A genetic marker associated with multiple carcass traits in chickens and uses thereof

Abstract

The present application relates to a kind of genetic markers related to multiple carcass traits of chicken and its application.The present application discloses a SNP site related to chicken carcass weight, total stomach weight and liver weight, which is located on the upstream of SETDB2 gene, and the genomic position is GRCg6a version genome 1 chromosome 170526425 nucleotide.The SNP marker exists 3 genotypes, T / T, C / C and T / C, wherein T / T corresponds to higher chicken carcass weight, total stomach weight and liver weight and other carcass traits.In high weight chicken, T is dominant allele, and in low weight chicken, C is dominant allele, by selecting the T / T genotype of the SNP site, early selection of chicken carcass traits can speed up the genetic breeding of chicken.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of molecular genetics, in particular, a genetic marker associated with multiple carcass traits of chicken and application thereof. BACKGROUND

[0002] In recent years, the output of chicken meat in China has been increasing continuously, and improving the muscle yield and the quality of chicken meat has been a long-term exploration of breeding scientists. The classical breeding method has made a great contribution to the improvement of production traits of agricultural animals. With the continuous advancement of genome work and the extensive development of genetic markers, breeding scientists can select chickens with good yield and quality characteristics according to specific genetic markers for breeding, so as to gradually improve the yield and quality level of the whole chicken population.

[0003] SNP (Single Nucleotide Polymorphism) is one of the common genetic variations in genetics. SNP has the advantages of large quantity, high frequency and low mutation rate, and plays an important role in genetic research and molecular selection breeding. However, there is still a lack of molecular markers with clear function and significant effect in the practice of broiler molecular breeding. Therefore, it is the current research focus to excavate molecular markers with large effect and high accuracy. Further, if the SNP molecular marker associated with the target traits of chicken can be found and the molecular mechanism of the site is finally analyzed, it will greatly promote the genetic improvement of chicken and bring breakthrough progress to the field of poultry breeding. SUMMARY

[0004] In view of the defects in the prior art, the purpose of the present application is to provide a genetic marker associated with multiple carcass traits of chicken and application thereof. The present application discloses a SNP site associated with chicken carcass weight, total stomach weight and liver weight, which is located upstream of the SETDB2 gene and has a genomic position of GRCg6a version chromosome 1 170526425 nucleotides. The SNP marker has three genotypes, T / T, C / C and T / C, wherein T / T corresponds to higher carcass traits such as chicken carcass weight, total stomach weight and liver weight. In high weight chickens, T is the dominant allele, while in low weight chickens, C is the dominant allele. By selecting the T / T genotype of the SNP site, early selection of chicken carcass traits can be carried out to accelerate the genetic breeding of chicken.

[0005] To achieve the above purpose, the technical scheme adopted by the present application is as follows:

[0006] A SNP molecular marker associated with multiple carcass traits of chicken, characterized in that the SNP molecular marker is located at chr1: 170526425 bp of the genomic version GRCg6a 104, and the alleles of the SNP molecular marker are T and C.

[0007] The specific process of obtaining the SNP molecular marker is as follows:

[0008] The body weight traits of the chicken cross population are determined and recorded, 1174 individuals of the chicken cross population are sequenced by resequencing technology, and the identified SNPs are quality controlled and filtered, 7,901,521 SNPs remaining after filtering are subjected to GWAS, and a SNP site significantly related to carcass weight, total stomach weight and liver weight is obtained, which is rs316394840 (chr1:170526425) of genomic version GRCg6a 104, and the polymorphism of the molecular marker is T and C.

[0009] On the basis of the above scheme, the advantageous allele of the SNP molecular marker is T. The result is obtained by statistically analyzing the SNP frequency of the SNP in other low-weight chicken species and high-weight chicken species in resequencing, and it is found that there is a significant difference between low-weight chicken species and high-weight chicken species, T is the advantageous allele in high-weight chicken, and C is the advantageous allele in low-weight chicken. In the population with low carcass weight, total stomach weight and liver weight, the selection of individuals with allele T can improve the carcass weight of the chicken.

[0010] On the basis of the above scheme, the SNP molecular marker is located at the 101st base in the nucleotide sequence shown in SEQ ID NO. 1. The sequence shown in SEQ ID NO. 1 is a fragment of 170526325 bp-170526525 bp in chr1 of genomic version GRCg6a 104.

[0011] A SNP molecular marker related to multiple carcass traits of chickens is applied in marker-assisted selection breeding of chickens.

