Diagnostic markers for pulmonary hypertension

Abstract

The present invention discloses a diagnostic marker for pulmonary hypertension. The present invention adopts AP003110.1 and / or AL133476.1 for the diagnosis of pulmonary hypertension for the first time, and it is verified that it has high diagnostic efficacy, high sensitivity and specificity, is helpful for early screening of pulmonary hypertension, helps patients to receive early treatment, reduces pain and stress, and has broad application prospects in clinical practice.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine, and in particular relates to a diagnostic marker for pulmonary hypertension. Background Art

[0002] Pulmonary hypertension (PH) is a clinical syndrome caused by different etiologies and pathogenesis, characterized by a persistent increase in pulmonary vascular resistance. The pathological characteristics of PH are pulmonary vasoconstriction, pulmonary vascular wall remodeling, and in situ thrombosis, which lead to increased right heart load or dysfunction and reduced pulmonary blood flow, seriously affecting the quality of life and prognosis of patients.

[0003] The most common initial symptoms of PH are exertional dyspnea, fatigue, chest pain and even syncope. As the disease progresses, symptoms of right heart failure such as dyspnea, abdominal distension, and lower limb edema may also occur at rest. The occurrence of syncope or dizziness indicates that the cardiac output has dropped significantly. Rare symptoms include cough, hemoptysis, and occasional hoarseness. Physical examination can reveal signs of right heart hypertrophy, right heart failure and PH-related diseases, such as clubbing, fever, hard skin, sclerosis of the fingertips, mucosal ulcers, skin erythema, rash, Raynaud's phenomenon, dry mouth and eyes, asymmetric swelling of the lower limbs, paroxysmal dyspnea at night, spider angiomas, liver palms, thyroid enlargement, and skin capillary dilation.

[0004] Screening of markers that can diagnose PH is of great significance for the timely diagnosis and effective treatment of PH patients. Summary of the invention

[0005] To make up for the deficiencies of the prior art, the present invention provides a diagnostic marker for pulmonary hypertension.

[0006] To achieve the above object, the present invention adopts the following technical solutions:

[0007] A first aspect of the present invention provides a product for diagnosing PH, comprising a reagent for detecting the expression level of AP003110.1 and / or AL133476.1.

[0008] Furthermore, the PH is selected from pulmonary hypertension caused by pulmonary artery obstruction.

[0009] Furthermore, the pulmonary hypertension caused by pulmonary artery obstruction is selected from CTEPH.

[0010] Further, the reagent is selected from the following group:

[0011] (1) Primers that specifically amplify AP003110.1 and / or AL133476.1;

[0012] (2) Probes that specifically recognize AP003110.1 and / or AL133476.1.

[0013] Furthermore, the sequences of the primers for specific amplification of AP003110.1 are shown in SEQ ID NO: 1-2.

[0014] Furthermore, the sequences of the primers for specifically amplifying AL133476.1 are shown in SEQ ID NO: 3-4.

[0015] Furthermore, the product includes a chip, a kit or a nucleic acid membrane strip.

[0016] Furthermore, the kit also includes a container.

[0017] Furthermore, the kit also includes instructions.

[0018] Furthermore, the kit further comprises a buffer.

[0019] Furthermore, the kit also includes packaging materials.

[0020] A second aspect of the present invention provides use of a reagent for detecting the expression level of AP003110.1 and / or AL133476.1 in a sample in the preparation of a product for diagnosing PH.

[0021] Furthermore, the sample is selected from blood.

[0022] Furthermore, the PH is selected from pulmonary hypertension caused by pulmonary artery obstruction.

[0023] Furthermore, the pulmonary hypertension caused by pulmonary artery obstruction is selected from CTEPH.

[0024] Furthermore, the reagents also include reagents required for detecting the expression level of AP003110.1 and / or AL133476.1 by RT-PCR method or qRT-PCR method.

[0025] Furthermore, the reagent also includes a detectable marker.

[0026] Further, the detectable markers include UV-Vis labels, near-infrared labels, fluorescent groups, phosphorescent groups, magnetic spin resonance labels, photosensitizers, photocleavable moieties, chelating centers, heavy atoms, radioisotopes, isotope detectable spin resonance labels, paramagnetic moieties, chromophores, and luminophores.

