Application of LcIMT gene in tomato
By introducing the LcIMT gene into tomatoes, the synthesis of ceramide and ceramide is promoted, and the problem of insufficient ceramide content in tomatoes is solved, and the drought resistance and photosynthesis of tomatoes is improved, although the fruit size and growth rate have been slowed down.
Patent Information
- Application Number
- CN202410092031.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-01-23
- Publication Date
- 2025-08-22
- Estimated Expiration
- 2044-01-23
AI Technical Summary
In the prior art, the functional development and research of the LcIMT gene in other plants have not been reported, resulting in insufficient content of ceramide alcohol in tomatoes, affecting its drought resistance and other properties.
The LcIMT gene was extracted from lychees and transferred into tomatoes. The overexpression vector was constructed through PCR amplification, homologous recombinase cleavage and ligation. The LcIMT gene was introduced into tomatoes using Agrobacterium competent transformation technology to promote the synthesis of cervical alcohol and syrupolol and enhance the osmotic regulation ability of tomatoes.
The content of the tomato without mortal alcohol is increased, the tomato's drought resistance is optimized, and other properties such as drought resistance and photosynthesis are optimized, although fruit size and growth rate have been slowed down.
Smart Images

Figure CN118703539B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of biotechnology and genetic breeding, and in particular to the application of the LcIMT gene in tomatoes. Background Art
[0002] Litchi (Litchi chinensis Sonn.) is an evergreen tree in the Sapindaceae family and the genus Litchi. It is rich in quebrachitol (2-O-methy L-chiro-inositol), which is systemically distributed throughout the plant's tissues and organs. Quebrachiol concentrations are highest in leaves, seeds, and pericarp, reaching as high as 10 mg·g⁻¹ (FW) in leaves and seeds. The lowest concentration is found in the flesh, at only 1.6±0.14 mg·g⁻¹ (FW).
[0003] Quebrachiol is the primary photosynthetic product of litchi and a crucial component in maintaining the osmotic potential of litchi leaves. Six inositol methyl ethers have been discovered in plants: quebrachitol, L-bornesitol, D-bornesitol, sequoyitol, D-pinitol, and D-ononitol. In plants containing these methyl inositol ethers, they act as important osmotic regulators, playing a crucial role in osmotic stress. For example, when soybeans are exposed to drought stress, D-pinitol levels increase significantly, reaching concentrations even higher than those of proline. D-pinitol is also found in large quantities in the halophyte plant, Mesophyllum glaucum. Its ability to grow in saline soils may be related to its accumulation of D-pinitol. Similarly, when studying the changes in inositol substances in the salt-tolerant rice Porteresia coarctata under high salt stress, it was found that the content of myo-inositol decreased significantly under high salt stress, while the content of D-pinitol increased significantly. These evidences indicate that D-pinitol can participate in plant osmotic regulation. Soapberry alcohol and quebracho alcohol can also participate in plant osmotic regulation. Using 13CO2 to feed rubber trees and detecting the dynamic changes of quebracho alcohol, it was found that quebracho alcohol plays an important role in the osmotic balance of latex. Wu Zichen (2019) studied the relationship between the content of quebracho alcohol and sucrose and the water content in the leaves of different varieties of litchi and found that the content of quebracho alcohol and sucrose was significantly correlated with the water content of the leaves, indicating that quebracho alcohol and sucrose are involved in the regulation of the osmotic potential of litchi leaves.
[0004] Currently, quebracholi alcohol has only been detected in 57 plant species from 15 families. The content of quebracholi alcohol in different plants varies greatly. Litchi and longan leaves contain a large amount of quebracholi alcohol, with the content in lychee leaves reaching up to 10 mg·g-1 (FW). The content in the leaves of Banksia grandis in the Proteaceae family is relatively low, containing only about 0.1 mg·g-1 (FW).
[0005] The IMT (inositol methyltransferase) gene is a member of a family of genes involved in the synthesis of inositol methyl ethers. In litchi, inositol methyltransferase uses SAM (S-adenosylmethionine) as a methyl donor to synthesize soapnut alcohol. This alcohol is then converted to quebracho alcohol through the action of two other isomerases. While the LcIMT gene in litchi has been identified, the function of soapnut alcohol in other plants remains largely unexplored. Summary of the Invention
[0006] The purpose of the present invention is to avoid the shortcomings of the prior art and provide an application of the LcIMT gene in tomatoes. The application of the LcIMT gene in tomatoes can effectively increase the content of sapindyl alcohol in tomatoes and improve the performance of tomatoes.