[0012] On the basis of the above scheme, the marker-assisted selection breeding of chickens is specifically: breeding chickens with high carcass weight by SNP site assisted selection.

[0013] On the basis of the above scheme, the application of the SNP molecular marker related to multiple carcass traits of chickens in marker-assisted selection breeding of chickens comprises the following steps:

[0014] Step 1, detecting the genotype of the sample chicken at the SNP molecular marker;

[0015] Step 2, selecting chickens with genotype T / T for breeding.

[0016] On the basis of the above scheme, step 1 is performed by direct sequencing, or by amplifying the fragment containing the SNP molecular marker and then sequencing.

[0017] A primer pair for amplifying the fragment containing the SNP molecular marker, wherein the nucleotide sequences of the primer pair are shown as SEQ ID NO. 2 and SEQ ID NO. 3.

[0018] F: CCTCTGCCAACCCACACCAC (SEQ ID NO. 2)

[0019] R: GAAGGCGGTGTGTCCGCCA (SEQ ID NO. 3)

[0020] The primer pair is used to amplify the fragment containing the SNP molecular marker from the sequence shown in SEQ ID No. 1.

[0021] The genetic marker related to multiple carcass traits of chickens and the application thereof have the beneficial effects that:

[0022] The SNP site of Chr1: 170526425 of 1174 chickens is genotyped, and the SNP site is associated with carcass weight, total stomach weight and liver weight, and it is found that the site is significantly related to carcass weight. The SNP frequency of the site is analyzed in low-weight chicken breeds and high-weight chicken breeds, and it is found that the SNP frequency distribution in low-weight chicken breeds and high-weight chicken breeds is significantly different. In high-weight chickens, T is the dominant allele, and in low-weight chickens, C is the dominant allele. High-weight chickens have higher body weight than low-weight chickens, which shows that the SNP site can be used as a molecular marker for the breeding of excellent chicken breeds. In the population with lower carcass weight, by selecting individuals with allele T, the carcass weight of the population can be improved, which has great economic application value. BRIEF DESCRIPTION OF DRAWINGS

[0023] The present application has the following drawings:

[0024] Figure 1 It is the Manhattan plot of the GWAS result of the chicken carcass weight of the present application;

[0025] Figure 2 It is the Manhattan plot of the GWAS result of the total stomach weight of the chicken of the present application;

[0026] Figure 3 It is the Manhattan plot of the GWAS result of the liver weight of the chicken of the present application. DETAILED DESCRIPTION

[0027] The following examples further illustrate the content of the present application, but should not be understood as limiting the present application. Modifications or replacements of the methods, steps or conditions of the present application, without departing from the spirit and essence of the present application, all belong to the scope of the present application.

[0028] Example 1 Whole genome association analysis of multiple carcass traits of chickens

[0029] 1. Test materials

[0030] For individual hybrid chickens, slaughter was carried out at 13 weeks of age, and the carcass weight, total stomach weight, and liver weight were measured in strict accordance with the chicken farm's internal regulations.

[0031] 2. Test Methods

[0032] 2.1 Phenotypic determination

[0033] For chickens aged 13 weeks in the flock, slaughter them, remove the feathers and internal organs of each chicken, place them on a weighing device, and measure the carcass weight; separately remove the stomach and liver of each chicken and weigh them.

[0034] 2.2 Chicken whole-genome SNP genotyping method based on resequencing technology

[0035] Sequencing data were aligned to the GRCg6a 104 reference genome using GTX Align, and SNP loci were detected using Basevar. The genotype probability of all individuals was estimated using STITCH. For SNP loci obtained through genotyping, they were filtered based on MAF < 0.05, locus call rate < 0.95, and info score < 0.4, retaining a total of 7,901,521 high-quality SNPs.

[0036] 2.3 Genome-wide association analysis

[0037] Genome-wide association analysis was performed on the carcass weight, total stomach weight, and liver weight of 1174 chickens using fastGWA.

[0038] 2.4 SNP sites significantly associated with carcass traits

[0039] Detection of significant loci at the genomic level: significant loci are identified based on FDR < 0.05.

[0040] 3. Results and Analysis

[0041] This invention used 1174 chickens from a hybrid population as subjects. Using resequencing technology, 7,901,521 SNPs were obtained, and GWAS analysis was performed on the carcass weight, total stomach weight, and liver weight of the chickens. A SNP (chr1: 170526425) significantly correlated with the carcass weight of the chickens was identified. Figure 1 As shown.

