L-aspartate alpha-decarboxylase mutants and uses thereof

Abstract

The application relates to the technical field of enzyme catalysis. The application discloses an L-aspartate alpha-decarboxylase mutant, which is obtained after the 54th amino acid residue in the amino acid sequence of L-aspartate alpha-decarboxylase panD is mutated into X; the amino acid sequence of the L-aspartate alpha-decarboxylase panD is shown in the sequence table SEQ ID NO. 1. The method has the advantages of green environmental protection, low cost and the like.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of enzyme catalysis, and particularly relates to a method for synthesizing 3-aminopropanol by L-homoserine catalyzed by an L-aspartate alpha-decarboxylase mutant. BACKGROUND

[0002] L-aspartate alpha-decarboxylase (PanD) can specifically catalyze the decarboxylation of L-aspartate to produce beta-alanine, and is a key enzyme for biosynthesis of beta-alanine, pantothenic acid, and camosine. Enzymatic synthesis is the mainstream method for synthesis of various compounds at present due to its greenness, high efficiency, and sustainability.

[0003] At present, L-aspartate alpha-decarboxylase from Corynebacterium glutamicum and Bacillus subtilis is commonly used, but the bottleneck for synthesis of beta-alanine or other products (3-aminopropanol) by the enzymes from the two sources is the low enzyme activity. SUMMARY

[0004] To solve the problem, the present application performs semi-rational design on L-aspartate alpha-decarboxylase to improve the catalytic performance of the new enzyme on different substrates (L-homoserine).

[0005] The present application aims to provide an L-aspartate alpha-decarboxylase mutant, which is obtained after the 54th amino acid residue in the amino acid sequence of L-aspartate alpha-decarboxylase panD is mutated to X; the amino acid sequence of the L-aspartate alpha-decarboxylase panD is shown in SEQ ID NO. 1.

[0006] Further, the 3rd amino acid residue is mutated to K on the basis of the 54th amino acid residue being mutated to X.

[0007] Further, the 88th amino acid residue is mutated to M on the basis of the 54th amino acid residue being mutated to X.

[0008] Further, the 26th amino acid residue is mutated to V on the basis of the 54th amino acid residue being mutated to X.

[0009] Further, the 88th amino acid residue is mutated to M on the basis of the 54th amino acid residue being mutated to X and the 3rd amino acid residue being mutated to K.

[0010] Further, the 26th amino acid residue is mutated to V on the basis of the 54th amino acid residue being mutated to X and the 3rd amino acid residue being mutated to K.

[0011] Further, based on the 54th amino acid residue being mutated into X, the 3rd amino acid residue being mutated into K and the 26th amino acid residue being mutated into V, the 88th amino acid residue is mutated into M.

[0012] Further, based on the 54th amino acid residue being mutated into X and the 26th amino acid residue being mutated into V, the 88th amino acid residue is mutated into M.

[0013] The application further provides an application of the L-aspartate alpha-decarboxylase mutant in catalyzing L-homoserine to produce 3-aminopropanol.

[0014] Further, the catalysis condition is that the pH is 6.5-7.0 and the temperature is 37℃.

[0015] The application adopts L-homoserine as a substrate, and synthesizes 3-aminopropanol (shown in the formula) through decarboxylation of the L-aspartate alpha-decarboxylase mutant. Figure 1 Compared with the existing chemical synthesis method, the application has the advantages of green environmental protection and low cost. BRIEF DESCRIPTION OF DRAWINGS

[0016] Figure 1 It is a synthesis schematic diagram of 3-aminopropanol.

[0017] Figure 2 It is an HPLC detection spectrum of L-homoserine standard.

[0018] Figure 3 It is an HPLC detection spectrum of 3-aminopropanol standard.

[0019] Figure 4 It is an HPLC detection spectrum of the conversion product. DETAILED DESCRIPTION

[0020] The specific embodiments of the application are described in more detail below with reference to the accompanying drawings and examples, so that the advantages of the application and various aspects can be better understood. However, the specific embodiments and examples described below are only an explanation of the application, but the application is not limited to the following examples.

