA.

[0061] (3) XYS and SNH improve depressive-like behaviors in VPS13A KD mice by promoting autophagy: SPF-grade male homozygous CX3CR1-CreERT2 mice were numbered according to body weight by the random number table method and randomly divided into groups. There were 15 mice in the control group (NC), 15 mice in the model group (VPS13A KD ), 15 mice in the model group + XYS (VPS13A KD + XYS), 15 mice in the model group + XYS + 3-MA (VPS13A KD + XYS + 3-MA), 15 mice in the model group + SNH (VPS13A KD + SNH), and 15 mice in the model group + SNH + 3-MA (VPS13A KD + SNH + 3-MA). After 10 days of adaptive feeding, the mice were subjected to stereotaxic injection of AAV into the brain. Mice in the NC group were allowed free access to food and water. Seven days later, mice in the VPS13A KD + XYS group and VPS13A KD + SNH group were given intragastric administration of 0.658 g / kg XYS and intraperitoneal injection of 0.5 mg / kg SNH at 9:00 every day for 21 days. Mice in the VPS13A KD + XYS + 3-MA group and VPS13A KD + SNH + 3-MA group were given intraperitoneal injection of 30 mg / kg 3-MA.

[0062] 2. Stereotaxic injection of AAV into the brain

[0063] Using a mouse brain stereotaxic apparatus, inject the required AAV into the vmPFC (0.5 μl / side) at a rate of 0.1 nl / s. VmPFC: anterior–posterior: +1.7 mm; medial–lateral: ±0.3 mm; dorsal–ventral: -2.8 mm. Leave the needle in place for 10 minutes after injection and then remove the needle.

[0064] 3. Detect autophagy level by TEM

[0065] Quickly collect mouse PFC tissues, wash them three times with PBS (10 min / time), and fix them overnight at 4°C with 2.5% glutaraldehyde. Embed the cells, with a section thickness of 60 - 80 nm, and attach them to glass slides. Observe the ultrastructure images of mitochondria and autophagosomes under a transmission electron microscope (TEM) (HT7800 / HT7700, HITACHI).

[0066] 4. Detect autophagy indicators and changes in microglial phenotypes by immunofluorescence

[0067] Anesthetize the mice, perfuse with saline to remove blood, then perfuse with 4% PFA, and dissect to obtain the mouse brain. After dehydration and drying, embed it in paraffin, or the fresh brain obtained from the dissection is embedded in OCT, then sectioned coronally and mounted on glass slides for immunofluorescence staining. Briefly, permeabilize the brain tissue sections with PBST containing 0.3% Triton X - 100 for 10 min, and block the sections with PBST containing 3% donkey serum and 0.3% Triton X - 100 at room temperature for 1 hour. Then incubate overnight at 4°C with primary antibodies against mouse Iba - 1 (1:100), rabbit Arg - 1 (1:100), and rabbit iNOS (1:100). Wash with PBST 3 times, 10 min each time. Then incubate with secondary antibodies, goat anti - mouse Alexa Fluor 488 (1:500) and goat anti - rabbit Alexa Fluor 594 (1:500), at room temperature for 1 h. Wash with PBST again 3 times, 10 min each time. Drop anti - fluorescence quenching mounting medium containing DAPI for mounting. Observe the staining of cells in different fluorescence channels using a Leica laser scanning confocal microscope and take pictures for subsequent use.

[0068] 5. Detect behavioral changes in mice by behavioral assays

[0069] Before collecting tissue samples, behavioral tests such as the Sucrose preference test (SPT), Open field test (OFT), Tail suspension test (TST), Forced swimming test (FST), Elevated plus maze test (EPMT), and Novelty suppressed feeding test (NSFT) were conducted. All tests were carried out in the same room, under the same lighting, and at the same temperature. The behavioral test process was recorded by a camera, and all behavioral test data were analyzed using a small animal behavior trajectory tracking and analysis system (NOLDUS EthoVision XT, Netherlands).

