Application of CsPPC3 gene in regulation of carbon and nitrogen metabolism in cucumber fruit

By constructing transgenic plants with CsPPC3 gene overexpression and knockout, we studied its regulation of carbon and nitrogen metabolism in cucumber fruits, which improved the CO2 fixation efficiency and carbon cycling of the fruits, and improved the growth and metabolic balance of the fruits.

CN119685359BActive Publication Date: 2026-06-26CHINA AGRI UNIV

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
CHINA AGRI UNIV
Filing Date
2024-12-17
Publication Date
2026-06-26

AI Technical Summary

Technical Problem

Current technologies lack research on the role of the CsPPC3 gene in the regulation of carbon and nitrogen metabolism in cucumber fruits, which affects the carbon fixation efficiency and metabolic balance of the fruits.

Method used

By constructing transgenic plants with overexpression and gene knockout, and using the CsPPC3 gene to overexpress or knock out in cucumber fruits, we studied its role in carbon and nitrogen metabolism, including constructing the Super-1300-CsPPC3 overexpression vector and the CRISPR-Cas9 gene editing vector for genetic transformation.

Benefits of technology

CsPPC3 gene overexpression plants exhibit enhanced fruit CO2 refixation capacity, increased fruit weight, increased malic acid and soluble sugar content, and decreased amino acid content; CsPPC3 gene knockout plants exhibited reduced fruit CO2 refixation capacity, decreased fruit weight, decreased malic acid and soluble sugar content, increased starch content, and decreased carbon source.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119685359B_ABST
    Figure CN119685359B_ABST
Patent Text Reader

Abstract

The application provides application of a CsPPC3 gene in regulation of carbon and nitrogen metabolism of cucumber fruits, and takes a main-effect gene CsPPC3 coding phosphoenolpyruvate carboxylase (PEPC) in carbon fixation of cucumber fruits as a research target, the function of the CsPPC3 gene in carbon fixation of fruit photosynthesis and carbon and nitrogen metabolism is researched by constructing overexpression and gene knockout transgenic plants, it is found that the transgenic plant of the overexpression of the CsPPC3 gene has the following characteristics: the amount of CO2 released by respiration of the fruit is reduced, the CO2 refixing capacity is enhanced, the single fruit weight is increased, the content of malic acid, soluble sugar and starch is increased, and the content of amino acid is reduced; the transgenic plant of the knockout of the CsPPC3 gene has the following characteristics: the amount of CO2 released by respiration of the fruit is increased, the single fruit weight is reduced, the content of malic acid, soluble sugar and amino acid is reduced, the content of starch is increased, and the CO2 refixing capacity is reduced. The application has practical guiding significance for cultivating transgenic plants with high CO2 fixation efficiency.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to the application of the CsPPC3 gene in the regulation of carbon and nitrogen metabolism in cucumber fruits. Background Technology

[0002] Cucumber (Cucumis sativus L.) is a widely cultivated and important fruit and vegetable crop worldwide, with its fruit being a crucial economic organ. Cucumber fruits release a large amount of CO2 through internal respiration, of which approximately 88% can be captured and refixed to generate photosynthetic products for the fruit's own growth. The photosynthetic contribution of the cucumber fruit's exocarp to its own carbon accumulation is 9.4%, which is significant for fruit growth. Plants need to maintain a balance between carbon and nitrogen metabolism for normal growth and development. Both carbon and nitrogen are essential elements for plant growth, and an imbalance in their metabolism leads to decreased growth. In most non-photosynthetic tissues and the photosynthetic tissues of C3 plants, the non-photosynthetic PEPC plays a vital role in metabolic processes, its primary function being the continuous replenishment of tricarboxylic acid cycle intermediates.

[0003] Phosphoenolpyruvate carboxylase (PEPC) is a C4 photosynthetic functional enzyme. Currently, the known PEPC family genes in plants are divided into two categories: plant-type PEPC and bacterial-type PEPC. Guo Fang's study on tissue expression analysis of cucumber Cs-ppc genes and the effect of light intensity on their transcription level in leaves pointed out that the expression levels of Cs-ppcl and Cs-ppc3 are high in multiple tissues, while the tissue expression of Cs-ppc2 gene varies greatly, with high expression in flowers and low expression in other tissues. In response to light intensity, the expression level of Cs-ppcl and its biological cycle are significantly affected by light intensity compared to the other two Cs-ppc genes. The tissue expression of Cs-ppc2 gene varies greatly, which may play an important role in flower development. It is speculated that Cs-ppcl plays an important role in adapting to different light intensities (North China Journal of Agricultural Sciences, 2011, 26(5):21-24). However, there is currently no research on the role of the major gene CsPPC3 encoding phosphoenolpyruvate carboxylase (PEPC) in photosynthetic carbon fixation and carbon and nitrogen metabolism in cucumber fruit, and its function and application in carbon and nitrogen metabolism in cucumber fruit have not been reported. Summary of the Invention

