Escherichia coli strain for efficiently producing beta-alanine as well as construction method, production method and application of escherichia coli strain
By genetically modifying Escherichia coli strains, introducing mutant aspartate decarboxylase and overexpressing antioxidant enzymes, and optimizing metabolic pathways, the problem of oxidative stress in β-alanine production was solved, achieving high-efficiency production.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- QINGDAO YOURUIDA BIOTECHNOLOGY CO LTD
- Filing Date
- 2025-12-30
- Publication Date
- 2026-04-10
AI Technical Summary
In existing technologies, the production efficiency of microbial synthesis of β-alanine is limited by the stability of the cells during the non-growth phase and the control of oxidative stress. In particular, when fatty acids are used as substrates, oxidative stress is aggravated, leading to impaired cell viability and affecting production efficiency.
A multi-plasmid system was constructed using genetic engineering techniques. A mutant aspartate decarboxylase (L17F/G24R) was introduced, and phosphoenolpyruvate carboxylase (PPC) was overexpressed to optimize metabolic pathways and reduce dependence on NADPH. At the same time, the antioxidant enzymes thioredoxin/glutathione peroxidase (BtuE) and glutathione reductase (Gor) were overexpressed to enhance the antioxidant capacity of cells.
It significantly increased the yield of β-alanine, optimized carbon flow distribution, enhanced the synthesis efficiency of cells during the non-growth phase, and broke through the bottleneck of traditional fermentation processes.
Smart Images

Figure CN121825839A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of microbial metabolic engineering technology, specifically to an efficient Escherichia coli strain for producing β-alanine, its construction method, and its application. Background Technology
[0002] β-Alanine is a naturally occurring β-amino acid that plays a crucial role in various biosynthetic pathways, particularly in the formation of D-pantothenic acid, where it is a key precursor essential for the synthesis of coenzyme A and acyl carrier proteins. β-Alanine is widely used in the food, feed, and pharmaceutical industries, and in the human body, it combines with other amino acids to form carnosine, which buffers muscle tissue acidity, thereby enhancing athletic performance. Furthermore, research indicates that β-Alanine has potential therapeutic and cognitive-enhancing effects on certain neurological disorders. Market forecasts predict that global demand for β-Alanine will reach 90,000 tons by 2024, demonstrating significant market potential.
[0003] Currently, the synthesis methods for β-alanine are mainly divided into two categories: chemical synthesis and biosynthesis. While chemical synthesis yields higher quantities, it involves toxic precursors and harsh reaction conditions, posing environmental and safety concerns. Another option is biotransformation; however, this method requires expensive substrates (such as L-aspartic acid or fumaric acid) and high purification levels, making it costly and unsuitable for large-scale production. In contrast, microbial fermentation is considered a more promising green production route because it does not rely on expensive chemical reagents and is sustainable. However, in practical applications, the efficiency of microbial fermentation is limited by the stability of the cell cells during the non-growth phase and the control of oxidative stress responses.
[0004] Escherichia coli ( Escherichia coli E. coli is a commonly used industrial fermentation strain, possessing a relatively fast growth rate and mature genetic modification tools. During its non-growth quiescent phase, E. coli cell morphology undergoes remodeling and exhibits a certain degree of stress resistance. However, cell activity and survival rate decrease over time during the quiescent phase, eventually leading to cell death. Furthermore, under aerobic conditions, E. coli produces superoxide in the periplasm through the oxidation of dihydromenadione, accelerating the cell death process. To cope with these oxidative stress responses, cells typically initiate protective mechanisms such as the transmembrane cycling of glutathione to maintain cell stability. However, when fatty acids are used as substrates, the β-oxidation of fatty acids requires a large amount of oxygen, further exacerbating oxidative stress, leading to impaired cell viability and affecting the production efficiency of β-alanine. Summary of the Invention
[0005] To solve the above technical problems, the present application uses genetic engineering means to transform the Escherichia coli strain, constructs a multi-plasmid system to optimize the metabolic pathway and improve the product synthesis efficiency. First, by constructing a recombinant plasmid pET-PanD, a mutant aspartate decarboxylase (L17F / G24R mutant) is introduced to promote the efficient conversion of aspartate to beta-alanine. At the same time, by overexpressing phosphoenolpyruvate carboxylase (PPC) through recombinant plasmid pRSF-PPC, the generation of oxaloacetate (OAA) is increased, thereby improving the carbon flow to the beta-alanine synthesis pathway. In addition, the NADH-dependent aspartate dehydrogenase (AspDH) from Pseudomonas aeruginosa is overexpressed by pBAD-AspDH plasmid to reduce the dependence on NADPH, further improving the conversion efficiency. In order to alleviate the problem of oxidative stress, the present application introduces pBBR1-BG plasmid to overexpress antioxidant enzymes thioredoxin / glutathione peroxidase (BtuE) and glutathione reductase (Gor) to enhance the antioxidant capacity of cells and stabilize cell activity. Through these engineering modifications, the present application effectively optimizes the carbon flow distribution, enhances the beta-alanine synthesis efficiency of cells in the non-growth phase, thereby breaking through the bottleneck of traditional fermentation process and significantly improving the yield of beta-alanine.
[0006] To solve the above technical problems, the present application provides a genetically engineered strain for efficient production of beta-alanine, which comprises the following mutant genes and overexpression systems: a mutant aspartate decarboxylase gene (PanD) containing L17F and G24R mutation sites, constructed as pET-PanD plasmid and expressed under the T7 promoter by IPTG induction; an overexpressed aspartase (AspA) gene, constructed as pACY-AspA plasmid and stably expressed under the control of Pgrac promoter without induction; an overexpressed phosphoenolpyruvate carboxylase (PPC) gene, constructed as pRSF-PPC plasmid and expressed by IPTG induction to enhance the carbon flow to the synthesis of beta-alanine; an overexpressed aspartate dehydrogenase (AspDH) gene derived from Pseudomonas aeruginosa, constructed as pBAD-AspDH plasmid and expressed by L-arabinose induction; and overexpressed antioxidant enzyme genes BtuE and Gor, constructed as pBBR1-BG plasmid and continuously expressed without induction to enhance the antioxidant capacity of cells.