[0021] The test methods used in the following examples are conventional methods unless otherwise specified.

[0022] The quantitative data involved in the following examples are the average values of at least three repeated experiments.

[0023] The materials and reagents used in the examples of the application can be obtained from commercial channels unless otherwise specified.

[0024] The experimental materials involved in the following examples are as follows:

[0025] Carrier pET28a: Invitrogen Company.

[0026] Escherichia coli BL21 (DE3): Qianke Biotechnology Co., Ltd.

[0027] Homoserine standard: Aladdin, product number H105430.

[0028] 3-Aminopropanol: ACMEC, product number A41420.

[0029] The present application adopts homoserine as a substrate, and synthesizes 3-aminopropanol (as shown in the formula) after decarboxylation by L-aspartate alpha-decarboxylase mutant. Figure 1

[0030] Example 1

[0031] Construction of recombinant bacteria

[0032] The L-aspartate alpha-decarboxylase panD in the embodiments of the present application is derived from Bacillus subtilis, which is abbreviated as BspanD hereinafter.

[0033] The amino acid sequence of the BspanD is shown in SEQ ID NO. 1, and the base sequence is shown in SEQ ID NO. 2.

[0034] The amino acid single-point mutant sequence SEQ ID NO: 1 of the BspanD has the following mutations:

[0035] 3rd R→K;

[0036] 26th I→V;

[0037] 54th R→D;

[0038] 88th I→M.

[0039] On the basis of the mutation of the 54th amino acid residue of the BspanD to D, the amino acid double-point mutant of the BspanD has any one mutation selected from the following group:

[0040] 3rd R→K;

[0041] 26th I→V;

[0042] 88th I→M.

[0043] ​The amino acid three-point mutant of BspanD is constructed on the basis of the mutation of the 54th amino acid residue to D and the mutation of the 3rd amino acid residue to K, and the amino acid three-point mutant of BspanD has a mutation selected from the group consisting of:

[0044] the 26th I→V;

[0045] the 88th I→M.

[0046] The amino acid four-point mutant of BspanD is constructed on the basis of the mutation of the 54th amino acid residue to D, the mutation of the 3rd amino acid residue to K and the mutation of the 26th amino acid residue to V, and the amino acid four-point mutant of BspanD has a mutation selected from the group consisting of:

[0047] the 88th I→M.

[0048] The BspanD gene fragment is cloned from the genome of Bacillus subtilis, and EcoR I and Hind III double enzyme digestion sites are added at both ends of the BspanD gene fragment. Then, the gene fragment BspanD is connected with the expression vector pET28A which has also been subjected to double enzyme digestion under the action of T4 DNA ligase (purchased from Takara Company) at 16°C overnight to obtain the connection liquid BspanD.

[0049] The connection liquid BspanD is used to transform the DH5α competent cells (purchased from Beijing Chengke Biological Technology Co., Ltd.), and sequencing verification is performed, so as to obtain the positive recombinant plasmid pET28A-BspanD.

[0050] The positive recombinant plasmid pET28A-BspanD is used to transform the expression host bacteria Escherichia coli BL21 (DE3) (purchased from Beijing Chengke Biological Technology Co., Ltd.), so as to obtain the prokaryotic expression strain pET28A-BspanD-BL21 (DE3).

[0051] The recombinant pET28A-BspanD-BL21 (DE3)-wt is used as a DNA template, the sequences in Table 1 are used as primers, the site-directed mutagenesis method is used, and the pET28A is used as an expression vector, so as to obtain a mutant plasmid with a mutant gene. The site-directed mutagenesis refers to introducing the required changes (usually changes representing the beneficial direction) into the target DNA fragment (which can be a genome or a plasmid) by a polymerase chain reaction (PCR) and the like, including the addition, deletion and point mutation of bases and the like.