[0004] The technical problem to be solved by this invention is to address the shortcomings of the prior art by providing an application of the CsPPC3 gene in the regulation of carbon and nitrogen metabolism in cucumber fruit. The research target is the major gene CsPPC3, which encodes phosphoenolpyruvate carboxylase (PEPC) in cucumber fruit carbon fixation. By constructing overexpression and gene knockout transgenic plants, the role of the CsPPC3 gene in photosynthetic carbon fixation and carbon and nitrogen metabolism in the fruit is studied, providing practical guidance for cultivating transgenic plants with high CO2 fixation efficiency.

[0005] To solve the above-mentioned technical problems, the technical solution adopted by the present invention is as follows:

[0006] An application of the CsPPC3 gene in the regulation of carbon and nitrogen metabolism in cucumber fruit, wherein the nucleotide sequence of the CsPPC3 gene is shown in SEQ ID NO.1 and the amino acid sequence encoded by the CsPPC3 gene is shown in SEQ ID NO.2, and the application includes: overexpressing or knocking out the CsPPC3 gene using biological techniques to obtain transgenic plants.

[0007] Preferably, the method for constructing the CsPPC3 gene overexpression transgenic plant is as follows: A Super-1300-CsPPC3 overexpression vector is constructed, and genetic transformation is performed by infecting cucumber cotyledons with Agrobacterium tumefaciens to overexpress the CsPPC3 gene in cucumber fruits. Positive buds are screened to obtain stably inherited transgenic plants. The transgenic plants overexpressing the CsPPC3 gene exhibit reduced CO2 release from cucumber fruits, enhanced CO2 refixation capacity, and increased single fruit weight. Simultaneously, the content of malic acid, soluble sugars, and starch increases, while the amino acid content decreases, indicating that more carbon sources are flowing to the carbon cycle in carbon and nitrogen metabolism.

[0008] Preferably, the method for constructing the CsPPC3 gene knockout transgenic plant is as follows: A CRISPR-Cas9 gene editing vector is constructed; genetic transformation is performed using Agrobacterium-mediated transformation of cucumber cotyledons to inhibit the expression of the CsPPC3 gene in cucumber fruits; positive buds are screened to obtain stably inherited transgenic plants. The CsPPC3 gene knockout transgenic plant results in increased CO2 release from cucumber fruits, reduced single-fruit weight, decreased malic acid, soluble sugar, and amino acid content, increased starch content, reduced CO2 refixation capacity, and decreased carbon source, thereby reducing the utilization of carbon sources in carbon and nitrogen metabolism.

[0009] The present invention has the following significant technical effects:

[0010] 1. This invention provides an application of the CsPPC3 gene in the regulation of carbon and nitrogen metabolism in cucumber fruit. Taking the major gene CsPPC3, which encodes phosphoenolpyruvate carboxylase (PEPC) in cucumber fruit carbon fixation, as the research target, the study investigates the role of the CsPPC3 gene in photosynthetic carbon fixation and carbon and nitrogen metabolism in fruit by constructing overexpression and gene knockout transgenic plants. This has practical guiding significance for cultivating transgenic plants with high CO2 fixation efficiency.

[0011] 2. Transgenic plants overexpressing the CsPPC3 gene showed reduced CO2 release from fruit respiration, enhanced CO2 refixation capacity, and increased fruit weight. Simultaneously, they exhibited increased levels of malic acid, soluble sugars, and starch, while amino acid content decreased, indicating a greater flow of carbon sources to the carbon cycle during carbon and nitrogen metabolism. Conversely, transgenic plants knocked out the CsPPC3 gene showed increased CO2 release from fruit respiration, decreased fruit weight, and reduced levels of malic acid, soluble sugars, and amino acids, while starch content increased. This indicated reduced CO2 refixation capacity and a decrease in carbon sources, resulting in decreased utilization of carbon sources in both carbon and nitrogen metabolism.