[0007] The original nucleotide sequence of the PanD gene is shown in SEQ ID NO: 1, wherein the 51st nucleotide is mutated from T to C (L17F) and the 72nd nucleotide is mutated from G to A (G24R) by mutation.
[0008] The nucleotide sequence of the AspA gene is shown in SEQ ID NO: 2.
[0009] The nucleotide sequence of the PPC gene is shown in the sequence table SEQ ID NO: 3.
[0010] The nucleotide sequence of the AspDH gene is shown in the sequence table SEQ ID NO: 4.
[0011] The application also provides a method for constructing the genetically engineered strain, comprising the following steps: Firstly, the constructed pET-PanD and pACY-AspA plasmids are co-transformed into the E. coli BL21 (DE3) strain, and cultured in a double-antibiotic screening medium containing kanamycin and chloramphenicol, and the integration of the PanD and AspA genes is verified by plasmid extraction and PCR; Secondly, the pRSF-PPC plasmid is introduced into the strain screened in the first step, and triple screening of kanamycin, chloramphenicol and streptomycin is used to ensure that the pET-PanD, pACY-AspA and pRSF-PPC plasmids are successfully integrated, and the presence of the PPC gene is verified by PCR; Thirdly, the pBAD-AspDH and pBBR1-BG plasmids are introduced into the strain screened in the second step, and a culture medium containing tetracycline is used for screening, and the integration of the BtuE and Gor genes is confirmed by PCR, to ensure that all target genes stably exist in the recombinant strain.
[0012] The application also provides a fermentation method for efficiently producing beta-alanine, which uses the genetically engineered strain described above and ferments in a culture medium containing sodium acetate as a carbon source.
[0013] The fermentation process includes two-stage carbon source supplementation, first using glucose for cell growth, and then using sodium acetate as a carbon source for continuous production of beta-alanine.
[0014] The application also provides the method for efficiently producing beta-alanine described above, which inoculates the genetically engineered strain described above into a culture medium in a fermenter, the culture medium initially contains 4-8 g / L of glucose, and the fermentation is carried out under the conditions of a dissolved oxygen concentration of 15% to 35%, a temperature of 30-37℃, and a stirring rate of 300-800 rpm for at least 12 hours, glucose is used as a carbon source in the early stage of fermentation, and sodium acetate is switched to as a carbon source in the late stage of fermentation, the addition amount of sodium acetate is 10 g / L, and sodium acetate is continuously supplemented by pH control mode to maintain the appropriate acid-base balance.
[0015] The recombinant E. coli engineering strain described above is used in the preparation of beta-alanine and its derivative products.
[0016] The beneficial effects of the application Enhanced β-alanine synthesis efficiency: Introduction of mutant aspartate decarboxylase and overexpression of phosphoenolpyruvate carboxylase (PPC) optimizes carbon flow distribution, making the conversion of aspartate to β-alanine more efficient, thereby significantly increasing production.
[0017] Optimized energy utilization: By introducing NADH-dependent aspartate dehydrogenase (AspDH), reducing the consumption of NADPH, enhancing the energy utilization efficiency of metabolism, further supporting the synthesis of β-alanine.
[0018] Relieve oxidative stress: By overexpressing antioxidant enzymes (BtuE and Gor), the antioxidant capacity of cells is enhanced, the activity time of cells is prolonged, the stability of fermentation process is improved, and the continuous production of β-alanine in the non-growth phase is ensured.
[0019] Flexible two-stage fermentation strategy: Using stage carbon source supplementation and optimization, it can switch carbon source under different growth conditions, providing greater flexibility for efficient production of β-alanine.
[0020] In summary, this technical solution overcomes the technical bottlenecks in traditional fermentation process through multi-level gene regulation and carbon flow optimization, realizes high yield of β-alanine, and has strong industrial application potential. BRIEF DESCRIPTION OF DRAWINGS
[0021] Figure 1 Performance of recombinant E. coli BL21(DE3) / pP overexpressing PanD (expressed by pP plasmid). A: Time course curve. B: Sub-phase and overall indicators of fermentation results. Error bars represent standard deviation from repeated experiments. The vertical line in the figure divides the transition from the rapid cell growth phase (Phase 1) to the product generation phase (Phase 2). OD: optical density.
[0022] Figure 2 Performance of recombinant E. coli BL21(DE3) / pP / pA overexpressing PanD (pP plasmid) and AspA (pA plasmid). A: Time course curve. B: Sub-phase and overall indicators of fermentation results. Error bars represent standard deviation from repeated experiments. The vertical line in the figure divides the transition from the rapid cell growth phase (Phase 1) to the product generation phase (Phase 2). OD: optical density.
[0023] Figure 3 Performance of recombinant E. coli BL21 (DE3) / pP / pPPC and BL21 (DE3) / pP / pAPPC. A: Time course profile of BL21 (DE3) / pP / pPPC. B: Fermentation results in stages and overall of BL21 (DE3) / pP / pPPC. C: Time course profile of BL21 (DE3) / pP / pAPPC. D: Fermentation results in stages and overall of BL21 (DE3) / pP / pAPPC. Plasmids pP, pPPC and pAPPC carry PanD, PPC and AspDH and PPC, respectively. Error bars indicate standard deviation of duplicate experiments. The vertical line in the graph divides the transition from the fast cell growth phase (stage 1) to the product formation phase (stage 2). OD: optical density.
[0024] Figure 4 Performance of recombinant E. coli BL21 (DE3) / pP / pAPPC / pBG overexpressing PanD (pP plasmid), AspDH and PPC (pAPPC plasmid) and BtuE and Gor (pBG plasmid). A: Time course profile. B: Fermentation results in stages and overall. Error bars indicate standard deviation of duplicate experiments. The vertical line in the graph divides the transition from the fast cell growth phase (stage 1) to the product formation phase (stage 2). OD: optical density.
[0025] Figure 5 Production of beta-alanine from sodium acetate by E. coli BL21 (DE3) / pP and BL21 (DE3) / pP / pA. A: Time course profile of BL21 (DE3) / pP overexpressing PanD on pP plasmid. B: Fermentation results indicators during acetate utilization (13-21 h) of BL21 (DE3) / pP. C: Time course profile of BL21 (DE3) / pP / pA overexpressing PanD on pP plasmid and AspA on pA plasmid. D: Fermentation results indicators during acetate utilization (13-21 h) of BL21 (DE3) / pP / pA. For both strains, cells were initially cultivated in 60 mM glucose for 13 h, followed by addition of 120 mM sodium acetate. Error bars indicate standard deviation of duplicate experiments. The vertical line in the graph indicates the transition from the fast cell growth phase (stage 1) to the product formation phase (stage 2). qs indicates specific acetate consumption rate, qp indicates specific beta-alanine production rate. OD: optical density.
