A recombinant adenovirus for targeted knockdown of BRD4 in endothelial cells

Abstract

The present invention first provides a tool sequence, which is a DNA sequence for knocking down BRD4 encoded by shRNA. The present invention also provides a recombinant plasmid, which is circular and includes the tool sequence as described above, and includes an EGFP sequence and an endothelial cell-specific promoter sequence. The present invention also provides a recombinant adenovirus for targeted knockdown of BRD4 in endothelial cells, which is packaged with the recombinant plasmid as described above. The present invention also provides a gene manipulation tool for treating lupus nephritis, lupus vasculitis or cancer, including the recombinant adenovirus as described above and endothelial high transduction serum. The gene manipulation tool described in the present invention can specifically act on the endothelial cells of the body, and can provide a new targeted treatment approach for diseases caused by abnormally increased BRD4 expression, especially immune-related kidney diseases such as lupus nephritis, and has great application prospects.

Description

Technical Field

[0001] The present invention belongs to the field of biochemical medicine, and specifically relates to a recombinant adenovirus for knocking down BRD4 in targeted endothelial cells and its application in the treatment of lupus nephritis. Background Art

[0002] Endothelial cells are a thin layer of epithelial cells lining the inner walls of blood vessels, distributed throughout the body's circulatory system, from the heart to the smallest capillaries. Endothelial cells are involved in a wealth of vascular biological functions, including: vasoconstriction and relaxation to control blood pressure, coagulation, anticoagulation and fibrinolysis, arteriosclerosis, angiogenesis, and inflammatory responses such as the entry and exit of white blood cells in and out of blood vessels, and substance filtration. In autoimmune diseases such as lupus, endothelial cell proliferation, functional damage, and destruction of the endothelial barrier manifest as severe and widespread systemic vasculitis. In tumor diseases, abnormal proliferation of endothelial cells promotes the growth of tumor cells, the spread of tumor cells, and the destruction of the body's normal homeostasis. Therefore, targeting pathogenic genes in endothelial cells has therapeutic significance for immune diseases and tumors.

[0003] BRD4, also known as bromodomain protein 4, is a transcriptional regulator. BRD4 is a member of the bromodomain and super-terminal domain family, which can bind to acetylated histones and non-histones, thereby regulating gene replication and transcription, affecting the cell cycle, cell differentiation, signal transduction and other processes. As an epigenetic reader, the expression level of BRD4 in the body increases in disease states such as immune diseases and tumors. The applicant's research shows that BRD4 is significantly expressed in endothelial cells in the renal tissue of patients with lupus nephritis, and can reflect the severity of the disease, which provides a theoretical basis for the exploration of therapeutic methods for targeted knockdown of BRD4 in endothelial cells.

[0004] However, after searching, no intervention strategy that successfully targets BRD4 in endothelial cells has been found in the prior art. Therefore, there is a need in the art to construct a genetic manipulation tool or drug for targeted knockdown of BRD4 in endothelial cells. Summary of the Invention

[0005] Under normal physiological conditions, BRD4 is mainly involved in the regulation of gene expression during the cell cycle. It can bind to acetylated chromatin to maintain the stable expression of various genes during the cell division cycle. This phenomenon is called epigenetic memory or "bookmarking" of gene transcription. Dysregulated expression of BRD4 is associated with the formation of various cancers such as leukemia and breast cancer. The most noteworthy thing about BRD4 is that studies have found that it may be a potential target for cancer treatment. This molecule is abundantly expressed in endothelial cells and immune cells, and plays an important role in transcriptional and epigenetic regulation during the cell cycle. The expression characteristics of BRD4 and its important role in cell cycle regulation and differentiation make it an emerging therapeutic target for cancer and immune system diseases.