[0007] The present invention provides the following technical solutions:
[0008] Provided is the use of the LcIMT gene in tomatoes. The tomatoes contain the LcIMT gene encoding sapindus alcohol protein, and the nucleotide sequence of the LcIMT gene is shown in SEQ ID NO.1.
[0009] In some embodiments, the LcIMT gene is derived from litchi.
[0010] Provided is the use of the LcIMT gene in improving the drought resistance of tomatoes. The nucleotide sequence of the LcIMT gene is shown in SEQ ID NO.1.
[0011] A method for applying the LcIMT gene in tomatoes is provided, comprising the following steps:
[0012] S1. The LcIMT gene was amplified from the cDNA of Feizixiao litchi leaves using the following primers to obtain a PCR product. The primer sequences are as follows:
[0013] Upstream primer: 5′-gccatggctgatatcggatccATGGGATCGGTAGAAGAAGAGAGG-3′;
[0014] Downstream primer: 5′-ggtggtgctcgagtgcggccgcTCACTGTGGATAGGCCTCAATAACG-3′;
[0015] The PCR products were purified by gel recovery;
[0016] S2. Double-digest the pSK277 overexpression vector with EcoRⅠ and XhoⅠ to obtain the homologous recombinase enzyme pair digested vector;
[0017] S3. The digested vector and purified PCR product were ligated using homologous recombinase and then transformed into DH5α competent E. coli and plated for incubation. A single clone was selected for sequencing. The correctly sequenced vector was transferred into GV3101 competent Agrobacterium and plated for incubation. A single clone was selected and the clone with a band in the bacterial solution PCR was retained for future use to obtain the LcIMT gene.
[0018] S4. Transfer the LcIMT gene to tomatoes to obtain LcIMT gene-transfected tomatoes.
[0019] Beneficial effects of the application of the LcIMT gene of the present invention in tomatoes:
[0020] The present invention introduces the LcIMT gene into tomatoes. The IMT (inositol methyltransferase) gene is a type of gene that synthesizes inositol methyl ethers. The inositol methyltransferase produced by the LcIMT gene can synthesize soapberry alcohol using SAM (S-adenosylmethionine) as a methyl donor. Sapindiol is then converted into quebracho alcohol by the action of an isomerase, promoting the regulation of osmotic potential in tomato leaves. Furthermore, increasing soapberry alcohol content in tomatoes can improve drought resistance and other properties, further optimizing tomato performance. BRIEF DESCRIPTION OF THE DRAWINGS
[0021] Figure 1 It is a comparison of drought resistance among T2-1, T2-2 and WT.
[0022] Figure 2 This is a map showing that LcIMT-transgenic tomatoes also contain D-irinotecan.
[0023] Figure 3 This is a comparison of the glucose, fructose, galactose, borneol, inositol, and sucrose content of LcIMT-transgenic tomatoes and wild-type tomatoes.
[0024] Figure 4 This is a comparison between the fruits of transgenic tomatoes with the LcIMT gene and those of wild-type tomatoes.
[0025] Figure 5 This is a graph comparing the growth rates of transgenic LcIMT gene tomato fruits and wild-type tomato fruits. DETAILED DESCRIPTION
[0026] The preferred embodiments of the present invention will be described in more detail below with reference to the accompanying drawings. Although preferred embodiments of the present invention are shown in the accompanying drawings, it should be understood that the present invention can be implemented in various forms and should not be limited by the embodiments described herein. Rather, these embodiments are provided to make the present invention more thorough and complete and to fully convey the scope of the present invention to those skilled in the art.
[0027] Example
[0028] To demonstrate the successful transfer of the LcIMT gene into tomatoes and the effects of the LcIMT gene on tomatoes, the following specific implementation steps were performed:
[0029] Step 1:
[0030] By the following primer sequences:
[0031] Upstream primer: 5′-gccatggctgatatcggatccATGGGATCGGTAGAAGAAGAGAGG-3′;
[0032] Downstream primer: 5′-ggtggtgctcgagtgcggccgcTCACTGTGGATAGGCCTCAATAACG-3′;
[0033] The LcIMT gene was amplified from cDNA of Feizixiao litchi leaves and the product was purified by gel recovery.