[0026] Figure 6. Experiments on β-alanine production in a fed-batch bioreactor using glucose and sodium acetate as carbon sources. A: *E. coli* BL21(DE3) / pP / pAAP / pBG with glucose as the carbon source. B: *E. coli* BL21(DE3) / pP / pA with sodium acetate as the carbon source. In experiment B, cells were initially grown in 18 g / L glucose for 9 hours, followed by fed-batch feeding with sodium acetate. OD: Optical density. Detailed Implementation
[0027] To clone aspartate decarboxylase, the *E. coli* genome was used as a template, and PanD was constructed through overlapping fragment amplification. L17F / G24R The mutant was ligated into the pET-28a plasmid, which was double-digested with NdeI and XhoI, to form the pET-PanD plasmid, enabling efficient expression of PanD under the control of the T7 promoter. The exogenous gene PanD is derived from... E. coli K-12 substr. MG1655 Its nucleotide sequence is shown in SEQ ID NO: 1.
[0028] ATGATTCGCACGATGCTGCAGGGCAAACTCCACCGCGTGAAAGTGACTCATGCGGACCTGCACTATGAAGGTTCTTGCGCCATTGACCAGGATTTTCTTGACGCAGCCGGTATTCTCGAAAACGAAGCCATTGATATCTGGAATGTCACCAACGGCAAGCGTTTCTCCACTTATGCCATCGCGGCAGAAC GCGGTTCGAGAATTATTTCTGTTAACGGTGCGGCGGCCCACTGCGCCAGTGTCGGCGATATTGTCATCATCGCCAGCTTCGTTACCATGCCAGATGAAGAAGCTCGCACCTGGCGACCCAACGTCGCCTATTTTGAAGGCGACAATGAAATGAAACGTACCGCGAAAGCGATTCCGGTACAGGTTGCTTGA Aspartate aminotransferase AspA was cloned into the pACYCDuet-1 plasmid and overexpressed under the control of the Pgrac promoter. Specifically, the AspA gene was amplified by PCR from the *E. coli* genome, overlapped and ligated with a Pgrac fragment to form the Pgrac-AspA fragment, which was then inserted into pACYCDuet-1 digested with XbaI and XhoI to construct the pACY-AspA plasmid. This achieved efficient expression and more stable aspartate production. The exogenous AspA gene was derived from... E. coli K-12 substr. MG1655having a nucleotide sequence as shown in SEQ ID NO: 2.
[0029] ATGGGTATTTTTTCTCGCTTTGCCGACATCGTGAATGCCAACATCAACGCTCTGTTAGAGAAAGCGGAAGATCCACAGAAACTGGTTCGTCTGATGATCCAGGAGATGGAAGATACACTGGTTGAAGTACGTTCTACTTCGGCGCGCGCGTTGGCAGAAAAGAAACAGCTGACTCGCCGTATTGAACAAGCGTCGGCGCGTGAGGTTGAATGGCAGGAAAAAGCCGAACTGGCGCTGCTGAAAGAGAGAGAGGATCTGGCACGTGCAGCGTTAATTGAAAAACAGAAACTGACCGATCTGATTAAGTCCCTGGAACATGAAGTGACGCTGGTGGACGATACGCTGGCACGCATGAAGAAAGAGATTGGCGAGCTGGAAAACAAATTGAGCGAAACACGCGCTCGCCAGCAGGCATTGATGTTACGTCATCAGGCGGCAAACTCGTCGCGCGATGTGCGTCGTCAGCTGGACAGTGGCAAACTGGATGAAGCAATGGCTCGTTTCGAATCTTTCGAACGTCGTATTGACCAGATGGAAGCGGAAGCAGAAAGCCACAGCTTCGGTAAACAAAAATCGCTGGACGATCAGTTTGCCGAACTGAAAGCCGATGATGCAATCAGCGAACAACTGGCACAATTAAAAGCCAAAATGAAGCAAGACAATCAATAA The PPC gene of phosphoenolpyruvate carboxylase (PPC) is amplified from the genome of Escherichia coli and inserted into the Xhol site of the pRSFDuet-1 plasmid to form the pRSF-PPC plasmid, which improves the oxaloacetate and optimizes the carbon flow distribution, and the exogenous gene PPC is derived from E. coli K-12 substr. MG1655 having a nucleotide sequence as shown in SEQ ID NO: 3.
[0030] After the aspartate dehydrogenase AspDH gene is amplified from the genome of Pseudomonas aeruginosa, it is inserted into the XbaI site of the pBAD33 plasmid to generate the pBAD-AspDH plasmid, so as to controllably express AspDH and reduce growth interference. The exogenous gene AspDH is derived from Pseudomonas aeruginosa PAOl The nucleotide sequence is shown as SEQ ID NO: 4.