[0027] The third aspect of the present invention provides the use of AP003110.1 and / or AL133476.1 as a target in screening candidate drugs for treating PH.

[0028] Further, the method for screening candidate drugs for treating PH includes: testing the effect of the candidate drug on the level of AP003110.1 and / or AL133476.1 in a sample, wherein, after using the candidate drug, the level of AP003110.1 decreases and / or the level of AL133476.1 increases, indicating that the candidate drug has an effect of treating PH.

[0029] Furthermore, the PH is selected from pulmonary hypertension caused by pulmonary artery obstruction.

[0030] Furthermore, the pulmonary hypertension caused by pulmonary artery obstruction is selected from CTEPH.

[0031] A fourth aspect of the present invention provides a system / device for diagnosing PH, the system / device comprising:

[0032] (1) Data acquisition module: used to obtain the expression level of AP003110.1 and / or AL133476.1 in the subject sample;

[0033] (2) a diagnostic prediction module: used to input the expression levels of AP003110.1 and / or AL133476.1 obtained by the data acquisition module as input data into a diagnostic prediction model, wherein the diagnostic prediction model makes a prediction for the subject based on the expression levels of AP003110.1 and / or AL133476.1;

[0034] (3) Prediction result acquisition module: used to obtain the output result of the diagnosis prediction module and obtain the prediction result of the subject.

[0035] Furthermore, the PH is selected from pulmonary hypertension caused by pulmonary artery obstruction.

[0036] Furthermore, the pulmonary hypertension caused by pulmonary artery obstruction is selected from CTEPH.

[0037] The fifth aspect of the present invention provides the use of AP003110.1 and / or AL133476.1 in constructing a system / device for diagnosing PH.

[0038] Furthermore, the PH is selected from pulmonary hypertension caused by pulmonary artery obstruction.

[0039] Furthermore, the pulmonary hypertension caused by pulmonary artery obstruction is selected from CTEPH.

[0040] The sixth aspect of the present invention provides the use of AP003110.1 and / or AL133476.1 in constructing a computer-readable storage medium for diagnosing PH.

[0041] Furthermore, the PH is selected from pulmonary hypertension caused by pulmonary artery obstruction.

[0042] Furthermore, the pulmonary hypertension caused by pulmonary artery obstruction is selected from CTEPH.

[0043] Advantages and beneficial effects of the present invention:

[0044] The present invention adopts AP003110.1 and / or AL133476.1 for the diagnosis of pulmonary hypertension for the first time, and it has been verified that it has high diagnostic efficacy, high sensitivity and specificity, is helpful for the early screening of pulmonary hypertension, helps patients to receive early treatment, reduces the pain and stress of the disease, and has broad application prospects in clinical practice. BRIEF DESCRIPTION OF THE DRAWINGS

[0045] Figure 1 is the expression level graph of AP003110.1 in the test set;

[0046] Figure 2 is the expression level graph of AL133476.1 in the test set;

[0047] Figure 3 This is the ROC curve of AP003110.1 in the test set;

[0048] Figure 4 This is the ROC curve of AL133476.1 in the test set;

[0049] Figure 5 This is the ROC curve of AP003110.1 and AL133476.1 in the test set;

[0050] Figure 6 This is the expression level graph of AP003110.1 in the validation set;

[0051] Figure 7 is the expression level graph of AL133476.1 in the validation set;

[0052] Figure 8 This is the ROC curve of AP003110.1 in the validation set;

[0053] Fig. 9 This is the ROC curve of AL133476.1 in the validation set;

[0054] Fig.10 This is the ROC curve of the combination of AP003110.1 and AL133476.1 in the validation set. DETAILED DESCRIPTION

[0055] The definitions of some terms used in this specification are provided below. Unless otherwise defined, all technical and scientific terms used herein generally have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

[0056] The present invention provides a product for diagnosing PH, which comprises a reagent for detecting the expression level of AP003110.1 and / or AL133476.1.

[0057] The reagent is selected from the following group:

[0058] (1) Primers that specifically amplify AP003110.1 and / or AL133476.1;

[0059] (2) Probes that specifically recognize AP003110.1 and / or AL133476.1.