[0042] Example 2: Frequency distribution of SNP (chr1: 170526425) in different chicken breeds

[0043] 1. Test materials

[0044] Low-weight chicken breeds: Bearded chicken (n=15), Camellia chicken (n=30), Daweishan miniature chicken (n=33), Silkie chicken (n=57) and Tibetan chicken (n=154).

[0045] High-weight chicken breeds include: Lingnan Yellow-feathered Broiler (n=16), White-feathered Broiler (n=20), and Kebao Chicken (n=33).

[0046] 2. Test methods

[0047] 2.1 Data Collection

[0048] The whole-genome resequencing data from the above 5 low-weight chicken breeds and 3 high-weight chicken breeds were downloaded from the NCBI SRA database (https: / / ncbi.nlm.nih.gov / sra).

[0049] 2.2 SNP typing using GATK

[0050] The gVCF was constructed based on the GRCg6a 104 reference genome using the gtx wgs command on the GTX server. Then, the gtx gi and gtx joint commands were used to perform joint variant detection on all gVCF samples and obtain genotype VCF files.

[0051] 2.3 SNP Filtration and Quality Control

[0052] After the combined variant detection was completed, SNPs were extracted using the SelectVariants tool in the GATK software package. Subsequently, the whole genome resequencing data were quality controlled using the VariantFiltration tool in the GATK software package according to the following hard filtering parameters: MQ < 40.0, FS > 60.0, SOR > 3.0, MQRankSum < -12.5, ReadPosRankSum < -8.0, QUAL < 30. After the above quality control, a total of 44,272,587 resequencing SNPs were obtained.

[0053] 2.4 Calculation of allele frequencies of chr1:170526425 in different chicken breeds

[0054] The allele frequencies of chr1:170526425 in different chicken breeds were calculated using vcftools --freq2.

[0055] 2.5 Amplifying the target fragment

[0056] DNA was extracted from blood tissue samples of the hybrid population using a total DNA extraction kit from Beijing Tiangen Biotech Co., Ltd. The extracted DNA concentration and purity were determined by measuring the OD values ​​(OD260 / OD280 and OD260 / OD230 ratios) using a NanoDrop 2000 spectrophotometer, and DNA integrity was assessed by agarose gel electrophoresis. Using the genome of the hybrid population samples as a template, primers were designed using Oligo7 software, and sequence amplification was performed using Novizan 2 × Taq Master Mix. The reaction system was as follows: 95℃, pre-denaturation for 3 min; 95℃, denaturation for 15 s, 60℃, annealing for 15 s, 72℃, extension for 15 s, 30 cycles; 72℃, complete extension for 5 min. Finally, agarose gel electrophoresis was used to determine the fragment size of the product.

[0057] 3. Results and Analysis

[0058] The SNP frequency distribution of SNP (chr1: 170526425) in different low-weight and high-weight chicken breeds is shown in Table 1. Significant differences exist between the two breeds. T is the dominant allele in high-weight chickens, while C is the dominant allele in low-weight chickens.

[0059] Table 1. SNP frequency (chr1: 170526425) in different low-weight and high-weight chicken breeds.

[0060] ;

[0061] Thus, a SNP molecular marker associated with chicken slaughter weight trait was obtained. In a population with low slaughter weight, the weight of the breeding population can be increased by breeding individuals with the T / T allele at this locus.

[0062] Although the present invention has been described in detail above with general descriptions, specific embodiments, and experiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention.

[0063] The contents not described in detail in this specification are existing technologies known to those skilled in the art.

Claims

1. Application of a SNP molecular marker related to multiple carcass traits of chicken in the assisted selection breeding of chicken 13-week-old carcass weight traits; wherein the SNP molecular marker is located at chr1: 170526425 bp of the genome version GRCg6a; and the alleles of the SNP molecular marker are T and C.

2. The application of claim 1, wherein the assisted selection breeding is specifically breeding chickens with high carcass weight through SNP site assisted selection.

3. The application of claim 2, comprising the following steps: Step 1, detecting the genotype of sample chickens at the SNP molecular marker; Step 2, selecting chickens with the genotype of T / T for breeding.

3. Use according to claim 2, wherein the compound is ###0002### 4. The application of claim 3, wherein the step 1 is performed by direct sequencing, or by amplifying the fragment containing the SNP molecular marker and then sequencing. ​ ​ ​ ​

Images