[0034] The nucleotide sequence of the LcIMT gene is shown in SEQ ID NO.1:
[0035] ATGGGATCGGTAGAAGAAGAGAGGGCTGCCTTGCTGAGAGGCCAAGCTGAAGTAT
[0036] GGGAT
[0037] CTCATGTTTGCTTTTGCAGACTCTTTGGCTCTAAAGGCAGCAGTTGAGCTTCGGGTA
[0038] CCA
[0039] GATATTGTACACTCCCACGGTGGCCCAATCACTTTGACCCAATTGGCCTCAAAAATT
[0040] GAT
[0041] GCAACTAGTCTAGACATCTCGTACCTTGCCCGGGTCATAAGGTTGTTGGTCCGAAA
[0042] ARGUMENT
[0043] GTTTTCACGGCAGATTATCCATCAAGCGGGGGAGAGCCTCAGTACGGGGCAACCGA
[0044] CGTA
[0045] TCAAAATGGCTACTACAAGATGCGGACCTAACACTTGCTCCAATGCTACTAATGGAA
[0046] AAT
[0047] GATCCCGTGCAATCGGACCCGTGGCATTACATCGGCAACTGTGTCAAAGAAGGTGG
[0048] TGTT
[0049] CCATTCGAAAAGGTTCATGGGGAGGACTCTGGTACTTGATACCCAAAAAGCCAAA
[0050] ATTT
[0051] GAGAAGCTGTTCTATGCTGCCATGGCGTGTACCAGCAAGGTAGTGATGAGGGCAGT
[0052] GGTA
[0053] TCTGAGTGTAAAGATGTGTTTGCAAACATTGGATCACTGGTCGATGTTGCCGGTGG
[0054] GATC
[0055] GGTGGAGCCATCTCTGAGGTTGTCAAAGCCTATCCTCATATCAAGGGTATAAACTTT
[0056] GAT
[0057] CAGCCACATGTCGTCGCCACTGCCCCTGCCTATAATGGCGTGTCTCATGTTGGTGGT
[0058] AAC
[0059] ATGTTTGACACCATTCCGAAAGCTGATGCAGTCATGATGAAGTGGATTCTACATGAT
[0060] TGG
[0061] ACTGAAGAAGATGGTATAAAGATATTGAAAAATTGTCGTAAAGCAATACCAGAGAA
[0062] AAAC
[0063] GGAAAGGTGATACTAATTGATTTCGTTGTAAAAGAAGATGGTAACAAGAAGTATGG
[0064] GGAC
[0065] ATAGATGTGCGCTTCGATCTAGTCATGCTTGCGCACAACAAAGGTGGACGGGAAAG
[0066] GACA
[0067] GAAGAAGAATGGAAGAAATTATTAGGGGCAGGAGGGTTCCCTCGCTACAGGATCAT
[0068] CAAA
[0069] GTCCCATCTGTACTACACGTTATTGAGGCCTATCCACAGTGA
[0070] Step 2: Use EcoRⅠ and XhoⅠ to double-digest the pSK277 overexpression vector.
[0071] Step 3: Use homologous recombinase to connect the enzyme-cut vector and purified PCR product, then transfer them into DH5α Escherichia coli competent cells and incubate them on plates. Pick out single clones for sequencing. Transfer the correctly sequenced vector into GV3101 Agrobacterium competent cells and incubate them on plates. Pick out single clones and retain the clones with bands in the bacterial liquid PCR for later use.
[0072] Step 4: Conduct genetic transformation experiments of LcIMT to tomato, specifically:
[0073] Prepare culture medium
[0074] Suspension: Sterile water and 100 μM As
[0075] Co-culture medium: 4.4 g / L MS, 20 g / L glucose, 1 mM MES, 7 g / L agar, 0.375 mg / L trans-zeatin, 0.5 mg / L IAA, 100 μM As, pH 5.7, sterilized at high temperature and high pressure before aliquoting
[0076] First screening medium: 4.4 g / L MS, 20 g / L glucose, 1 mM MES, 7 g / L agar, 0.75 mg / L trans-zeatin, 1 mg / L IAA, 100 mg / L Kan, 300 mg / L Cef, pH 5.7, sterilized at high temperature and high pressure, and then divided for use
[0077] Elongation medium: 4.4 g / L MS, 20 g / L glucose, 1 mM MES, 7 g / L agar, 0.2 mg / L trans-zeatin, 0.05 mg / L IAA, 100 mg / L Kan, 300 mg / L Cef, pH 5.7, sterilized at high temperature and high pressure and then aliquoted for use
[0078] Rooting medium: 4.4 g / L MS, 30 g / L sucrose, 8 g / L agar, 100 mg / L Kan, 300 mg / L Cef, pH 5.7, sterilize at high temperature and high pressure before use.