[0070] 6. Construction of a Chronic social defeat stress (CSDS) mouse model

[0071] C57BL / 6 mice were randomly assigned to the model group (CSDS) or the control group (CTL). Each C57BL / 6 mouse was housed in a cage with one aggressive CD-1 (ICR) mouse for 10 days. The two mice were separated by a perforated transparent barrier, allowing olfactory, visual, and auditory sensory communication between the animals. The transparent barrier was removed for 4 minutes every day to allow territorial competition between the mice (aggressive behavior of the mice to fight for their respective territories against the invading mouse). The aggressive behavior between the mice was closely monitored to ensure reliable social defeat and the safety of the mice. If no obvious aggressive behavior occurred, the experimental C57BL / 6 mouse was transferred to a new CD-1 mouse cage for 4 minutes of confrontation competition. Control group mice were paired with one CD-1 mouse and separated and housed in the same cage for 10 days respectively.

[0072] 7. Observation of the change in the number of neurons by Nissl staining

[0073] At 37 °C, 6-μm coronal paraffin sections of the mouse brain PFC were stained with Nissl staining solution (Servicebio) for 5 minutes. Subsequently, the samples were washed with 95% ethanol for 5 minutes and dried. They were washed twice in xylene (5 minutes each time). After sealing with neutral resin, the slides were observed under an optical microscope (ECLIPSE E100, Nikon) to obtain section photos.

[0074] 8. Immunoblotting (Western Blot, WB)

[0075] Mouse PFC tissues were collected and lysed thoroughly by adding lysis buffer. The protein concentration of the cell lysate was measured using a BCA protein assay kit. Tissue lysates (30 μg) were separated by 10% SDS-PAGE and transferred onto PVDF membranes. The membranes were blocked with skim milk for 1 h. The membranes were incubated overnight at 4 °C with primary antibodies against VPS13A and β-actin (1:1000). After washing three times with TBST (10 min each time), the membranes were incubated with the corresponding secondary antibodies (peroxidase-conjugated goat anti-rabbit or anti-mouse IgG, 1:5000) for 1 h at room temperature and washed again three times with TBST (10 min each time). Enhanced chemiluminescence reagents were used to observe and record protein bands on a multifunctional imaging system. ImageJ and GraphPad Prism v8.0 software were used to measure gray values and quantify band data.

[0076] 9. Statistical analysis

[0077] Each experiment was performed at least 3 or more independent replicate experiments. All experimental data were expressed as mean ± standard error of the mean (mean ± SEM), and GraphPad Prism 8, Adobe Photoshop 2022, and Adobe Illustrator 2022 software were used to analyze, process, and plot the experimental data. Normality tests were performed on all experimental data. For experimental data that conformed to a normal distribution, one-way analysis of variance (one way-ANOVA) was used to analyze the differences between groups; for experimental data that did not conform to a normal distribution, independent sample analysis with non-parametric tests was used. P < 0.05 was considered statistically significant for data differences.

[0078] Example 2: XYS and SNH improve LPS-induced depressive-like behaviors in mice by promoting autophagy

[0079] According to the experimental method described in Example 1, the behavioral regulatory effects of XYS and SNH on the LPS-induced mouse model were detected by behavioral assays, and 3-MA was used for pharmacodynamic intervention. Figure 1 The results shown indicate that LPS reduced exploratory activities in the central area of the mouse open field ( Figure 1 A in), and increased mouse behavioral despair, manifested as a decrease in the central area movement trajectory and the number of central area crossings compared with the CTL group ( Figure 1 A to Figure 1 C in), the sucrose preference rate of the LPS group mice decreased to 40.00 ± 2.65% ( Figure 1 I in), and the immobility time in the tail suspension test and forced swimming test was prolonged ( Figure 1 G in, H in Figure 1), which was significantly increased compared with the CTL group (P < 0.001) ( Figure 1in F). It is worth noting that LPS also induced anxiety-like behaviors in mice, manifested as a decrease in the frequency and residence time of mice entering the open arms in the EPM (P < 0.001, P < 0.01)( Figure 1 in D of Figure 1 in E of Figure 1 in I of Figure 1 in D of Figure 1 in E of Figure 1 in I of Figure 1 in C of Figure 1 in C of Figure 1 in G of Figure 1 in H of Figure 1 in F of