[0060] In one embodiment, a primer refers to a short nucleic acid molecule, such as a DNA oligonucleotide, such as a sequence of at least 15 nucleotides, which can anneal to a complementary target nucleic acid molecule by nucleic acid hybridization to form a hybrid between the primer and the target nucleic acid strand. The primer can be extended along the target nucleic acid molecule by a polymerase. Therefore, a primer can be used to amplify a target nucleic acid molecule, wherein the sequence of the primer is specific for the target nucleic acid molecule, and the primer hybridizes to the target nucleic acid molecule under very high stringency hybridization conditions.

[0061] Can be by PCR, real-time PCR or other nucleic acid amplification methods known in the art, use primer pair to amplify nucleic acid sequence.Upstream or forward primer is the primer in the 5' direction relative to the reference point on the nucleic acid sequence.Downstream or reverse primer is the primer in the 3' direction relative to the reference point on the nucleic acid sequence.In general, comprise at least one forward and one reverse primer in the amplification reaction.

[0062] In one embodiment, a probe refers to a molecule that can bind to a specific sequence or subsequence or other portion of another molecule. Unless otherwise indicated, a probe generally refers to a polynucleotide probe that can bind to another polynucleotide (often referred to as a target polynucleotide) through complementary base pairing. Depending on the stringency of the hybridization conditions, the probe can bind to a target polynucleotide that lacks complete sequence complementarity with the probe. The probe can be labeled directly or indirectly. Hybridization methods include, but are not limited to, solution phase, solid phase, mixed phase, or in situ hybridization assays.

[0063] The product includes a chip, a test kit or a nucleic acid membrane strip.

[0064] In one embodiment, the kit further comprises one or more substances selected from the group consisting of: a container, instructions for use, a positive control substance, a negative control substance, a buffer, an auxiliary agent or a solvent.

[0065] The kit may also include common reagents required for the corresponding PCR technology, such as dNTPs, MgCl2, double distilled water, fluorescent probes, etc. These common reagents are well known to those skilled in the art.

[0066] In some embodiments, the kit further comprises packaging material. Packaging material may refer to a physical structure that holds the components of the kit. The packaging material may maintain the sterility of the kit components and may be made of materials commonly used for such purposes (e.g., paper, corrugated fiber, glass, plastic, foil, ampoules, etc.).

[0067] In one embodiment, pulmonary hypertension includes idiopathic pulmonary arterial hypertension (PAH), pulmonary arterial hypertension caused by left heart disease, pulmonary arterial hypertension caused by lung disease / hypoxia, pulmonary arterial hypertension caused by pulmonary artery obstruction, and pulmonary arterial hypertension caused by unknown or multiple factors.

[0068] Among them, idiopathic pulmonary hypertension includes heritable PH, PH caused by drugs and toxins, primary PH related to other diseases (connective tissue disease, HIV infection, portal hypertension, congenital heart disease, schistosomiasis, etc.), primary pulmonary hypertension with obvious venous / capillary involvement, and persistent pulmonary hypertension of the newborn.

[0069] Pulmonary hypertension caused by left heart disease includes PH caused by heart failure with preserved ejection fraction, PH caused by heart failure with reduced ejection fraction, post-capillary PH caused by congenital / acquired cardiovascular disease, and PH related to valvular heart disease.

[0070] Pulmonary hypertension caused by lung disease / hypoxia, such as chronic obstructive pulmonary disease, idiopathic pulmonary fibrosis and mixed lung disease. In addition, pulmonary hypoxia without lung disease can also cause PH.

[0071] Pulmonary hypertension caused by pulmonary artery obstruction, such as chronic thromboembolic pulmonary hypertension (CTEPH).

[0072] PH of unknown cause or multifactorial cause, such as blood system diseases, systemic and metabolic diseases, and other systemic diseases.

[0073] In a preferred embodiment, the pulmonary hypertension is selected from pulmonary hypertension caused by pulmonary artery obstruction.

[0074] In a specific embodiment, the pulmonary hypertension caused by pulmonary artery obstruction is chronic thromboembolic pulmonary hypertension (CTEPH).

[0075] The present invention provides use of a reagent for detecting the expression level of AP003110.1 and / or AL133476.1 in a sample in the preparation of a product for diagnosing PH.

[0076] In one embodiment, the sample includes but is not limited to blood, tissue, urine, saliva, etc.

[0077] In a specific embodiment, said sample is selected from blood.