[0012] The present invention will now be described in further detail with reference to the accompanying drawings and embodiments. Attached Figure Description

[0013] Figure 1 This is a sequence analysis diagram of the CsPPC3 gene protein.

[0014] Figure 2 This is an expression analysis of the CsPPC3 gene in cucumber. A shows the expression pattern of the CsPPC3 gene in different organs of cucumber, and B shows the expression pattern of the CsPPC3 gene in different tissues of cucumber fruit. R: root, S: stem, L: leaf, MF: male flower, FF: female flower, DAA: days after flowering, Ex: exocarp, Me: mesocarp, MVB: main vascular bundle, Pl: placenta.

[0015] Figure 3 This is an identification diagram of CsPPC3 overexpressing transgenic plants.

[0016] Figure 4 This is an analysis of editing sites in CsPPC3 gene knockout plants. The target sequence is located below the black line, the nucleotide mutation sites are marked with red boxes, and the stop codon is marked with a red box and an asterisk (*).

[0017] Figure 5 This is a graph showing the protein levels of CsPPC3 transgenic plants.

[0018] Figure 6This is a phenotypic analysis of the fruits of cucumber CsPPC3 transgenic plants. A is the phenotypic diagram of the ovary / fruit of cucumber CsPPC3 transgenic plants on the day of flowering, B is the phenotypic diagram of the ovary / fruit of cucumber CsPPC3 transgenic plants 9 days after flowering, and C is the statistical analysis of the single fruit weight of cucumber CsPPC3 transgenic plants 9 days after flowering. Different letters represent significant differences (n≥5).

[0019] Figure 7 This is an analysis of the photosynthetic characteristics of the fruit of cucumber CsPPC3 transgenic plants. A represents the CO2 release rate of cucumber fruit 9 days after flowering (n≥5), * indicates P<0.05; ** indicates P<0.01; B represents the CO2 refixation rate, and different letters represent significant differences.

[0020] Figure 8 The values ​​represent the carbon and nitrogen content in cucumber fruits from wild-type (WT), CsPPC3 overexpressing (OE), and CsPPC3 knockout (ppc3) plants. A: malic acid, B: soluble sugar, C: starch, D: amino acids.

[0021] Figure 9 These are speculative models of CsPPC3 function in cucumber fruits: A: speculative model of CsPPC3 function in fruits of plants with CsPPC3 gene overexpression; B: speculative model of CsPPC3 function in fruits of plants with CsPPC3 gene knockout. Detailed Implementation

[0022] Example 1

[0023] This example demonstrates the cloning, isolation, and identification of the CsPPC3 gene.

[0024] The CsPPC3 (Csa5G577360) gene sequence was obtained using the Cucurbitaceae Genome Database (http: / / cucurbitgenomics.org / organism / 2). Based on the obtained gene sequence information, full-length cloning primers (F: ATGACGGACACTACTGACGATATC; R: TTAACCTGTGTTCCTCATTCCA) were designed for PCR amplification to obtain the target fragment.

[0025] The nucleotide sequence of the CsPPC3 gene is shown in SEQ ID NO.1, and the amino acid sequence encoded by the CsPPC3 gene is shown in SEQ ID NO.2.

[0026] Phylogenetic analysis revealed that cucumber CsPPC1 and CsPPC2 genes belong to the plant-type PEPC, while the CsPPC3 gene is highly homologous to genes such as Arabidopsis Atppc4, maize Zmppc4, and rice Osppc4, all of which are bacterial PEPC. The cucumber CsPPC3 gene consists of 3187 bases, encoding 1061 amino acids. Amino acid sequence alignment also showed a lack of the Ser site at the N-terminus. Figure 1 ).

[0027] Example 2

[0028] This example illustrates the expression analysis of the CsPPC3 gene in cucumber.

[0029] The expression of the cucumber CsPPC3 gene in different organs (roots, stems, leaves, male flowers, female flowers, and ovaries) and different fruit tissues (exocarp, mesocarp, placenta, and main vascular bundles) was detected using qRT-PCR. qRT-PCR results showed that the cucumber CsPPC3 gene was expressed in all detected organs and tissues, and its expression level gradually increased with fruit development, reaching a peak 6 days after flowering. Its expression level was higher than that in leaves and stems. Figure 2 A). Further analysis was conducted on the expression patterns of the CsPPC3 gene in the exocarp, mesocarp, main vascular bundle, and placenta of cucumber fruits, such as... Figure 2 As shown in Figure B, CsPPC3 expression was highest in the placental tissue (Pl), followed by the main vascular bundle (MVB), then the mesocarp (Me) and exocarp (Ex). This indicates that CsPPC3 is highly expressed primarily in the mesocarp, placental tissue, and main vascular bundle within the cucumber fruit.