[0079] Genetic transformation experimental steps
[0080] Tomato seed sterilization and explant preparation
[0081] Sow tomato seeds in a clean bench after sterile operation (soak the seeds in 75% alcohol for 1 minute, 10% sodium hypochlorite for 10 minutes, and rinse with sterile water 4-5 times. Sow about 10 seeds in one tissue culture bottle and place them in the tissue culture bottle for germination and growth);
[0082] Remove the sterile seedlings from the tissue culture flask, pour a small amount of sterile water into a culture dish, and use a razor blade or scissors to cut the leaves into explants approximately 0.25cm x 0.25cm in size. Trim off the edges and middle veins of the leaves, and set aside. (Note: Be careful not to damage the explants when cutting).
[0083] Cultivation of Agrobacterium containing target gene plasmid and preparation of infection solution
[0084] Transformation: 1 μL of the plasmid identified as correct by sequencing was added to 33 μL of Agrobacterium GV3101 competent cells.
[0085] Invert the plate and culture on the plate containing the corresponding resistance for 2-3 days in the dark. Pick the bacteria after colonies grow.
[0086] Picking and shaking: In a clean bench, dispense 1 mL of YEP liquid medium containing the desired antibiotic into 2 mL centrifuge tubes. Use a sterile bamboo stick or pipette to pick a single colony. Incubate at 28°C, 220 rpm, overnight. (Bacterial testing: After 6 hours of incubation or overnight, PCR analysis can be performed on the culture medium.)
[0087] In a clean bench, take 100 μL of correctly detected Agrobacterium, add 5 mL of YEP liquid culture medium containing the corresponding antibiotic, divide into 50 mL centrifuge tubes, and incubate at 28°C, 220 rpm, overnight.
[0088] Centrifuge at 6000 rpm at room temperature for 5 minutes, discard the supernatant, and resuspend the bacteria in about 50 mL of sterile water and 100 μM As for later use.
[0089] Dipping, co-cultivation, screening, elongation and rooting cultures
[0090] The cut explants were placed in the above-mentioned suspended Agrobacterium solution and infected for 10 minutes.
[0091] Co-cultivation: Place the explants after immersion with the front side facing up (upper surface facing up) on the co-cultivation medium, label and record them, wrap the co-cultivation medium with a black plastic bag, and culture it in the dark in the culture room for 2 days.
[0092] First screening culture: After 2 days of co-culture, the explants were transferred to the screening culture medium (10-12 pieces per plate) on a clean bench.
[0093] Second screening culture: After 2 weeks, transfer the explants to the screening culture medium for continued culture, and subculture every two weeks thereafter. If the leaves of the explants are found to be tilted upward during the culture process, they need to be re-placed, and the incision should be in contact with the surface of the culture medium as much as possible.
[0094] Elongation culture: Once shoots begin to form, they should be transferred to elongation medium.
[0095] Rooting Culture: After approximately four weeks, resistant buds are induced to form on the screening medium. When they reach approximately 1-2 cm in diameter, they are excised and transferred to the rooting medium for rooting induction. ⑥ Seedling Training and Transplanting: Once the plants have established roots and grown to a certain size, they are removed from the rooting medium, cleaned of the rooting medium, and transplanted into pots. These plants are then placed in a plant culture room to produce transgenic tomatoes with the LcIMT gene.
[0096] The above experiment was repeated three times, and after repeated subculture, T1-1 LcIMT gene-transgenic tomatoes, T1-2 LcIMT gene-transgenic tomatoes, and T1-3 LcIMT gene-transgenic tomatoes were obtained; in addition, wild-type tomatoes were used as WT as a control experiment.