[0078] The reagent also includes a detectable label.

[0079] In one embodiment, a detectable label refers to any composition detectable by fluorescent, spectroscopic, photochemical, biochemical, immunological, electrical, optical or chemical means, including but not limited to UV-Vis labels, near infrared labels, fluorescent groups, phosphorescent groups, magnetic spin resonance labels, photosensitizers, photocleavable moieties, chelating centers, heavy atoms, radioisotopes, isotope detectable spin resonance labels, paramagnetic moieties, chromophores, luminophores.

[0080] In one embodiment, the fluorescent group includes but is not limited to FAM (Carboxyfluorescein, green fluorescence), FITC (fluorescein isothiocyanate), TET (tetrachloro-6-carboxyfluorescein), HEX (hexachloro-6-methylfluorescein), JOE (2,7-dimethyl-4,5-dichloro-6-carboxyfluorescein), rhodamine (Rhodamine dyes such as R110, TAMRA, Texas Red, etc.), ROX, AlexaFluor dyes (such as Alexa 350, Alexa 405, Alexa 430, Alexa 488, Alexa 500, Alexa 514, Alexa 532, Alexa 546, Alexa 555, Alexa 568, Alexa594, Alexa 610, Alexa 633, Alexa 635, Alexa 647, Alexa 660, Alexa 680, Alexa 700, Alexa 750, Alexa 790), ATTO dyes (such as ATTO 390, ATTO 425, ATTO 465, ATTO 488, ATTO 495, ATTO 514, ATTO 520, ATTO 532, ATTO Rho6G, ATTO 542, ATTO 550, ATTO 565, ATTO Rho3B, ATTO Rho11, ATTO Rho12, ATTO Thio12, ATTO Rho101, ATTO 590, ATTO 594, ATTO Rho13, ATTO 610, ATTO 620, ATTO Rho14, ATTO 633, ATTO 647, ATTO 647N, ATTO 655, ATTO Oxa12, ATTO 665, ATTO 680, ATTO 700, ATTO 725, ATTO 740), DyLight dyes, cyanine dyes (such as Cy2, Cy3, Cy3.5, Cy3b, Cy5, Cy5.5, Cy7, Cy7.5), FluoProbes dyes, SulfoCy dyes, Seta dyes, IRIS dyes, SeTau dyes, SRfluor dyes, Square dyes.

[0081] The present invention provides a system / device for diagnosing PH, the system / device comprising:

[0082] (1) Data acquisition module: used to obtain the expression level of AP003110.1 and / or AL133476.1 in the subject sample;

[0083] (2) a diagnostic prediction module: used to input the expression levels of AP003110.1 and / or AL133476.1 obtained by the data acquisition module as input data into a diagnostic prediction model, wherein the diagnostic prediction model makes a prediction for the subject based on the expression levels of AP003110.1 and / or AL133476.1;

[0084] (3) Prediction result acquisition module: used to obtain the output result of the diagnosis prediction module and obtain the prediction result of the subject.

[0085] In one embodiment, the diagnosis prediction module includes a computing device, and the computing device includes a memory and a processor. The memory stores a computer program, and the processor is configured to execute the computer program stored in the memory.

[0086] The present invention provides the use of AP003110.1 and / or AL133476.1 in constructing a computer-readable storage medium for diagnosing PH.

[0087] In one embodiment, computer-readable storage media, such as computer executable code, can take a variety of forms, including but not limited to tangible storage media, carrier media, or physical transmission media. Non-volatile storage media include, for example, optical or magnetic disks, such as any storage device in any computer, and volatile storage media include dynamic memory, such as the main memory of such a computer platform. Tangible transmission media include coaxial cables; copper wires and optical fibers, including wires that constitute buses within a computer system. Carrier transmission media can take the form of electrical or electromagnetic signals or sound or light waves, such as those generated during radio frequency and infrared data communications. Therefore, common forms of computer-readable media include, for example: floppy disks, floppy disks, hard disks, magnetic tapes, any other magnetic media, CD-ROMs, DVDs or DVD-ROMs, any other optical media, punched card paper tapes, any other physical storage media with hole patterns, RAMs, ROMs, PROMs and EPROMs, FLASH-EPROMs, any other memory chips or boxes, carriers that transmit data or instructions, cables or links that transmit such carriers, or any other media from which a computer can read programming code and / or data. Many of these forms of computer readable media may be involved in carrying one or more sequences of one or more instructions to a processor for execution.