[0030] Example 3

[0031] This example demonstrates the construction of transgenic plants overexpressing the CsPPC3 gene.

[0032] 1. The Super-1300 overexpression vector was selected, and double digestion was performed using SalⅠ and KpnⅠ restriction sites (reaction system as shown in Table 1, reaction conditions: 37℃, 3h). The target fragment was recovered by agarose gel electrophoresis. Primers F: ATGACGGACACTACTGACGATA TC and R: TTAACCTGTGTTCCTCATTCCA were designed to ligate the full-length CDS clone of the CsPPC3 gene to the recovered Super-1300 expression vector using homologous recombination technology. The ligation was then performed into E. coli Dh5α strain, and single colonies were picked for verification and assay. After successful sequencing, the bacterial culture was multiplied, and plasmids were extracted using the Tiangen Plasmid Mini-Prep Kit (Beijing) and stored at -20℃.

[0033] Table 1. Double enzyme digestion reaction system

[0034] Reagent Name Usage plasmid 1μg SalⅠ 1μL KpnⅠ 1μL 10×Buffer 2μL <![CDATA[ddH2O]]> 15μL Total volume 20μL

[0035] 2. The constructed plasmid was transformed into Agrobacterium using the heat shock transformation method and incubated upside down in a 28℃ incubator for 36-48 hours. Single colonies were picked for bacterial PCR identification. An equal volume of 50% glycerol was added to the bacterial solution that showed the target band, and the bacteria were preserved at -80℃.

[0036] 3. Genetic transformation of cucumber cotyledons infected by Agrobacterium

[0037] (1) Seed disinfection and germination

[0038] Prepare 800 mL of SGM solid medium (for seed germination): containing 3.544 g of MS519 medium powder, 3% sucrose, and 400 ng of 6-BA. After the solid is dissolved, adjust the pH of the medium to 5.6-5.8, and add 2 g of plant gel. Autoclave at 121℃ for 20 min.

[0039] Sowing: Select plump seeds of Xintai dense-spined cucumber, soak them in deionized water for at least half an hour to ensure they have absorbed water and swelled, then peel off the seed coat, taking care not to damage the seeds. In a clean bench, disinfect the seeds sequentially with 75% ethanol (30 seconds, rinse twice with sterile water) and 3% NaClO solution (shake gently for 12 minutes, rinse three times with sterile water). After disinfection, transfer to SGM solid medium, sow approximately 30 seeds per dish, and incubate in the dark at 28℃ for 24-40 hours (judgment is based on the appearance of 3-5 distinct vascular bundle ridges on the cotyledons), then the explants can be harvested.

[0040] (2) Agrobacterium infection of cucumber cotyledons

[0041] Prepare 800 mL of IMS medium (cotyledon differentiation): Contain 3.544 g MS519 medium powder, 3% sucrose, and 400 ng of 6-BA solid. Adjust the pH to 5.6-5.8 after dissolving. Add 2 g of plant gel. Autoclave at 121℃ for 20 min. After sterilization, when the temperature reaches approximately 60℃, add 800 ng of ABA solution, 160 ng of AS solution, and 4 mL of MES solution (0.5M). Do not add gel when sterilizing IM liquid medium.

[0042] Preparation of Agrobacterium infection solution: Prepare 40 mL of bacterial solution in advance according to the amount of cotyledons infected. When the OD600 of Agrobacterium solution reaches 0.6-0.8, centrifuge at 6000 rpm for 8 min at room temperature, collect the bacterial cells, resuspend the bacterial cells in 1M liquid medium, centrifuge again at 6000 rpm for 8 min, resuspend the bacterial cells again in 1M liquid medium and adjust the OD600 value to 0.2-0.3, and place in a 28℃ incubator in the dark for later use.

[0043] Preparation of cucumber cotyledon explants: In a clean bench, remove the hypocotyl and roots from seeds with vascular bundle ridges, being careful not to touch the root hairs. Cut off the distal 1 / 3 of the cotyledon, gently separate the two cotyledons, and carefully peel off the hypocotyl. A U-shaped opening will appear near the end of the cotyledon. Place it in IM liquid culture medium for later use. Treat all healthy cotyledons in this way. The entire process should be completed within 1 hour.