[0052] Table 1. Primer sequence list

[0053] Primer Sequence R3K F CATGTATAAAACAATGATGAGCGGCAAACT R3K R TCATTGTTTTATACATGAATTCGGATCCGC I88M F CATTATTATGTCCTACAAAATGATGTCTGA I88M R TGTAGGACATAATAATGACCTTATCTCCTT I26V F GGGAAGCGTTACAATTGATGAAGATCTCAT I26V R CAATTGTAACGCTTCCCACATAGTTCAGGT R54D F TGGAGCAGACCTTGAAACGTATATTATTCC R54D R TTTCAAGGTCTGCTCCATTATTATTATTCA

[0054] Note: The underlined base position in the sequence is the corresponding amino acid mutation position.

[0055] The specific process of constructing the mutant library is as follows:

[0056] The system and conditions of PCR are as follows, using Apex HFHS DNA polymerase: the volume of a single PCR reaction solution is 50 μL, containing the following components: Apex HFHS DNA 2x: 25 μL; forward and reverse (10 pm) / reverse primer (10 pm): 1.5 μL + 1.5 μL; wild-type plasmid (pET28A-BspanD-BL21(DE3)-wt plasmid containing SEQ ID NO: 1, 100 ng / μL): 1 μL; water: 22 μL.

[0057] The PCR reaction conditions are as follows: 98°C for 10 min, 98°C for 10 s, 55°C for 30 s, 72°C for 4 min, 35 cycles, 72°C for 10 min, 4°C forever.

[0058] After the PCR is completed, 1.5 μL Dpn I (20 U / μL) is added to the above-mentioned PCR reaction solution, and 37°C, 3 h.

[0059] The obtained different mutant plasmids are respectively transformed into E. coli BL21(DE 3) to obtain different mutants.

[0060] Example 2

[0061] Preparation of BspanD mutant crude enzyme solution

[0062] The BspanD mutant strain constructed above is inoculated into 100 mL 2YT liquid medium containing a final concentration of 50 μg / ml kanamycin at a proportion of 1% (V / V) after being cultured in 5 mL 2YT liquid medium (0.5% NaCl, 1% yeast extract, 1.6% tryptone) containing a final concentration of 50 μg / ml kanamycin at 37°C, 220 rpm overnight, and is cultured at 37°C, 220 rpm to obtain a culture solution BspanD mutant.

[0063] When the OD600 of the BspanD mutant culture solution is between 0.6 and 0.8, an inducer IPTG with a final concentration of 0.5 mM is added for induction at 25°C overnight to obtain induced BspanD mutant bacterial solution.

[0064] The induced BspanD mutant bacterial solution is centrifuged at 4°C, 6000 rpm for 10 min, the bacterial body is collected, and is suspended in 50 mM phosphate (dipotassium hydrogen phosphate and potassium dihydrogen phosphate) pH7.0 buffer, and is ultrasonically broken (200 W, 5 s / 7 s, 20 min) to obtain a BspanD mutant crude enzyme solution.

[0065] Example 3

[0066] Catalytic activity assay of wild-type and various mutant BspanD

[0067] L-homoserine was added to the crude enzyme solution prepared in Example 2. In a reaction system of 50 mM phosphate (dipotassium hydrogen phosphate and potassium dihydrogen phosphate) at pH 7.0, the concentration of the BspanD crude enzyme solution was 10 OD / ml, and the concentration of L-homoserine was 10 mM. The mixture was catalytically reacted at 37°C and 220 rpm for 12 hours to obtain the conversion solution.

[0068] After the catalytic reaction was completed, the resulting conversion solution was heat-treated in a boiling water bath at 80℃ for 10 min. After the heat treatment, it was centrifuged at 4℃ and 12000 rpm for 5 min, and the supernatant was collected. The supernatant was derivatized with DNFB (2,4-dinitrofluorobenzene) and the content of 3-aminopropanol was determined by HPLC.

[0069] DNFB derivatization method: Take 50 μl of sample, 20 μl of 1M sodium bicarbonate, and 80 μl of DNFB derivatizing agent, mix well, and incubate at 60℃ for 30 min. After 30 min, remove the sample and add 50 μl of 1M hydrochloric acid, mix well, and centrifuge at 12000 rpm for 5 min. Collect the supernatant and filter it through a 0.22 μM filter membrane. Collect the filtrate for HPLC detection of the 3-aminopropanol content. HPLC uses an RP-C18 column, mobile phase: 35% acetonitrile + 65% 0.1% formic acid solution, flow rate: 0.7 mL / min, column temperature: 25℃, injection: 10 μl, detection wavelength: 360 nm.