[0031] ATGCTGAATATCGTCATGATCGGCTGCGGCGCCATCGGCGCCGGCGTCCTGGAACTGTTGGAGAACGATCCGCAACTGAGGGTCGATGCGGTGATCGTTCCTCGCGACTCCGAGACCCAGGTCCGCCATCGCCTGGCCAGCCTGCGCCGGCCGCCGCGGGTACTCAGCGCGCTGCCGGCCGGAGAGCGCCCCGATCTTCTGGTGGAGTGCGCCGGGCACCGCGCCATCGAGCAGCACGTGCTGCCGGCGCTGGCCCAAGGCATTCCCTGCCTGGTGGTCTCGGTGGGCGCGCTGTCCGAGCCGGGCCTGGTGGAGCGCCTGGAAGCCGCGGCGCAGGCCGGAGGCAGCCGCATCGAGCTGCTGCCCGGCGCCATCGGCGCCATCGATGCGCTGTCGGCGGCCAGGGTCGGTGGCCTCGAATCGGTGCGCTACACCGGGCGCAAGCCGGCGAGCGCCTGGCTGGGCACGCCAGGCGAGACGGTCTGCGACCTGCAGCGCCTGGAGAAGGCGCGGGTGATCTTCGACGGCAGCGCCCGCGAGGCGGCGCGGCTCTATCCGAAGAACGCCAATGTCGCCGCCACCCTGTCGCTCGCCGGCCTCGGCCTGGACCGCACCCAGGTGCGCCTGATCGCCGACCCCGAAAGCTGCGAGAACGTGCACCAGGTGGAAGCCAGCGGCGCCTTCGGCGGCTTCGAACTGACCTTGCGCGGCAAACCGCTGGCGGCCAACCCGAAGACATCGGCGCTGACCGTGTACAGCGTGGTCCGAGCGTTGGGCAACCACGCCCACGCGATTTCGATCTAG The btuE and gor genes of thioredoxin / glutathione peroxidase (BtuE) and glutathione reductase (Gor) were combined via overlap PCR to form the btuE-gor fragment, which was then inserted into the XbaI-digested pBBR1MCS plasmid to generate the pBBR1-BG plasmid. This ensures the continuous expression of antioxidant enzymes under non-inducible conditions, enhancing the cellular antioxidant capacity. The exogenous gene BtuE is derived from... E. coli K-12 substr. MG1655 Its nucleotide sequence is shown in SEQ ID NO: 5.
[0032] ATGCAAGATTCCATTCTGACGACCGTAGTGAAAGATATCGACGGTGAAGTGACCACGCTGGAGAAGTTCGCCGGTAATGTGCTGTTGATTGTCAATGTCGCCTCAAAGTGTGGCTTAACGCCGCAATATGAGCAGTTG GAGAATATTCAGAAAGCCTGGGTCGATCGAGGTTTTATGGTGCTGGGATTCCCGTGCAACCAGTTTCTGGAACAAGAACCGGGCAGCGATGAAGAGATTAAAACTTACTGTACCACCACATGGGGGGTGACGTTCCCG ATGTTCAGTAAGATTGAAGTTAATGGCGAAGGACGCCATCCGCTGTATCAAAAATTGATTGCCGCAGCGCCGACCGCAGTCGCGCCGGAAGAGAGCGGATTCTATGCCCGTATGGTCAGCAAAGGCCGTGCACCGCTG TACCCGGATGATATTTTATGGAATTTTGAAAAATTCCTGGTTGGCAGGGACGGAAAAGTCATCCAGCGTTTTTCCCCGGATATGACGCCGGAAGATCCCATTGTGATGGAAAGCATTAAACTGGCGTTGGCAAAATAA The exogenous gene Gor originates from E. coli K-12 substr. MG1655 Its nucleotide sequence is shown in SEQ ID NO: 6.
[0033] Further, the construction process of pET-PanD plasmid is as follows: First, design primers at both ends of PanD gene using NdeI and XhoI recognition sites, mutate and amplify the original PanD sequence in E. coli genome; Second, PCR amplify the mutated PanD gene sequence, and double enzyme cut the amplification product and pET-28a vector; Third, insert the PanD gene fragment into pET-28a to obtain pET-PanD plasmid for subsequent IPTG induced PanD protein expression.
[0034] The nucleotide sequence of the pET-PanD plasmid is as shown: PanD-F: 5'-CATATGTTGCTGACCATCGGCGAAC-3' (primer sequence containing NdeI site, NdeI site in front, followed by the front sequence of PanD gene, the nucleotide sequence is shown in SEQ ID NO: 7) PanD-R: 5'-CTCGAGTTACTGCTGAACCGCATCC-3' (primer sequence containing XhoI site, XhoI site in front, followed by the tail sequence of PanD gene, the nucleotide sequence is shown in SEQ ID NO: 8).
[0035] The specific method for constructing pACY-AspA plasmid is as follows: First, amplify AspA gene from E. coli genome, and design primers to add XbaI and XhoI sites at both ends of the amplified fragment; Second, after amplification, generate Pgrac-AspA fragment by PCR overlap of AspA gene fragment and Pgrac promoter fragment; Third, after XbaI and XhoI double enzyme digestion, insert Pgrac-AspA fragment into pACYCDuet-1 vector to construct pACY-AspA plasmid.
[0036] AspA-F: 5'-TCTAGAATGTCGGCGATCAGTGGTA-3' (primer sequence containing XbaI site, XbaI site in front, the nucleotide sequence is shown in SEQ ID NO: 9) AspA-R: 5'-CTCGAGTCAGCGTGGCGATGGCGGA-3' (primer sequence containing XhoI site, XhoI site in front, the nucleotide sequence is shown in SEQ ID NO: 10) The method for constructing the pRSF-PPC plasmid is as follows: First, the PPC gene is amplified from the E. coli genome, and primers are designed to add XhoI sites at both ends; Second, the XhoI-treated PPC fragment is inserted into the XhoI site of the pRSFDuet-1 vector to form the pRSF-PPC plasmid; Third, this plasmid efficiently expresses the PPC protein under IPTG induction, supporting oxaloacetate production.
[0037] PPC-F: 5'-CTCGAGATGGCCGATGTCTTGTC-3' (primer sequence containing an XhoI site, the nucleotide sequence of which is shown in SEQ ID NO: 11) PPC-R: 5'-CTCGAGCTAGGCGTGGTGATGCG-3' (primer sequence containing an XhoI site, the nucleotide sequence of which is shown in SEQ ID NO: 12) The method for constructing the pBAD-AspDH plasmid is as follows: First, the aspDH gene is amplified from the P. aeruginosa genome, and primers are designed to add XbaI and XhoI sites at both ends; Second, after double digestion with XbaI and XhoI, aspDH is inserted into the pBAD33 plasmid to form the pBAD-AspDH plasmid; Third, this plasmid induces AspDH expression through L-arabinose, adapting to changing growth stage requirements.
[0038] AspDH-F: 5'-TCTAGACGGAAGCCTTCTGGCGAAC-3' (primer sequence containing an XbaI site, the nucleotide sequence of which is shown in SEQ ID NO: 13) AspDH-R: 5'-CTCGAGCTATCGGTCGTGACCGTAC-3' (primer sequence containing an XhoI site, the nucleotide sequence of which is shown in SEQ ID NO: 14) The specific method for constructing the pBBR1-BG plasmid is as follows: First, the btuE and gor genes are amplified using overlap PCR technology, and the two genes are ligated to form a btuE-gor fragment; Second, the btuE-gor fragment is inserted between the EcoRI and XbaI restriction sites to form the pBBR1-BG plasmid; Third, this plasmid continuously expresses antioxidant enzymes under non-inducing conditions, improving the oxidative tolerance of cells.