[0006] BRD4 is a key player in regulating endothelial cell injury. BRD4 inhibitors, such as JQ1, can ameliorate endothelial injury and reduce atherosclerosis, angiogenesis, intimal hyperplasia, pulmonary hypertension, and myocardial hypertrophy. In a model of myocardial fibrosis, BRD4 inhibition attenuates aortic coarctation, TGF-β-induced endothelial-mesenchymal transition, and cardiac fibrosis. In a liver injury model, the interaction between p300, NFκB, and BRD4 in sinusoidal endothelial cells increases CCL2 expression, leading to hepatic macrophage accumulation, portal hypertension, and liver fibrosis. In an acute kidney injury model, BRD4 inhibition reduces neutrophil activation and endothelial adhesion after ischemia-reperfusion renal injury. Furthermore, the BRD4 inhibitor JQ1 effectively alleviates symptoms in MRL-lpr lupus mice by suppressing the production of BAFF, proinflammatory cytokines, and anti-ds-DNA antibodies. Therefore, BRD4 inhibition can alleviate endothelial cell dysfunction and endothelial-related diseases and may be a promising therapeutic target for a variety of inflammatory and autoimmune diseases.

[0007] A recombinant adenovirus targeting the pathogenic gene BRD4 acts specifically on endothelial cells, effectively knocking down abnormally expressed BRD4 in endothelial cells in vivo, thereby inhibiting the expression of inflammatory and tumor-promoting genes downstream of BRD4. This represents a novel targeted therapeutic strategy. The inventors achieved good therapeutic results by injecting this recombinant virus into mice with lupus nephritis, an immune-related nephritis, suggesting that targeted knockdown of BRD4 in endothelial cells may be a promising new clinical drug intervention.

[0008] The present invention first provides a tool sequence, which is a DNA sequence encoding shRNA for knocking down BRD4. The DNA sequence is:

[0009]

[0010] The present invention also provides a recombinant plasmid, which is circular and includes the tool sequence as described above, an EGFP sequence, and an endothelial cell-specific promoter sequence.

[0011] In a specific embodiment, the endothelial cell-specific promoter is TIE.

[0012] In a specific embodiment, the recombinant plasmid includes plasmid GV685 and the tool sequence inserted into the MCS position of plasmid GV685.

[0013] The present invention also provides a recombinant adenovirus for knocking down BRD4 in targeted manner in endothelial cells, which is packaged with the recombinant plasmid described above.

[0014] In the present invention, the recombinant adenovirus contains an EGFP segment, so that green fluorescence of positively transfected endothelial cells can be observed in vivo.

[0015] The present invention also provides a gene manipulation tool for treating lupus nephritis, lupus vasculitis or cancer, comprising the recombinant adenovirus and endothelial high transduction serum as described above.

[0016] Recombinant adenoviruses are currently widely used tools for gene transduction and gene therapy, with applications in gene therapy for diseases of the central nervous system, liver, heart, lungs, blood vessels, skin, and other areas. In this invention, the recombinant adenovirus, like adenovirus, has a high affinity for human and animal cells and is non-pathogenic, making it an excellent tool for gene manipulation and therapy.

[0017] The recombinant adenovirus of the present invention only initiates the knockdown of the BRD4 gene in specific endothelial cells, thus overcoming the waste caused by the non-specific, continuous and efficient expression of exogenous genes initiated by constitutive promoters in the receptors, and can increase the effect of transgenics.

[0018] The recombinant adenovirus described in the present invention can combine the targeted transcription ability of a specific promoter with endothelial high-efficiency AAV serum to enhance the targeted infection ability. This gene manipulation tool makes the knockdown of BRD4 in endothelial cells more precise and efficient.

[0019] When using this gene manipulation tool, the recombinant adenovirus is dispersed in endothelial high transduction serum and injected into lupus mice, which helps to improve lupus nephritis and lupus vasculitis.

[0020] The present invention has the following beneficial effects:

[0021] 1. The present invention only acts on endothelial cells, and the knockdown of the exogenous gene BRD4 is specifically expressed only in endothelial cells, thereby overcoming the waste caused by the non-specific, continuous, and efficient expression of exogenous genes initiated by constitutive promoters in the receptors, and increasing the effect of transgenics; and tissue-specific expression can reduce immune response, so the gene manipulation tool described in the present invention is more suitable for the study of disease mechanisms and treatments.