[0080] Example 3: XYS and SNH increase Nissl bodies in the mouse PFC by promoting autophagy

[0081] Nissl bodies are commonly used for the detection of neurons and are mainly involved in the synthesis of neuronal proteins. A decrease in the number of Nissl bodies indicates neuronal damage. According to the experimental method described in Example 1, the protective effects of SNH and XYS on neurons in the mouse PFC and HP were analyzed by Nissl staining. The results showed that the number of Nissl bodies in the LPS group was decreased compared with that in the CTL group Figure 2 in A of Figure 2in C), suggesting that LPS stress induces pathological damage to PFC and HP neurons in mice, with a decrease and disappearance of Nissl bodies ( Figure 2 in B, Figure 2 in D). The average number of Nissl bodies in the LPS+SNH group, LPS+XYS group, and LPS+Mino group all increased ( Figure 2 in B, Figure 2 in D), indicating that SNH and XYS exerted good neuroprotective effects and inhibited LPS-induced neuronal damage. However, the average expression levels of Nissl bodies in the PFC and HP of mice in the LPS+SNH+3-MA group and LPS+XYS+3-MA group both decreased ( Figure 2 in B, Figure 2 in D). The autophagy inhibitor 3-MA also significantly induced the stress response in the PFC and HP of mice and inhibited the neuroprotective effects of SNH and XYS on neurons. Thus, autophagy plays an important role in the mechanism of neuroprotection by SNH and XYS.

[0082] Example 4: XYS and SNH regulate microglial homeostasis by promoting autophagy

[0083] To further explore the role of autophagy in the antidepressant mechanism of XYS and SNH and its role in the M1 / M2 phenotype transformation of microglia, according to the experimental method described in Example 1, Iba-1 was used to label microglia, and the co-staining of the pro-inflammatory factor iNOS and Iba-1 in the PFC of mice treated with XYS and SNH under the action of 3-MA was observed separately under a confocal microscope ( Figure 3 in A). Consistent with the expected results, the iNOS + / Iba-1 + increased in the LPS group of mice and decreased significantly after treatment with XYS and SNH (P < 0.001), and the iNOS + / Iba-1 + in the LPS+SNH group, LPS+XYS group, and LPS+Mino group was significantly downregulated (P < 0.001, P < 0.001, P < 0.001) ( Figure 3 in C), suggesting that treatment with SNH and XYS significantly inhibited the polarization of M1 pro-inflammatory microglia in the PFC of mice. However, after interference with 3-MA, the expression of iNOS increased compared with the SNH and XYS treatment groups (P < 0.001, P < 0.01) ( Figure 3 in B). The autophagy inhibitor significantly induced the activation of M1 pro-inflammatory microglia and blocked the inhibitory effect of XYS and SNH on the activation of pro-inflammatory microglia. Thus, autophagy inhibition increases the polarization of microglia towards the pro-inflammatory type and induces neuroinflammation.

[0084] Example 5: Effects of XYS and SNH on autophagy

[0085] To further clarify the key role of autophagy in the antidepressant mechanisms of XYS and SNH, according to the experimental method described in Example 1, TEM was used to observe the cell microstructure in the PFC of mice. The results are as follows Figure 4 shown. In the LPS group, the mitochondria in the PFC of mice were severely damaged, and the vacuolization structure increased. However, no obvious autophagosome double-membrane vesicle structure was observed. In the LPS+XYS group, the structure of autophagosomes could be observed, and the mitochondrial cristae structure was obvious, and the cytoplasm was relatively intact. Although no obvious increase in the double-membrane autophagosome structure was observed in the PFC of mice in the LPS+SNH group, the mitochondrial damage was improved compared with the LPS group, and some mitochondrial structures were intact and visible. Mitochondrial structure damage was also observed in the PFC of mice after 3-MA intervention treatment, suggesting that XYS and SNH have an improving effect on LPS-induced mitochondrial damage and autophagy defects and are regulated by 3-MA.