[0039] BtuE-F: 5'-GCGGAATTCCGATGACGTGGTGACC-3' (EcoRI site, the nucleotide sequence of which is shown as SEQ ID NO: 15) Gor-R: 5'-GCGTCTAGACTAGCCGTGTAGGGA-3' (XbaI site, the nucleotide sequence of which is shown as SEQ ID NO: 16) The method for constructing the recombinant strain of Escherichia coli for efficiently producing beta-alanine, specifically comprises: Firstly, the constructed pET-PanD and pRSF-PPC plasmids are co-transformed into an Escherichia coli chassis strain (such as E. coli BL21 (DE3)), and cultured in a double-antibiotic screening medium containing kanamycin and streptomycin, so as to ensure that the strain containing the two plasmids is successfully screened, and the integration of the PanD and PPC genes is confirmed by plasmid extraction and PCR verification; Secondly, the pACY-AspA plasmid is introduced into the strain containing the pET-PanD and pRSF-PPC plasmids, and triple screening of kanamycin, streptomycin and chloramphenicol is used to ensure that the three plasmids are successfully introduced, and the presence of AspA is confirmed by PCR.
[0040] Thirdly, the pBAD-AspDH plasmid and the pBBR1-BG plasmid are introduced into the strain obtained in the second step, and tetracycline resistance screening is used to ensure the expression of the antioxidant enzymes BtuE and Gor, and the integration of all the plasmids is verified by PCR to ensure that all the target genes stably exist in the recombinant strain.
[0041] The embodiments of the present application are described in detail below by using examples and drawings, so that the process of how the present application applies technical means to solve technical problems and achieve technical effects can be fully understood and implemented.
[0042] Analysis method Cell growth was measured by OD 600 Monitoring was performed using a UV / Vis spectrophotometer (Lambda 20, PerkinElmer). The conversion factor was 1 OD 600 Corresponding to 0.3 g of dry cell weight per liter. Metabolites in the culture broth (including glucose, amino acids, acetic acid, and pyruvic acid) were quantitatively analyzed by high-performance liquid chromatography (HPLC, Agilent). After centrifugation at 13,000 g for 10 minutes, the culture supernatant was purified by filtration with a 0.22 µm membrane before HPLC analysis.
[0043] For substrate analysis, Aminex HPX-87H ion exclusion column was used with column temperature maintained at 65 °C, 0.01 M sulfuric acid as mobile phase, and flow rate of 0.5 mL / min. Phenomenex column was used for amino acid quantification with column temperature set at 30 °C, mobile phase of 15:85 mixture of methanol and 2 mM Cu(OH)2buffer, and flow rate of 1.0 mL / min.
[0044] The primers used in the present application were provided by Macrogen. Standard molecular biology experiments (including PCR, gel electrophoresis, and transformation) were performed according to the specifications in order to develop the strains. The required reagents, such as restriction enzymes and pfu DNA polymerase for PCR, were purchased from New England Biolabs and Solgent, respectively.
[0045] Example 1 Construction of pET-PanD plasmid Primer design: Primers were designed at both ends of PanD gene using NdeI and XhoI restriction sites. According to the PanD sequence of E. coli genome, L17F / G24R mutation was introduced and amplified, PanD-F: 5'-CATATGTTGCTGACCATCGGCGAAC-3' (containing NdeI site) PanD-R: 5'-CTCGAGTTACTGCTGAACCGCATCC-3' (containing XhoI site) PCR amplification and enzyme digestion: PanD gene with mutation was amplified, and the product was digested with NdeI and XhoI along with pET-28a vector.
[0046] Ligation and construction: PanD gene was inserted into the digested pET-28a vector, and T4 DNA ligase was used to ligate the two, forming pET-PanD plasmid. This plasmid efficiently expresses PanD under the control of T7 promoter induced by IPTG.
[0047] Resistance screening: The constructed pET-PanD plasmid was transformed into E. coli DH5α competent cells, and resistance screening was performed using LB solid medium containing kanamycin (50 µg / mL), and single colonies were picked and verified for the presence and sequence correctness of PanD gene through plasmid extraction and PCR.
[0048] Example 2 Construction of pACY-AspA plasmid Primer design: AspA gene was amplified from E. coli genome, and XbaI and XhoI restriction sites were added at both ends.
[0049] AspA-F: 5'-TCTAGAATGTCGGCGATCAGTGGTA-3' (containing XbaI site) AspA-R: 5'-CTCGAGTCAGCGTGGCGATGGCGGA-3' (containing XhoI site) PCR overlap: Overlap the AspA gene fragment with the Pgrac promoter fragment to form the Pgrac-AspA fragment.
[0050] Enzymatic digestion and ligation: After double digestion with XbaI and XhoI, the Pgrac-AspA fragment is inserted into the pACYCDuet-1 vector to obtain the pACY-AspA plasmid, which realizes high-efficiency overexpression of AspA.
[0051] Resistance screening: The constructed pACY-AspA plasmid is transformed into DH5α competent cells, and LB solid medium containing chloramphenicol (34 μg / mL) is used for screening, and single colonies are picked for plasmid extraction and PCR verification.
[0052] Example 3 Construction of pRSF-PPC plasmid Primer design: The PPC gene is amplified from the E. coli genome, and the primer with XhoI site is designed.
[0053] PPC-F: 5'-CTCGAGATGGCCGATGTCTTGTC-3' (containing XhoI site) PPC-R: 5'-CTCGAGCTAGGCGTGGTGATGCG-3' (containing XhoI site) Enzymatic digestion and ligation: After treatment with XhoI, the PPC fragment is inserted into the XhoI site of the pRSFDuet-1 vector to form the pRSF-PPC plasmid, which highly expresses the PPC protein under IPTG induction and enhances the generation of oxaloacetate.