[0044] Agrobacterium infection: Using a 20mL syringe, transfer the cotyledonary explant into the syringe barrel, plug the syringe head with the stopper, pour in 10mL of Agrobacterium infection solution, gently expel air until only 10mL of infection solution remains, seal the syringe head needle hole with the syringe stopper, and gently and slowly pull the plunger. You will see the cotyledon releasing air bubbles and floating up and down inside. Stop when it reaches the 20mL mark. This process should last for 30 seconds. Maintain the 20mL mark for 1.5 minutes, gently shaking the syringe during this time to complete the vacuum negative pressure infection. After the time is up, gently release the plunger. When it returns to the 10mL mark, open the sealing head, replace with fresh infection solution, and repeat the above operation once.

[0045] Co-culture of cotyledons with Agrobacterium: After infection, spread the cotyledons on filter paper to absorb the Agrobacterium infection solution on the surface. Place each cotyledon with the inside facing up on IMS differentiation medium, seal it, and place it in an incubator at 28°C in the dark for about 3 days, until the cotyledons grow and turn yellow.

[0046] (3) Explant differentiation culture

[0047] Prepare 800 mL of SRM solid medium (resistance differentiation medium): This medium contains 3.544 g MS519 medium powder, 3% sucrose, and 400 ng of 6-BA solid. After dissolving the solid, adjust the pH to 5.6-5.8, and add 2 g of plant gel. Autoclave at 121℃ for 20 min. After sterilization, when the temperature reaches approximately 60℃, add 800 ng of ABA solution and 1.6 mg of the antibiotic termethin (Tim).

[0048] Explant (cucumber cotyledon) differentiation culture: The differentiated cucumber cotyledons were transferred to SRM solid medium with resistance. When placing them, the inner surface of the cotyledons was facing down, and the U-shaped opening was inserted into the medium. They were then placed in a tissue culture room for culture.

[0049] (4) Obtaining and cultivating positive plants

[0050] RM medium preparation (rooting medium): Contains 3.544g MS519 medium powder, 3% sucrose, and 400ng 6-BA solid. After dissolving, adjust the pH of the medium to 5.6-5.8, and add 2g of plant gel. Autoclave at 121℃ for 20 minutes. After sterilization, allow to cool to room temperature, then add 1.6mg of the antibiotic termethin (Tim).

[0051] Rooting culture: After the explants differentiated into shoots after 20 days of culture, they were cut off as independent individuals and transferred to rooting culture medium.

[0052] Transplanting and acclimatization: Transplant the rooted individual plants into sterilized substrate and harden and acclimate them in a light incubator.

[0053] RNA was extracted from the placental tissue of fruit 9 days after flowering from T1 generation plants of CsPPC3 overexpression (OE) positive lines and reverse transcribed into cDNA template. mRNA levels were then identified using qRT-PCR. Figure 3 It can be seen that the relative expression levels of each line have increased. Among them, the expression levels of OE#3 and OE#57 overexpression lines are 2 times and 6 times that of wild-type (WT) plants, respectively. They were selected as transgenic plants for CsPPC3 gene overexpression for further research.

[0054] Example 4

[0055] This example demonstrates the construction of CsPPC3 gene knockout transgenic plants.

[0056] A CRISPR-Cas9 gene editing vector was constructed, and CsPPC3 gene knockout plants were created using CRISPR-Cas9 gene editing technology. The CRISPR-Cas9 vector was designed with two targets: CAGGCAGAGCTTGGCTTCC and GATCTTCAGGACTAAGGTC. The construction of the cucumber transgenic plants was the same as in Example 3.

[0057] The obtained CsPPC3-edited T1 generation plants (ppc3#1 and ppc3#2) were examined. Primers were designed approximately 150 bp before the target site for PCR and sequencing. The sequencing results were compared with those of WT plants. It was found that each mutant had an insertion of a T base at the first target site. The ppc3#2 line also exhibited a deletion at the second target site, but this insertion was a frameshift mutation, causing CsPPC3 protein translation to terminate at base 550. In addition, the ppc3#2 line also had a single-base mutation at this target site, causing the edited amino acid to change from asparagine to histidine. Figure 4 ).