[0086] Example 6: Regulation of VPS13A by XYS and SNH

[0087] It was found that SNH has a regulatory effect on the expression level of VPS13A mRNA. In this example, according to the experimental method described in Example 1, the expression level of VPS13A in the PFC of mice was further detected. The immunohistochemical results showed that the number of VPS13A-positive cells in the PFC and HP of mice in the LPS group decreased ( Figure 5 A, C in Figure 5 ), showing a significant difference compared with the CTL group (

[0088] Example 7: XYS and SNH improve depressive-like behaviors in CSDS-induced mice by promoting autophagy

[0089] To further explore the mechanism of autophagy in depression and the autophagy targeting of the antidepressant effects of XYS and SNH, in this example, the classical depression model of CSDS mice was further used according to the experimental method described in Example 1 to explore the important role of autophagy in the pathological mechanism of depression. Consistent with the behavioral test results of LPS model mice, CSDS restricted the exploration of novel environments by mice and increased behavioral despair in mice ( Figure 6 A in Figure 6 C in Figure 6 D in ). The CSDS model has environmental pathogenic factors and depressive symptoms similar to those of human depression. After treatment with XYS and SNH, both could significantly improve the increased activity trajectories in the central area of the open field test in mice ( Figure 6 A in ). The sucrose preference rates in the CSDS+SNH and CSDS+XYS groups increased to 69.84±6.65% and 67.44±6.57% respectively ( Figure 6 F in ), showing significant differences compared with the CSDS group (36.22±2.57%) (P<0.001, P<0.01). In addition, the immobile time of mice in the TST and FST in the CSDS+SNH and CSDS+XYS groups was significantly reduced compared with that of mice in the CSDS group ( Figure 6 C in Figure 6 D in ), similar to the therapeutic effect of the classical antidepressant drug FLX for depression. Similarly, after blocking autophagy with 3-MA, the sucrose preference rates of mice in the CSDS+SNH+3-MA and CSDS+XYS+3-MA groups were 35.81±6.20% and 50.67±10.54% respectively ( Figure 6 F in ), showing a downward trend and presenting depressive symptoms similar to anhedonia in humans. Blocking autophagy with 3-MA significantly inhibited the antidepressant effect of SNH but did not significantly change the therapeutic effect of XYS, suggesting that the antidepressant effect of XYS is superior to that of SNH. Inhibiting autophagy also restricted the therapeutic effects of XYS and SNH on the despair behavior of mice, and the immobile time of mice in the TST and FST increased significantly ( Figure 6 C in Figure 6 D in ). Without affecting the motor ability of mice, CSDS also induced anxiety-like behavior in mice, manifested as a decrease in the residence time of mice in the open arms in the EPM, and the activities of mice in the EPM were mainly concentrated in the closed arms. XYS and SNH increased the residence time of mice in the open walls and improved the anxiety behavior of mice. However, treatment with 3-MA induced the occurrence of anxiety-like behavior again ( Figure 6 E in ), suggesting that autophagy not only mediates the occurrence and development of depression but may also be related to the pathogenesis of anxiety disorder.