[0022] 2. There are many types of recombinant adenovirus serotypes. The differences in their capsid protein amino acid sequence, structure, and their interactions with host cell factors result in different serotypes of AAV having different infection efficiencies in different tissues and cells. The gene manipulation tools in the present invention include endothelial high-transduction serum, which will greatly improve the transduction efficiency.

[0023] 3. The gene manipulation tools described in the present invention are precise and efficient, and the recombinant adenovirus described in the present invention has good specificity and application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 Schematic diagram of the structure of the plasmid GV685 in the recombinant adenovirus of the present invention.

[0025] Figure 2 Schematic diagram of the sequence and size of each element of the plasmid GV685 in the recombinant adenovirus of the present invention.

[0026] Figure 3 This is a fluorescence image of blood vessels in mice after tail vein injection of the gene manipulation tool.

[0027] Figure 4 This is a kidney section of a lupus mouse treated with the gene manipulation tool injected into the tail vein. DETAILED DESCRIPTION

[0028] The present invention will be described in detail below with reference to the accompanying drawings and specific embodiments.

[0029] The terms in this invention are explained as follows:

[0030] 1. Cell-specific promoters are promoters that regulate the expression of exogenous genes, generally only in cells of certain specific origins, making them more suitable for studying disease mechanisms and treatments. The TIE promoter used in this invention is specific for endothelial cells.

[0031] 2. Adeno-associated virus (AAV) is the simplest, non-enveloped single-stranded DNA virus discovered so far, and AAV has not been found to be associated with any disease. Recombinant adeno-associated virus (rAAV) is an engineered AAV vector that removes all protein-coding Rep or Cap gene sequences from the AAV genome, and only retains the trans-DNA sequences (i.e., ITR) at both ends that serve as packaging signals. After rAAV infects cells, it will not integrate and recombine with the host genome, thereby avoiding the risk of cancer. Since 1984, the first rAAV vector has been shown to be able to transduce exogenous genes into mammalian cells, and rAAV has gradually been used in life science research as a gene delivery vector. The U.S. FDA has approved two AAV gene therapy methods. In the present invention, recombinant adeno-associated virus is also referred to as recombinant adenovirus.

[0032] In a specific embodiment, the method for constructing the gene manipulation tool comprises the following steps:

[0033] 1. Design appropriate shRNA sequence for target gene BRD4:

[0034] Design appropriate shRNA sequences for the target gene BRD4 and select appropriate target sequences using bioinformatics prediction tools.

[0035] 2. Synthesis and cloning of shRNA sequences:

[0036] The shRNA-encoding DNA sequences were synthesized and then inserted into an adeno-associated viral plasmid vector containing a TIE cell-specific promoter to ensure that these sequences are properly processed and expressed by the cellular machinery after transfection. The vector is GV685, and the vector element sequence is TIEp-EGFP-MIR155(MCS)-WPRE-SV40 PolyA.

[0037] 3. Co-transfection of adeno-associated virus vector plasmid and packaging plasmid:

[0038] HEK 293 cells are co-transfected with an AAV vector plasmid and a packaging plasmid that helps assemble viral particles. The packaging plasmid provides essential AAV proteins and adenoviral helper proteins without integrating into the genome itself.

[0039] 4. Production and purification of recombinant adenovirus particles:

[0040] The cells produce recombinant adenoviral particles containing the shRNA expression plasmid. The viral particles are then collected and purified to remove cellular residues and unpackaged material.

[0041] 5. Titer determination and functional verification:

[0042] Titering of recombinant adenoviral particles is typically performed using real-time quantitative PCR to determine the number of infectious units. Validation of viral potency involves performing experiments in mammalian cells or animal models and measuring the reduction of target gene expression to ensure effective knockdown.

[0043] 6. Application and evaluation:

[0044] The validated AAV-shRNA viral particles, i.e., the recombinant adenovirus particles, are placed into ENT endothelial high transduction serum and act on endothelial cells through dual (endothelial cell-specific promoter and endothelial high transduction serum) for laboratory research or as a potential therapeutic strategy for further functional testing and efficacy evaluation.