[0097] Result analysis:
[0098] Analysis on drought resistance:
[0099] After subculturing T1-1 LcIMT-transgenic tomatoes and T1-2 LcIMT-transgenic tomatoes, T2-1 LcIMT-transgenic tomatoes and T2-2 LcIMT-transgenic tomatoes were obtained. The drought resistance of T2-1, T2-2 and WT was compared. Figure 1 It can be seen that on the fifth day after watering was stopped, the overall plant expansion of WT was worse than that of T2-1 and T2-2; on the tenth day after watering was stopped, the overall plant expansion of WT was even worse than that of T2-1 and T2-2. It can be seen that the transgenic tomatoes with the LcIMT gene obtained in this example have specific drought resistance.
[0100] GC-MS analysis of transgenic and wild-type tomatoes:
[0101] Depend on Figure 2 As can be seen, compared with wild-type tomatoes, the LcIMT-transgenic tomatoes also contain D-foraminodiol. This indicates that this example not only successfully produces LcIMT-transgenic tomatoes, but also increases the amount of inositol methyl ethers in the tomatoes, promoting the synthesis of soapnut alcohol, which in turn facilitates the synthesis of quebracholi alcohol, thereby improving tomato photosynthesis.
[0102] Analysis of pulp taste and hormone secretion:
[0103] Depend on Figure 3 As shown in (a) to (c), the glucose, fructose, and galactose contents of the LcIMT-transgenic tomatoes obtained in this example are not significantly different from those of the wild-type tomatoes. This indicates that the LcIMT-transgenic tomatoes can maintain a tomato-like taste.
[0104] In addition, by Figure 3 T1-2 in (d) contains tomatoes with a high content of sapindyl alcohol, with the content in the leaves reaching 9 mg / g, corresponding to Figure 3 The inositol content of T1-2 in (e) was reduced by 12 times compared with that of the wild type. This indicates that most of the inositol in the LcIMT-transgenic tomatoes produced in this example was converted to sapindiol. This also indicates that the LcIMT-transgenic tomatoes in this example can produce a high content of sapindiol.
[0105] Analysis of fruit size:
[0106] Depend on Figure 4 It can be seen that the fruit size of the LcIMT gene-transgenic tomato is smaller than that of the wild type. It can be seen that the LcIMT gene-transgenic tomato was successfully obtained in this example.
[0107] Analysis of growth rate:
[0108] Depend on Figure 5 It can be seen that the growth rate and fruit ripening rate of the LcIMT gene transgenic tomatoes are slower than those of the wild type. It can be seen that the LcIMT gene transgenic tomatoes were successfully obtained in this example.
[0109] The foregoing description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Those skilled in the art will readily appreciate that various modifications and variations of the present invention are possible. Any modifications, equivalent substitutions, or improvements made within the spirit and principles of the present invention are intended to be within the scope of protection of the present invention.
Claims
1. LqCy The application of the gene in tomatoes is characterized by: The tomato contains a protein encoding sapindyl alcohol LqCy gene, the LqCy The nucleotide sequence of the gene is shown in SEQ ID NO.
1. LqCy The genes are derived from lychee; The applications include improving drought resistance of tomatoes, improving photosynthesis of tomatoes, and regulating the shrinkage of tomato fruits.
2. Claim 1 LqCy The gene is used in tomatoes, characterized in that The following steps are involved: S1, amplified from Feizixiao litchi leaf cDNA using the following primers LqCy Gene, PCR products were obtained, and the primer sequences were as follows: Upstream primer: 5′-gccatggctgatatcggatccATGGGATCGGTAGAAGAAGAGAGG-3′; Downstream primer: 5′-ggtggtgctcgagtgcggccgcTCACTGTGGATAGGCCTCAATAACG-3′; The PCR products were purified by gel recovery; S2. Double-digest the pSK277 overexpression vector with EcoRⅠ and XhoⅠ to obtain the homologous recombinase enzyme pair digested vector; S3, using homologous recombination enzyme to connect the enzyme-cut vector and purified PCR product, and then transfer them into DH5α Escherichia coli competent cells and incubate them on plates. Pick out single clones for sequencing, transfer the correctly sequenced vector into GV3101 Agrobacterium competent cells and incubate them on plates. Pick out single clones and retain the clones with bands in the bacterial solution PCR for standby use. LqCy Gene; S4. LqCy Genes were transferred to tomatoes to produce transgenic LqCy Genetically modified tomatoes.