[0090] Example 8: Stereotaxic injection of AAV into Cx3cr1-CreERT2 mice

[0091] According to the experimental method described in Example 1, microglia-specific VPS13A knockdown mice were constructed by stereotactic injection of AAV into the brains of Cx3cr1-CreERT2 homozygous mice to explore the role of VPS13A-dependent autophagy in depression and the therapeutic effects of SNH and XYS in the VPS13A KD model mice. The site of stereotactic injection of AAV into the brain is as shown in Figure 7 A in Figure 7 B in shows the cross-section of the vmPFC of mice injected with shVPS13A virus

[0092] Example 9: Analysis of VPS13A expression in CX3CR1-CreERT2 mice

[0093] According to the experimental method described in Example 1, CX3CR1-CreERT2 mice were subjected to stereotactic injection of AAV-EF1a-DIO-shVPS13A-eGFP (target sequence: GAGTGGTGGGCT TATGCTATAATGGAGTTGTTGGGAAGCATT ATTGTTGAGTCTGACAGTGA A, SEQ ID NO:1) into the vmPFC of the brain. The expression level of VPS13A in the vmPFC of mice was detected by WB( Figure 8 A in KD The protein expression level of VPS13A in the VPS13A Figure 8 group of mice decreased significantly (

[0094] B in), showing a statistically significant difference compared with the NC group (P < 0.0001). Figure 8 C in), the microglia in the PFC of the NC group showed normal branching, and the microglia in the VPS13A KD group of mice had an increased volume and an increased number of branches compared with the NC group, showing an activated microglia morphology, suggesting that VPS13A KD can induce microglia activation

[0095] Example 10: XYS and SNH improve the depressive-like behavior of VPS13A KD mice

[0096] Behavioral tests were performed according to the experimental method described in Example 1. The results showed that VPS13A KDinduced a depressive-like phenotype in mice, and the sucrose preference rate of the mice decreased to 47.90 ± 2.66%, which was significantly lower than that of the NC group (83.36 ± 2.82%) (P < 0.0001). After treatment with SNH and XYS, it was restored. VPS13A KD + SNH group and VPS13A KD + XYS group, the sucrose preference rates increased to 67.09 ± 5.15% and 56.83 ± 7.28% respectively, and the therapeutic effect of SNH was better ([[]] Figure 9 F in). It is worth noting that the sucrose preference rate of the mice treated with 3-MA decreased significantly again, suggesting that VPS13A KD induced anhedonia in mice by inhibiting autophagy. Treatment with SNH and XYS could improve anhedonia by promoting VPS13A-related autophagy and exert an antidepressant effect. The results of OFT, TST, FST and EPM also showed that VPS13A KD induced depressive-like behaviors. Compared with the NC group, the activity of the mice in the VPS13A KD group in the central area decreased ([[]] Figure 9 A in), and the despair behavior increased. However, the immobility time of the mice in the VPS13A KD + SNH group and VPS13A KD + XYS group in the TST and the immobility time in the FST were both significantly increased compared with the VPS13A KD group ([[]] Figure 9 C in, [[[]] Figure 9 D in), and the despair behavior of the mice was effectively improved. Injection of AAV virus and drug treatment did not affect the activity level of the mice in the open field, and there was no significant difference in the total movement distance of the mice (P > 0.05) ([[]] Figure 9 B in). It is worth noting that VPS13A KD resulted in a decrease in the residence time of the mice in the open arms of the EPM. Although there was no statistical difference, XYS treatment significantly promoted the exploratory activity of the mice towards the open arms, and this promoting effect was further inhibited by 3-MA ([[]] Figure 9 E in).

[0097] The above are only the preferred embodiments of the present invention. It should be pointed out that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and refinements can be made, and these improvements and refinements should also be regarded as the protection scope of the present invention.

Claims

1. A method for constructing an animal model of depression, characterized in that, Obtained by knocking down the expression of Cx3cr1-CreERT2 mice VPS13A Expression obtained; Among them, the sucrose preference rate of mice decreased, the activity trajectory in the central area of the open field decreased, the immobility time during tail suspension increased, the immobility time during forced swimming increased, and the residence time in the open arm decreased; The knockdown is mediated by adeno-associated virus; The target sequence of the adeno-associated virus used to knock down the expression of Cx3cr1-CreERT2 mice is shown in SEQ ID NO: 1 as follows. VPS13A The target sequence of the adeno-associated virus used to knock down the expression is shown in SEQ ID NO: 1.

Images