[0045] Specifically, the experimental process of the present invention includes the following steps:

[0046] ①shRNA target design, that is, designing shRNA sequences to knock down BRD4.

[0047] ② Preparation of double-stranded DNA oligonucleotides, i.e. synthesis of DNA sequences encoding shRNA.

[0048] ③ Enzyme digestion of adeno-associated virus vector, i.e., using enzyme digestion to open the circular plasmid GV685. Figure 1 As shown, the commercially available plasmid GV685 inherently contains the TIE endothelial cell-specific promoter sequence.

[0049] ④ Connect to form a new plasmid, that is, connect the plasmid GV685 with the DNA sequence encoding shRNA to form a new plasmid, that is, obtain a recombinant plasmid.

[0050] ⑤ Preparation of competent cells. The purpose of this step is to form multiple recombinant plasmids. Since the recombinant plasmid itself cannot be amplified, the recombinant plasmid is placed into cells. When the cells amplify, the recombinant plasmid is amplified synchronously. The competent cells are, for example, commercially available HEK 293 cells, i.e., human embryonic kidney cells 293.

[0051] ⑥ Transformation: transforming the recombinant plasmid into the HEK293 cells.

[0052] ⑦ Colony PCR identification and / or sequencing of positive clones to confirm that the recombinant plasmid includes the DNA sequence encoding shRNA. Part of the key sequence of the recombinant plasmid is shown in Sequence 2.

[0053] ⑧ Plasmid extraction: extract the recombinant plasmid from HEK 293 cells and purify the recombinant plasmid.

[0054] ⑨ Functional verification: verifying that the recombinant plasmid can be used to treat lupus nephritis in mice.

[0055] In the present invention, the recombinant adenovirus needs to be injected into the mouse body and needs to be dissolved before injection. In the present invention, the recombinant adenovirus is dissolved in endothelial high transduction serum and then injected into the commercially available lupus nephritis model mouse body.

[0056] In the present invention, the plasmid GV685 can be purchased commercially, or the adenovirus containing the plasmid GV685 can be directly purchased.

[0057] In the present invention, if the plasmid GV685 already exists in the adenovirus, the inventors need to add the DNA sequence encoding the shRNA into the circular plasmid GV685 in the adenovirus to form a new recombinant plasmid.

[0058] In summary, the present invention combines the targeted transcriptional capabilities of a specific promoter with the targeted infection capabilities of an adeno-associated virus serotype to create a more precise and efficient recombinant adenovirus. In vivo validation has demonstrated that the genetic manipulation tool provided by the present invention exhibits superior endothelial cell targeting and anti-inflammatory therapeutic effects. The recombinant adenovirus provided by the present invention exhibits strong endothelial cell specificity and holds promising application prospects in a variety of disease areas.

[0059] Figure 1The diagram shows the structure of the plasmid GV685 in the recombinant adenovirus of the present invention. Vector length: 5.7 kb. Ori, Ampr, and MCS are the basic elements of the vector, which can carry exogenous genes into recipient cells for cloning and amplification of gene fragments. Replication origin ori: This is the site that controls the initiation of replication. The arrow in ori indicates the direction of replication, while arrows marked with other elements usually indicate the direction of transcription (forward). f1 ori refers to the replication origin in eukaryotic cells. Resistance element Ampr: This is an ampicillin antibiotic resistance gene and a screening tag used to kill bacteria during shaking. Positive clones are screened by antibiotics. Two ITRs: L-ITR and R-ITR, are both inverted terminal repeats that play a role in replication and packaging. Promoter P TIE: P refers to promoter, and P TIE is the endothelial cell-specific promoter TIE. Fluorescent protein EGFP: Enhanced green fluorescent protein. Multiple cloning site (MCS): This is a specific region for inserting the target gene sequence. In the present invention, the DNA sequence encoding the shRNA used for inserting the hairpin structure is used. WPRE sequence: A cis-acting RNA element, a post-transcriptional regulatory sequence. Placed before the polyadenylation signal, it significantly increases mRNA expression levels and translation efficiency, thereby enhancing gene expression. Inserting WPRE into viral vectors can also significantly improve viral packaging titers. Poly A signal: Terminates gene transcription.