[0070] The results are as follows Figure 2 As shown, the retention time of the L-homoserine standard is 8.105 min.

[0071] like Figure 3 As shown, the retention time of the 3-aminopropanol standard is 12.775 min.

[0072] like Figure 4 As shown, the conversion solution contains peaks with retention times of 8.126 min and 12.773 min, indicating that 3-aminopropanol was generated using L-homoserine as a substrate.

[0073] The experiment was conducted in triplicate, and the average value was taken. After screening and verification, the mutation status, transformation rate, and mutation sites of wild-type and mutant were shown in Table 2 below.

[0074] Table 2. Mutation status, transformation rate, and mutation sites of wild-type and mutant strains

[0075]

[0076] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.

Claims

1. An L-aspartate α-decarboxylase mutant, which is obtained by mutating R at the 54th amino acid residue to D in the amino acid sequence of L-aspartate α-decarboxylase panD; The amino acid sequence of the L-aspartate α-decarboxylase panD is shown in SEQ ID NO.

1.

2. A mutant of L-aspartate a-decarboxylase characterized in that, The mutant is obtained by mutating R at the 54th amino acid residue to D and I at the 88th amino acid residue to M in the amino acid sequence of L-aspartate α-decarboxylase panD; The amino acid sequence of the L-aspartate α-decarboxylase panD is shown in SEQ ID NO.

1.

3. A mutant of L-aspartate a-decarboxylase characterized in that, The mutant is obtained by mutating R at the 54th amino acid residue to D and I at the 26th amino acid residue to V in the amino acid sequence of L-aspartate α-decarboxylase panD; The amino acid sequence of the L-aspartate α-decarboxylase panD is shown in SEQ ID NO.

1.

4. A mutant of L-aspartate a-decarboxylase characterized in that, The mutant is obtained by mutating R at the 54th amino acid residue to D, R at the 3rd amino acid residue to K and I at the 88th amino acid residue to M in the amino acid sequence of L-aspartate α-decarboxylase panD; The amino acid sequence of the L-aspartate α-decarboxylase panD is shown in SEQ ID NO.

1.

5. A mutant of L-aspartate a-decarboxylase characterized in that, The mutant is obtained by mutating R at the 54th amino acid residue to D, R at the 3rd amino acid residue to K and I at the 26th amino acid residue to V in the amino acid sequence of L-aspartate α-decarboxylase panD; The amino acid sequence of the L-aspartate α-decarboxylase panD is shown in SEQ ID NO.

1.

6. A mutant of L-aspartate a-decarboxylase characterized in that, The mutant is obtained by mutating R at the 54th amino acid residue to D, R at the 3rd amino acid residue to K, I at the 26th amino acid residue to V and I at the 88th amino acid residue to M in the amino acid sequence of L-aspartate α-decarboxylase panD; The amino acid sequence of the L-aspartate α-decarboxylase panD is shown in SEQ ID NO.

1.

7. A mutant of L-aspartate a-decarboxylase characterized in that, The mutant is obtained by mutating R at the 54th amino acid residue to D, I at the 26th amino acid residue to V and I at the 88th amino acid residue to M in the amino acid sequence of L-aspartate α-decarboxylase panD; The amino acid sequence of the L-aspartate α-decarboxylase panD is shown in SEQ ID NO.

1.

8. Use of the L-aspartate α-decarboxylase mutant of any one of claims 1 to 7 in catalyzing L-homoserine to produce 3-aminopropanol.

9. Use of an L-aspartate a-decarboxylase mutant according to claim 8 for catalysing the production of 3-aminopropanol from L-homoserine, characterized in that, The catalysis is under the condition of pH 6.5-7.0 and temperature 37℃.

Images