[0054] Resistance screening: The pRSF-PPC plasmid is transformed into DH5α competent cells, and LB solid medium containing streptomycin (50 μg / mL) is used for screening, and the positive clones are extracted for plasmid extraction and PCR verification.
[0055] Example 4 Construction of pBAD-AspDH plasmid Primer design: The aspDH gene is amplified from the Pseudomonas aeruginosa genome, and XbaI and XhoI sites are added at both ends.
[0056] AspDH-F: 5'-TCTAGACGGAAGCCTTCTGGCGAAC-3' (containing XbaI site) AspDH-R: 5'-CTCGAGCTATCGGTCGTGACCGTAC-3' (containing Xho I site) Enzymatic digestion and ligation: The aspDH gene was inserted into pBAD33 plasmid after Xba I and Xho I digestion, forming pBAD-AspDH plasmid, which regulated AspDH expression under the induction of L-arabinose, reducing the interference of growth.
[0057] Resistance screening: The pBAD-AspDH plasmid was transformed into DH5a competent cells, and LB solid medium containing chloramphenicol (34 μg / mL) was used for screening. Single colonies were extracted, and the presence of the aspDH gene was verified by plasmid extraction and PCR.
[0058] Example 5 Construction of pBBR1-BG plasmid Construction of btuE-gor fragment: Primers were designed to connect the btuE and gor genes to form a btuE-gor fragment.
[0059] BtuE-F: 5'-GCGGAATTCCGATGACGTGGTGACC-3' (containing Eco R I site) Gor-R: 5'-GCGTCTAGACTAGCCGTGTAGGGA-3' (containing Xba I site) Enzymatic digestion and ligation: The btuE-gor fragment was inserted into the Eco R I and Xba I digestion sites of pBBR1MCS to form the pBBR1-BG plasmid, which expressed the antioxidant enzymes BtuE and Gor without induction, enhancing the antioxidant capacity of the cells.
[0060] Resistance screening: The pBBR1-BG plasmid was transformed into DH5a competent cells, and LB solid medium containing tetracycline (10 μg / mL) was used for screening. Positive clones were verified by PCR.
[0061] Example 6 Construction of recombinant strains Primary transformation and screening The constructed pET-PanD and pRSF-PPC plasmids were co-transformed into E. coli BL21 (DE3) as the chassis strain, and double-antibiotic screening was performed on LB solid medium containing kanamycin (50 μg / mL) and streptomycin (50 μg / mL). Positive clones were picked, and the integration of PanD and PPC genes was verified by plasmid extraction and PCR.
[0062] Triple plasmid transformation and screening In the screened E. coli BL21 (DE3) strain containing pET-PanD and pRSF-PPC, the pACY-AspA plasmid was again transformed, and triple screening was performed on LB solid medium containing kanamycin, streptomycin, and chloramphenicol. The integration of the AspA gene in the screened strain was confirmed, and verification was performed by PCR.
[0063] Quintuple plasmid transformation and screening The pBAD-AspDH and pBBR1-BG plasmids were sequentially transformed into the E. coli BL21 (DE3) strain already containing the previous three plasmids, and screening was performed using a medium containing tetracycline to ensure the expression of the antioxidant enzymes BtuE and Gor. Verification of the integration of the final plasmid was performed by PCR to ensure the stable presence of all target genes in the recombinant strain.
[0064] Example 7 Flask culture A single colony was inoculated into 10 mL of LB medium (containing 10 g / L tryptone, 5 g / L yeast extract, and 10 g / L NaCl) and cultured overnight at 37°C. The cultured LB cells were transferred to a 250 mL flask containing 20 mL of modified medium, adjusted to an OD 600 of 0.1, and incubated overnight at 37°C as an inoculum for the main culture. The main flask culture was performed in a 250 mL flask containing 20 mL of modified medium, and incubated in a shaking incubator at 37°C and 220 rpm.
[0065] The modified medium contained, per liter: glucose 20 g, yeast extract (Oxoid Yeast Extract) 2 g, , , , , , L-threonine 0.15 g, L-methionine 0.2 g, L-lysine 0.2 g, L-isoleucine 0.05 g, and trace element solution 5 mL. The composition of the trace element solution was (g / L): , , , , , , , and 35% HCl. During the culture, antibiotics were added as necessary, including ampicillin (100 μg / mL), chloramphenicol (25 μg / mL), and kanamycin (50 μg / mL).
[0066] When the glucose in the initial culture was almost depleted (about 10 g / L), sodium acetate was added as a carbon source to maintain the subsequent growth of the cells.
[0067] Effect of introducing PanD mutant enzyme into E. coli on production of β-alanine Since aspartate (ASP) is a common intermediate of homoserine and β-alanine, introducing an efficient aspartate decarboxylase is expected to further improve the production efficiency of β-alanine. Therefore, a mutant high-activity aspartate decarboxylase gene was used in the present application to construct a recombinant plasmid pET-PanD, which was introduced into an E. coli strain. In a shake flask experiment, the recombinant strain almost depleted the glucose in the culture medium (initial concentration of 20 g / L) within 23 hours, successfully producing 86 mM of β-alanine. However, the conversion rate of β-alanine was still low, only 0.54 mol / mol, accounting for 56% of the corresponding homoserine yield.
[0068] During the experiment, it was observed that the production rate of β-alanine significantly increased at the 9th hour of fermentation, while the cell growth rate decreased, as shown in Figure 1 A, indicating that the carbon flow in the strain was redistributed from the cell growth phase to the synthesis of β-alanine. Therefore, the fermentation process can be divided into two stages: stage 1, referred to as the active growth phase, and subsequent stage 2, referred to as the production phase. Although the glucose consumption rate was similar in the two stages, the production rate of β-alanine significantly increased in stage 2, with its conversion rate increasing by about three times compared to stage 1, as shown in Figure 1 B. This change may be due to the spontaneous shift of carbon flow to the synthesis pathway of β-alanine.
[0069] The depletion of yeast extract in the culture medium (initial concentration of 2 g / L) may have played a key role in the shift of carbon flow to β-alanine, achieving a similar mechanism by reducing the growth rate of the cells. This phenomenon is consistent with previous observations in homoserine production.