[0058] Protein levels in transgenic plants were identified using Western blotting analysis with a CsPPC3 protein-specific antibody. Proteins were extracted from the fruits of wild-type plants (WT), overexpression lines (OE#3, OE#57), and knockout lines (ppc3#1 and ppc3#2). Protein concentrations were determined using the Bradford method. Samples were aligned for protein content consistency before electrophoresis and immunoblotting. Quantitative analysis was performed using anti-Actin as a control. Figure 5 It can be seen that when the Actin protein bands are similar in color, the target protein bands of the OE#3 and OE#57 strains are darker than those of the WT strains, indicating that the PEPC protein content of the overexpression strains is higher than that of the WT strains. Furthermore, the Csa9-edited strains (ppc3#1 and ppc3#2) show no signal in their protein lanes, indicating that the knockout strains do not contain the target protein that can bind to the CsPPC3-specific antibody, and that ppc3#1 and ppc3#2 are effective editing strains.

[0059] Effects of transgenic plants obtained by overexpression and knockout of the CsPPC3 gene on cucumber fruit morphology, photosynthetic carbon fixation, and carbon and nitrogen metabolism.

[0060] 1. Cucumber fruit morphology

[0061] Figure 6 A represents the ovary / fruit on the day of flowering, with no significant difference in fruit size. Observation of mature cucumber fruits 9 days after flowering revealed that the fruits of plants overexpressing the CsPPC3 gene were larger, while the fruits of knockout lines were slightly smaller. Figure 6 B); Statistical analysis showed that the single fruit weight of the overexpressing plants reached 404.67-356.97g, which was higher than that of the wild-type plants (335.11g), while the single fruit weight of the knockout plants (245.25-260.04g) was significantly lower than that of the wild-type plants. Figure 6 C) indicates that the CsPPC3 gene has a certain impact on cucumber fruit development.

[0062] 2. Photosynthetic carbon fixation

[0063] Cucumber fruits release a large amount of CO2 at a high respiration rate when they mature. Since the CsPPC3 gene is mainly located inside the cucumber fruit, especially in the placenta, the infrared CO2 analysis method was used to determine the CO2 release rate of the fruit to explore the differences in fruit respiration rates.

[0064] The CO2 re-fixation rate is calculated as follows:

[0065] CO2 re-fixation rate (%) under light conditions = [(R S +R P –R I ) / (R S +R P)]×100,

[0066] CO2 re-fixation rate (%) under dark conditions = [(R S' +R P' –R I' ) / (R S' +R P' )]×100.

[0067] Among them, R S and R S' R represents the CO2 release rate inside the fruit (with peel removed) under light and dark conditions, respectively. p and R p' R represents the CO2 release rate of the fruit pericarp under light and dark conditions, respectively. I and R I' The figures represent the CO2 release rates of the entire fruit under light and dark conditions, respectively.

[0068] Depend on Figure 7 It can be seen that under dark conditions, wild-type cucumber fruits release large amounts of CO2 from the whole fruit, peel, and internal tissues, with release rates of 1.46 μmol / m³. -2 s -1 1.74 μmol m -2 s -1 1.41 μmol m -2 s -1 In contrast, the CO2 release rate decreased after illumination. Figure 7 A) indicates that under light conditions, some of the CO2 released by respiration in cucumber fruits is refixed, thus decreasing the measured apparent CO2 release rate. The CO2 refixation rate of wild-type cucumber fruits was 26.80% higher under light conditions than in darkness. Figure 7 B). Overexpressing cucumber plants showed lower overall respiration release rates in the whole fruit and internal tissues compared to wild-type plants, but significantly stronger CO2 fixation capacity. In contrast, knockout lines showed a significant increase in CO2 release rates in the dark compared to wild-type plants, but no significant change in CO2 release rates under light. Their CO2 refixation rate was not significantly different from that of the wild-type.

[0069] 3. Carbon and nitrogen metabolism

[0070] The malic acid, soluble sugar, starch, and amino acid contents of transgenic and wild-type cucumber fruits were determined, and the results are as follows: Figure 8 As shown in the figure. The results showed that overexpression of the CsPPC3 gene significantly promoted malic acid accumulation, increasing its content by 17.16%, while the malic acid content in the knockout line significantly decreased by 10.85%. Figure 8A). Compared with the sugar content in mature fruits of the wild type, the content of soluble sugar in the CsPPC3 overexpression lines was significantly increased, up 12.86%; the content of soluble sugar in the knockout lines was significantly decreased by 30.29%. Figure 8 B). Compared to wild-type plants, the starch content in the fruits of both overexpression lines and knockout lines was increased. Figure 8 C). The amino acid content of cucumber fruits decreased significantly in both plants overexpressing the CsPPC3 gene and those with the gene knocked out. Figure 8 D).