[0060] Figure 2 A schematic diagram showing the order and size of the various components of plasmid GV685, the recombinant adenovirus of the present invention. Length: 5718 bp. SV40 poly A, transcription termination signal. Two ori: f1 ori (eukaryotic replication origin) and pUC ori (prokaryotic replication origin). Figure 2 In the same method, the shRNA encoding DNA sequence is inserted between the EGFP and WPRE sequences, but because the sequence is too small, Figure 2 It is not displayed in the . Figure 2 The introduction of other related components is the same as Figure 1 .

[0061] Figure 3 After the gene manipulation tool was injected into mice through the tail vein, spontaneous EGFP green fluorescence was observed in mouse tissue sections under a microscope. Because the plasmid GV685 itself contains the EGFP sequence, the endothelial cells of mice injected with the recombinant plasmid emit green fluorescence.

[0062] Figure 4Microscopic scans of kidney tissue sections from mice treated for lupus following tail vein injection of the gene manipulation tool. Panel A shows an untreated mouse, with black arrows indicating inflammatory foci. Panel B shows a treated mouse, i.e., a lupus nephritis mouse model, injected with the gene manipulation tool comprising the recombinant adenovirus described herein. As can be seen in the treated mouse, Panel B shows significantly reduced renal inflammation.

[0063] Sequence 1 is the DNA sequence encoding the shRNA. Sequence 1 is 154 bp in total.

[0064] Sequence 1:

[0065]

[0066] The target sequence corresponding to sequence 1 is: GCCTTTCTACAAGCCTGTGGA. The target sequence is a sequence in the DNA encoding the BRD4 protein.

[0067] The Brd4-RNAi (114337-1) sequence is the DNA sequence encoding the shRNA shown in Sequence 1, which includes five parts as shown in Table 1 below.

[0068] Table 1

[0069]

[0070] Sequence 2 is the partial cloning sequencing result of the recombinant plasmid in the recombinant adenovirus in the gene manipulation tool of the present invention, and specifically is the key 1000 bp sequence in the recombinant plasmid.

[0071] Sequence 2:

[0072]

[0073] As can be seen from the above, the present invention has constructed a recombinant adenovirus that specifically expresses and targets the endothelium and is used to knock down BRD4. After dissolving and injecting it, it has a good therapeutic effect on mice with lupus nephritis. The present invention specifically knocks down BRD4 in mouse endothelial cells through gene knockdown technology, realizing the exploration of effective intervention methods for high BRD4 to promote disease progression. This recombinant adenovirus is combined with an endothelial cell-specific promoter and endothelial high-transduction serum. It acts specifically only on endothelial cells and has high transduction efficiency. It can be used to study clinical prevention and treatment measures for autoimmune diseases and tumors, as well as for the development and research of new drugs.

[0074] The above-described embodiments are only preferred implementations of the present invention, but the scope of protection of the present invention is not limited thereto. Any equivalent replacement or modification made by any technician familiar with the field within the technical scope disclosed by the present invention based on the technical solution and inventive concept of the present invention should be covered by the scope of protection of the present invention.

Claims

1. A gene manipulation tool for treating lupus nephritis, characterized in that: The lupus nephritis is caused by the mouse BRD4 gene. The gene manipulation tool includes a recombinant adenovirus and an endothelial high transduction serum. The recombinant adenovirus is packaged with a recombinant plasmid. The recombinant plasmid includes plasmid GV685 and a tool sequence inserted into the MCS position of plasmid GV685. The recombinant plasmid also includes an EGFP sequence and an endothelial cell-specific promoter sequence TIE. The tool sequence is a DNA sequence encoded by shRNA for knocking down BRD4. The DNA sequence is: ACCGCTAGCTAACTGGAGGCTTGCTGAAGGCTGTATGCTGTCCACAGGCTTGTA GAAAGGCGTTTTGGCCACTGACTGACGCCTTTCTAAGCCTGTGGACAGGACACAAG GCCTGTTACTAGCACTCACATGGAACAAATGGCCCCTCGAGGGT.

Images