[0070] Effect of introducing AspA plasmid into E. coli on production of β-alanine In the process of producing β-alanine from aspartate (ASP), the distribution of carbon flow has an important influence on the yield, especially the carbon flow balance at the phosphoenolpyruvate (PEP) node. The production of β-alanine can be achieved through three main pathways: the compensatory reaction through PPC connection, the diversion of glyoxylate (GOX), and the oxidative TCA cycle. The different metabolic balances of these three pathways determine their contribution to the production of β-alanine.
[0071] In the case of PPC-compensatory reaction, aspartate is synthesized from oxaloacetate (OAA) by AspC (glutamate-dependent transaminase), and OAA is generated from PEP by PPC. This pathway can theoretically achieve a high yield of beta-alanine. However, when AspC converts OAA to ASP, the demand for NADPH becomes a key limiting factor, especially NADPH must be generated from NADH by the pentose phosphate pathway, TCA cycle or PntAB transhydrogenase. Therefore, in order to ensure the supply of NADPH, a certain amount of glucose needs to be oxidized.
[0072] In the GOX shunt and oxidative TCA cycle, AspA (aspartate-ammonia lyase) can directly generate aspartate from fumarate without the dependence of NADPH. The three pathways are expected to contribute to the production of beta-alanine together, and the specific contribution ratio varies with the strain and culture conditions.
[0073] In order to improve the yield of beta-alanine, the present application implements the exogenous overexpression of aspartase AspA, and regulates based on plasmid pACY-AspA. As shown in the experimental results of Figure 2 , the up-regulation of AspA indeed increases the glucose consumption rate, but has limited effect on the actual yield of beta-alanine, and instead causes the overall conversion rate to decrease by 19%. This phenomenon shows that the overexpression of AspA may direct the carbon flow to the oxidative TCA cycle or GOX shunt, thereby causing more CO2 release, resulting in carbon loss.
[0074] Effect of overexpression of PPC and AspDH on production of beta-alanine by E. coli The up-regulation of AspA has limited effect, so further research is conducted to enhance the effect of AspC by up-regulating PPC, so that more oxaloacetate (OAA) can be used for aspartate synthesis. After realizing the overexpression regulation of PPC by recombinant plasmid pRSF-PPC, the recombinant strain significantly improves the glucose consumption rate, yield and conversion rate in the production stage, each of which is increased by more than 20% ( Figure 3 A). In addition, the production rate of beta-alanine increases by 50% in stage 2, indicating that the overexpression of PPC can enhance the role of PPC-compensatory reaction in the synthesis of beta-alanine.
[0075] To reduce the NADPH requirement in this pathway, NADH-dependent aspartate dehydrogenase AspDH from Pseudomonas aeruginosa was also introduced. This enzyme uses ammonium as the amino donor to facilitate the reversible conversion of oxaloacetate to aspartate, reducing the dependence on NADPH. Theoretically, the forward action of this enzyme can further improve the yield of beta-alanine. Using a dual-plasmid recombinant strain (carrying pET-PanD, pRSF-PPC and pBAD-AspDH plasmids) overexpressing AspDH and PPC, the experimental results show that the dual-plasmid combination increases the production conversion rate of beta-alanine by about 15% (Table 2). Figure 3 C). Although overexpression of AspDH reduces the NADPH requirement, its effect on cell growth and glucose consumption needs further study to optimize production.
[0076] Effect of improving antioxidant capacity on beta-alanine production The previous staged fermentation shows that extending the production phase helps to improve the yield of beta-alanine. However, the decline in cell activity during the non-growth phase is usually associated with oxidative stress. By overexpressing the antioxidant enzymes BtuE and Gor using the pBBR1-BG plasmid, oxidative stress can be significantly alleviated. The results of shake flask experiments on recombinant strains with antioxidant enzyme expression show that the yield, production rate and conversion rate of beta-alanine in the production phase are increased by about 9%, and the growth inhibition phenomenon caused by AspDH overexpression is also alleviated (Table 3). Figure 4 Antioxidant protection not only improves cell growth stability, but also promotes product accumulation during the non-growth phase.
[0077] Effect of sodium acetate as a carbon source on beta-alanine production Sodium acetate, as a cheap and readily available two-carbon molecule, has potential in microbial fermentation. However, it is toxic and has a slow absorption rate and low energy content. In the validation experiment, acetate was used as an alternative carbon source for beta-alanine production, using recombinant strains and comparing different expression levels of pET-PanD and pACY-AspA. Cells were cultured in glucose conditions for 13 hours, and then acetate was added to promote the production of beta-alanine. The data shows that the production rate and specific production rate of beta-alanine using sodium acetate as a carbon source in recombinant strains are significantly higher than those of the control strain by 50%, and the overall yield is also significantly increased (Table 4). Figure 5
[0078] When sodium acetate is used as a carbon source, both the energy and carbon skeleton required for beta-alanine synthesis must be provided. By regulating the expression level of AspA, more carbon flows to the GOX shunt pathway, which helps to improve the yield, while the oxidative TCA cycle is mainly used for the complete oxidation of acetyl-CoA, contributing less to the carbon skeleton of beta-alanine.
[0079] Example 8 Fermentation validation The fermentation was carried out using a 2 L fermentor (Bioflo 3000, New Brunswick Scientific) at 37 °C with an initial working volume of 1 L. At the start of the experiment, the medium formulation was used, and the medium components included glucose 20 g / L, yeast extract 2 g / L, 、 、 、 、 , and key amino acids (threonine 0.15 g / L, methionine 0.2 g / L, lysine 0.2 g / L, and isoleucine 0.05 g / L). Trace element solution (5 mL / L) provided essential metal ions to support cell growth and metabolic activities.
[0080] To maintain the dissolved oxygen concentration at about 20% of saturation, the agitation rate was automatically adjusted up to 1000 rpm. The pH was maintained at 6.85 ± 0.05 by automatic addition of solution. During the fermentation, to maintain the glucose concentration in the range of 5 to 10 g / L, a high concentration glucose solution of 700 g / L was intermittently fed. During the growth phase, yeast extract was added at a rate of 0.08 g / L / h, while the amino acid mixture (including threonine, methionine, and lysine) was added at a rate of 0.003 g / L / h. During the stationary phase, only yeast extract was added at a rate of 0.04 g / L / h.