[0071] Table 2 lists the effects of overexpression and knockout of the CsPPC3 gene on cucumber fruit.

[0072] Table 2. Effects of CsPPC3 gene overexpression and knockout on cucumber fruit.

[0073]

[0074] Figure 9 This study aims to develop a model for the function of CsPPC3 in the carbon and nitrogen metabolism process of cucumber fruits in CsPPC3 gene overexpression and CsPPC3 gene knockout plants. Through gene expression, tissue-specific localization, enzyme activity assays, and related physiological metabolic pathways, the role and active sites of PEPC-mediated carbon fixation cycle and TCA cycle in cucumber fruits were inferred. Among them, PEPC: phosphoenolpyruvate carboxylase, PEP: phosphoenolpyruvate, OAA: oxaloacetic acid, Mal: ​​malic acid, Pyr: pyruvate, α-KG, and α-ketoglutarate. CO2 captured in the plant is converted to oxaloacetic acid (OAA) via PEPC catalysis through phosphoenolpyruvate (PEP). OAA then undergoes dehydrogenation catalyzed by MDH to produce malic acid (Mal). Malic acid can not only enter the decarboxylation reaction (NADP-ME) to release CO2 and be refixed by the C3 pathway, but it can also enter the tricarboxylic acid cycle (TCA) as an intermediate product, replenishing the carbon skeleton lost due to amino acid synthesis. This promotes the enhancement of the four-carbon dicarboxylic acid pathway in cucumber fruits, reduces light-induced respiration, consumes a large amount of CO2 for photosynthesis, and reduces CO2 loss in the dark, with more being fixed. Overexpression of CsPPC3 leads to the accumulation of malic acid, an increase in sugar content, and a decrease in amino acid content in its catalytic reaction. Conversely, knocking out the CsPPC3 gene reduces PEPC enzyme activity in cucumber fruits. Because it cannot effectively capture and fix CO2 released from internal respiration in the fruit, carbon loss occurs, ultimately resulting in a decrease in the content of malic acid, sugar, and total free amino acids in the fruit.

[0075] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention in any way. Any simple modifications, alterations, and equivalent changes made to the above embodiments based on the inventive essence shall still fall within the protection scope of the present invention.

Claims

1. CsPPC3 The application of genes in the regulation of carbon and nitrogen metabolism in cucumber fruits is characterized by, The CsPPC3 The nucleotide sequence of the gene is shown in SEQ ID NO.

1. CsPPC3 The amino acid sequence encoded by the gene is shown in SEQ ID NO.2, and the application includes: overexpressing or knocking out the gene using biological techniques. CsPPC3 Genes were used to obtain transgenic plants; in, CsPPC3 The method for constructing transgenic plants with gene overexpression is as follows: The Super-1300-CsPPC3 overexpression vector is constructed, and genetic transformation is performed by infecting cucumber cotyledons with Agrobacterium tumefaciens. CsPPC3 The gene was overexpressed in cucumber fruits, and positive buds were screened to obtain stably inherited transgenic plants; CsPPC3 Transgenic cucumber plants with overexpressed genes showed reduced CO2 release from respiration, enhanced CO2 refixation capacity, and increased single fruit weight. At the same time, the content of malic acid, soluble sugar, and starch increased, while the content of amino acids decreased, indicating that more carbon sources flowed to the carbon cycle in carbon and nitrogen metabolism. CsPPC3 The method for constructing gene-knockout transgenic plants is as follows: A CRISPR-Cas9 gene-editing vector is constructed, and genetic transformation is performed using Agrobacterium-mediated transformation of cucumber cotyledons via gene-editing technology to inhibit gene knockout. CsPPC3 Gene expression in cucumber fruits was investigated, and positive buds were screened to obtain stably inherited transgenic plants; CsPPC3 Gene knockout transgenic cucumber plants release more CO2 through respiration, have a smaller single fruit weight, and exhibit reduced levels of malic acid, soluble sugars, and amino acids, while increasing starch content. This reduces the plant's ability to re-fix CO2 and decreases carbon sources, resulting in a reduction in the utilization of carbon sources for carbon and nitrogen metabolism.