[0088] The invention will be further described below in conjunction with specific examples. It should be understood that the specific embodiments described herein are presented by way of example and are not intended to limit the invention. The main features of the invention may be used in a variety of embodiments without departing from the scope of the invention.

[0089] Example

[0090] 1. Experimental Materials

[0091] Test set: sequencing data of 7 CTEPH patients and 5 healthy volunteers.

[0092] Validation set: 28 CTEPH patients and 30 healthy samples.

[0093] Inclusion criteria:

[0094] CTEPH was diagnosed by right heart catheterization (RHC) combined with lung ventilation and perfusion scanning and computed tomographic pulmonary angiography (CTPA).

[0095] All healthy volunteers were from the Health Examination Center of the China-Japan Friendship Hospital, with normal lung and liver functions, routine blood and urine tests, thyroid hormone levels, and electrocardiograms.

[0096] Exclusion criteria:

[0097] 1) Patients who underwent balloon pulmonary angioplasty (BPA).

[0098] 2) Patients without complete RHC data or who received PEA before blood sample collection.

[0099] 3) Participants with other types of pulmonary hypertension, smoking, chronic obstructive pulmonary disease, obstructive sleep apnea syndrome, asthma, infection, interstitial lung disease, connective tissue disease, endocrine disease, hypertension, diabetes, coronary heart disease, cardiomyopathy, congenital heart disease, malignant tumors, hepatitis and cirrhosis, nephritis and renal failure.

[0100] 2. Experimental methods

[0101] RNA extraction and library construction

[0102] For whole blood samples Total RNA was extracted with reagents, and the RNA concentration and purity were detected by Nanodrop 2000. The RNA integrity was detected by agarose gel electrophoresis, and the RNA integrity number (RIN) was determined by Agilent 2100. The total amount of RNA required for single library construction was 5 μg, and the RNA concentration should be ≥200 ng / μL, and the optical density (OD) value should be between 1.8 and 2.0. DNA fragments in the total RNA sample were digested with DNase I, and the reaction products were purified and recovered with magnetic beads, and rRNA was removed from the total RNA sample after digestion. The RNA sample obtained in the previous step was placed in a polymerase chain reaction (PCR) instrument for heat blocking, and single-stranded cDNA and double-stranded cDNA with dUTP were synthesized in the PCR instrument. Subsequently, end repair and sequencing connector connection were performed, and finally PCR amplification was performed to complete library preparation.

[0103] Sequencing and raw data processing

[0104] The library quality was tested using Agilent 2100 Bioanalyzer and ABI StepOnePlus Real-Time PCR System, and qualified libraries were sequenced using the PE100 strategy on the BGIseq platform. The sequencing data was quality controlled using "FASTP", including the removal of adapter sequences, 5' fragments, 3' fragments, bases with a quality of <20, and reads with N>10%. In the transcriptome sequencing data, only data aligned with the reference genome can be used for subsequent analysis. The high-quality sequencing sequences obtained after quality control were analyzed using HISAT2

[0105] (https: / / ccb.jhu.edu / software / hisat2 / index.shtml) was compared with the specified reference genome, which was from the Ensembl database, with the genome version of GRCh38 and the gene annotation information of Ensemble92. Stringtie (http: / / ccb.jhu.edu / software / stringtie / ) was used to quantitatively analyze the expression of lncRNA and standardize the output results. Based on the alignment results of HISAT2 software, Stringtie calculated the exon model kilobase fragment number (FPKM) value of each gene / transcript in the sample per million mapped reads, and used this value as the expression level of the gene / transcript in the sample.

[0106] Differential analysis of lncRNA

[0107] First, the raw read counts were standardized, and then the hypothesis test probability (p-value) was calculated using a statistical model, and then multiple hypothesis testing correction (Benjiamini and Hochberg method) was performed to obtain the corrected p-value (false discovery rate, FDR). The DESeq2 package in R was used to screen genes with significant differences between different samples, with p<0.05 and |log2 fold change| (|log2FC|)>1 as the differential expression screening criteria for lncRNA.