[0081] When switching to sodium acetate as the carbon source, 10 g / L of sodium acetate was added after the initial 9 hours of cultivation in glucose. Subsequently, a pH-stat mode was employed to supplement 40% acetate to maintain the pH at around 6.85. In this mode, acetate served as both the carbon source and the pH neutralizer to maintain the appropriate medium acid-base balance. During the cultivation, the acetate concentration was maintained in the range of 5-10 g / L to ensure the continuous growth of the cells and the efficient production of beta-alanine.
[0082] Effect of two-stage fed-batch fermentation In the fed-batch fermentation experiment, two recombinant strains and different carbon sources were used: the modified *E. coli* BL21(DE3) / pET-PanD / pRSF-PPC / pBBR1-BG strain was used with glucose as the carbon source; while the *E. coli* BL21(DE3) / pET-PanD / pACY-AspA strain used acetic acid as the carbon source. In the two-stage bioreactor, the *E. coli* BL21(DE3) / pET-PanD / pRSF-PPC / pBBR1-BG strain continuously produced β-alanine during the nearly 60-hour fermentation process, including a 36-hour non-growth phase. At 61 hours of fermentation, the high yield of β-alanine reached 805.6 mM (71.7 g / L). Figure 6 (A) The overall conversion rate reached 1 mol / mol of glucose. In stage 1, the partial yield was 0.77 mol / mol, while in stage 2 the yield reached 1.29 mol / mol.
[0083] In addition, the *E. coli* BL21(DE3) / pET-PanD / pACY-AspA strain using acetic acid as a carbon source produced 555.7 mM (approximately 50.0 g / L) of β-alanine, with a yield of 0.33 mol / mol. Figure 6 (B) Throughout the entire production phase, including the 41-hour non-growth phase, β-alanine accumulated in a linear manner, demonstrating the strain's stable production capacity when using acetic acid as a carbon source. The two-stage fermentation strategy in this strain flexibly enabled substrate switching between the growth and production phases.
[0084] All of the foregoing primary implementations of this intellectual property right do not limit other forms of implementation of this new product and / or new method. Those skilled in the art will utilize this important information to modify the foregoing to achieve similar implementations. However, all modifications or alterations based on this new product invention are reserved rights.
[0085] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention in any other way. Any person skilled in the art may make changes or modifications to the above-disclosed technical content to create equivalent embodiments. However, any simple modifications, equivalent changes, and modifications made to the above embodiments based on the technical essence of the present invention without departing from the scope of the present invention shall still fall within the protection scope of the present invention.
Claims
1. A genetically engineered bacterial strain for efficient production of β-alanine, characterized by: comprising the following mutant genes and overexpression systems, a mutant aspartate decarboxylase gene (PanD) comprising L17F and G24R mutation sites, constructed as pET-PanD plasmid and expressed under T7 promoter by IPTG induction; an overexpressed aspartase (AspA) gene, constructed as pACY-AspA plasmid and stably expressed under Pgrac promoter without induction; an overexpressed phosphoenolpyruvate carboxylase (PPC) gene, constructed as pRSF-PPC plasmid and expressed by IPTG induction to enhance carbon flow to β-alanine synthesis; an overexpressed aspartate dehydrogenase (AspDH) gene, derived from Pseudomonas aeruginosa, constructed as pBAD-AspDH plasmid and expressed by L-arabinose induction; overexpressed antioxidant enzyme genes BtuE and Gor, constructed as pBBR1-BG plasmid and continuously expressed without induction to enhance the antioxidant capacity of the cell.
2. The recombinant E. coli engineered strain of claim 1, characterized in that: The original nucleotide sequence of the PanD gene is shown in SEQ ID NO: 1, wherein the 51st nucleotide is mutated from T to C (L17F) and the 72nd nucleotide is mutated from G to A (G24R) by mutation.
3. The recombinant E. coli engineered strain of claim 1, characterized in that: The nucleotide sequence of the AspA gene is shown in SEQ ID NO:
2.
4. The recombinant E. coli engineered strain of claim 1, characterized in that: The nucleotide sequence of the PPC gene is shown in SEQ ID NO:
3.
5. The recombinant E. coli engineered strain of claim 1, characterized in that: The nucleotide sequence of the AspDH gene is shown in SEQ ID NO:
4.
6. A method for constructing the genetically engineered bacterial strain of any one of claims 1 to 5, characterized in that: comprising the following steps: First, the constructed pET-PanD and pACY-AspA plasmids are co-transformed into E. coli BL21 (DE3) strain, cultured in double-antibiotic screening medium containing kanamycin and chloramphenicol, and the integration of PanD and AspA genes is verified by plasmid extraction and PCR; Second, the pRSF-PPC plasmid is introduced into the strain screened in the first step, triple screening with kanamycin, chloramphenicol and streptomycin is used to ensure that pET-PanD, pACY-AspA and pRSF-PPC plasmids are successfully integrated, and the presence of PPC gene is verified by PCR; Third, the pBAD-AspDH and pBBR1-BG plasmids are introduced into the strain screened in the second step, and tetracycline-containing medium is used for screening, and the integration of BtuE and Gor genes is confirmed by PCR to ensure that all target genes are stably present in the recombinant strain.
7. A fermentation method for efficiently producing β-alanine, characterized by: The genetically engineered strain of any one of claims 1 to 5 is used for fermentation in a medium containing sodium acetate as a carbon source.
8. The fermentation process for efficient production of beta-alanine according to claim 7, characterized by: The fermentation process includes two-stage carbon source supplementation, first using glucose for cell growth, and then using sodium acetate as a carbon source for continuous production of β-alanine.
9. A method for efficient production of beta-alanine, characterized by: The method comprises inoculating the genetically engineered strain of any one of claims 1 to 5 into a culture medium in a fermenter, the culture medium initially containing 4-8 g / L glucose, and fermenting for at least 12 hours under the conditions of a dissolved oxygen concentration of 15% to 35%, a temperature of 30-37°C, and a stirring rate of 300-800 rpm, using glucose as the carbon source in the early stage of fermentation and switching to sodium acetate as the carbon source in the later stage of fermentation, the amount of sodium acetate added being 10 g / L, and continuously supplementing acetic acid to maintain a suitable acid-base balance through a pH control mode.
10. Use of the recombinant Escherichia coli engineering strain of any one of claims 1 to 4 or the method of any one of claims 7 to 9 in the preparation of beta-alanine and its derivative products.