[0108] Primer design

[0109] Real Time PCR detection target gene primers are as follows:

[0110] AP003110.1-F: GGTTGAATCTCCCTGGCTTGA (SEQ ID NO: 1);

[0111] AP003110.1-R: TGCTGGAGGAAAAGTGGTGAA (SEQ ID NO: 2);

[0112] AL133476.1-F: GAGGGGTGGGAGACAGAAAGC (SEQ ID NO: 3);

[0113] AL133476.1-R: TGTTAGTTATGCCCGTCCTGC (SEQ ID NO: 4).

[0114] Extract total RNA from samples

[0115] 1) Add 0.75 mL MagZol LS Reagent to the EP tube, then add 0.25 mL blood sample, mix by pipetting 3-5 times, then vortex mix for more than 15 seconds to completely disperse the precipitate, and leave at room temperature for 5-10 minutes.

[0116] 2) Add 0.2 mL of chloroform, shake vigorously for 15 seconds, and place on ice for 10 minutes.

[0117] 3) Centrifuge at 12000 rpm for 10 min at 4°C. The sample will separate into three layers: a lower organic phase, a middle layer, and an upper colorless aqueous phase. RNA is present in the upper aqueous phase. The volume of the aqueous phase is approximately 70% of the added RLS volume. Transfer the aqueous phase to a new tube and proceed to the next step.

[0118] 4) Add 1.5 times the volume of anhydrous ethanol, vortex mix for 15 seconds, and purify the RNA through a column (the following centrifugation is performed at room temperature).

[0119] 5) Place the HiPure Viral Mini Column in a 2 mL collection tube. Transfer half of the mixed solution to the column, centrifuge at 12,000 rpm for 60 seconds, discard the waste liquid, and put the adsorption column back into the collection tube. Transfer the remaining mixed solution to the column, centrifuge at 12,000 rpm for 60 seconds. Discard the waste liquid and put the adsorption column back into the collection tube.

[0120] 6) Add 350 μL Buffer RWC to the column and centrifuge at 12000 rpm for 60 seconds. Discard the waste liquid and put the adsorption column back into the collection tube.

[0121] 7) Add 500 μL Buffer RW2 to the column and centrifuge at 12000 rpm for 60 seconds. Discard the waste liquid and put the adsorption column back into the collection tube.

[0122] 8) Repeat step 7), discard the waste liquid, put the adsorption column back into the collection tube, and centrifuge at 13000 rpm for 3 minutes to dry the matrix of the column.

[0123] 9) Transfer the column to a 1.5 mL centrifuge tube, add 30-50 μL RNase free water to the middle of the adsorption membrane according to the expected RNA yield, place at room temperature for 2 minutes, and centrifuge at 13,000 rpm for 1 minute.

[0124] 10) Discard the RNA column and store the RNA sample at -80°C.

[0125] Reverse transcription to synthesize mRNA cDNA

[0126] The FastQuant cDNA First-Strand Synthesis Kit (Cat. No. KR106) was used for mRNA reverse transcription. First, the genomic DNA reaction was removed, and 2.0 μL of 5×gDNA Buffer and 1 μg of TotalRNA were added to the test tube. RNase Free ddH2O was added to make the total volume 10 μL, and the mixture was heated at 42°C for 3 min in a water bath. Then, 2.0 μL of 10×Fast RT Buffer, 1.0 μL of RT EnzymeMix, 2.0 μL of FQ-RT Primer Mix, and 5.0 μL of RNase Free ddH2O were mixed and added to the above test tube to mix together for a total of 20 μL. The mixture was heated at 42°C for 15 min and at 95°C for 3 min in a water bath. If the synthesized cDNA needs to be stored for a long time, it should be stored at -20°C or lower.

[0127] Real-Time PCR

[0128] Gene-9660 fluorescence quantitative PCR instrument was used. -△△CT Relative quantitative analysis of the data was performed.

[0129] 1) Reaction system: Use SuperReal PreMix Plus (SYBR Green) (Cat. No.: FP205) for amplification, and perform the experimental operation according to the product manual. The Real Time PCR reaction system is shown in Table 1.

[0130] Table 1 Real Time PCR reaction system

[0131] Reagents Usage 2×SuperReal PreMix Plus 10μL Upstream primer (10 μM) 0.6μL Downstream primer (10 μM) 0.6μL <![CDATA[50×ROX Reference Dye △ ]]> 2μL DNA template 2μL Sterile distilled water 4.8μL

[0132] 2) The amplification program was: 95°C for 15 min, (95°C for 10 sec, 55°C for 30 sec, 72°C for 32 sec) × 40 cycles, 95°C for 15 sec, 60°C for 60 sec, 95°C for 15 sec.

[0133] 3) Primer screening

[0134] After mixing the cDNA of each sample, use it as a template for 3-10 times gradient dilution. Take 2 μL of each diluted sample as a template and amplify with target gene primers and internal reference gene primers respectively. At the same time, perform melting curve analysis at 60-95°C, and screen primers based on high amplification efficiency and single peak of melting curve.

[0135] 4) Real Time PCR detection of samples

[0136] After diluting the cDNA of each sample 3-10 times, 2 μL was taken as a template and amplified using target gene primers and internal reference gene primers (see Table 2). At the same time, melting curve analysis was performed at 60-95°C.

[0137] Table 2 Sample RealTime PCR detection design

[0138]

[0139]

[0140] 3. Experimental results

[0141] In the training set, the expression level of AP003110.1 in CTEPH was significantly upregulated ( Figure 1 ), the expression level of AL133476.1 in CTEPH was significantly downregulated ( Figure 2 ), the AUCs of AP003110.1 and AL133476.1 were 0.886 and 0.9 ( Figure 3 , Figure 4 ), the AUC of the combined diagnosis of AP003110.1 and AL133476.1 is 1( Figure 5), which has a high diagnostic efficacy.

[0142] In the validation set, the expression level of AP003110.1 in CTEPH was significantly upregulated ( Figure 6 ), the expression level of AL133476.1 in CTEPH was significantly downregulated ( Figure 7 ), the AUCs of AP003110.1 and AL133476.1 were 0.757 and 0.681 respectively ( Figure 8 , Fig. 9 ), the AUC of the combined diagnosis of AP003110.1 and AL133476.1 was 0.908 ( Fig.10 ), which has a high diagnostic efficacy.

[0143] The description of the above embodiments is only used to understand the method and core idea of ​​the present invention. It should be pointed out that, for those skilled in the art, several improvements and modifications can be made to the present invention without departing from the principle of the present invention, and these improvements and modifications will also fall within the scope of protection of the claims of the present invention.

Claims

1. Use of a reagent for detecting the expression level of AP003110.1 in a sample in the preparation of a product for diagnosing CTEPH, wherein the reagent is selected from the following group: (1) Primers that specifically amplify AP003110.1; (2) A probe that specifically recognizes AP003110.

1.

2. The use according to claim 1, characterized in that: The sequences of the primers for specifically amplifying AP003110.1 are shown in SEQ ID NO: 1-2.

3. The use according to claim 1, characterized in that: The sample is selected from blood.

4. The use according to claim 1, characterized in that: The reagents also include reagents required for detecting the expression level of AP003110.1 by RT-PCR method and qRT-PCR method.

5. The use according to claim 1, characterized in that: The reagent also includes a detectable label.

6. The use according to claim 5, characterized in that: The detectable labels include UV-Vis labels, near infrared labels, fluorescent groups, phosphorescent groups, magnetic spin resonance labels, photosensitizers, photocleavable moieties, chelating centers, heavy atoms, radioisotopes, isotopically detectable spin resonance labels, paramagnetic moieties, chromophores, and luminophores.

7. The use according to claim 1, characterized in that: The product includes a chip, a test kit or a nucleic acid membrane strip.

8. The use according to claim 7, characterized in that: The kit also includes a container.

9. The use according to claim 7, characterized in that: The kit also includes instructions.

10. The use according to claim 7, characterized in that: The kit also includes a buffer.

11. The use according to claim 7, characterized in that: The kit also includes packaging materials.

12. Use of a reagent for detecting the expression level of AP003110.1 in a sample in the preparation of a system / device for diagnosing CTEPH, wherein the reagent is selected from the following group: (1) Primers that specifically amplify AP003110.1; (2) A probe that specifically recognizes AP003110.

1.

13. The use according to claim 12, characterized in that: The sequences of the primers for specifically amplifying AP003110.1 are shown in SEQ ID NO: 1-2.

Images