A primer set for identifying Chinese pangolin and its application

Abstract

The present invention relates to a primer set for identifying Chinese pangolins and its application, and relates to the field of biological detection technology. The primer set for identifying Chinese pangolins includes an RPA primer set, a Cas enzyme complex and an ssDNA probe, and the Cas enzyme complex includes crRNA; the RPA primer set is used to amplify a target sequence, the target sequence is selected from the Cytb gene, and the crRNA is used to identify the Cytb gene. The use of the primer set can solve one or more problems existing in the above-mentioned forensic practice and customs inspection and other on-site detections, and plays an important role in combating illegal and criminal cases involving Chinese pangolins.

Description

Technical Field

[0001] The present invention relates to the field of biological detection technology, and in particular to a primer set for identifying Chinese pangolins and an application thereof. Background Art

[0002] The Chinese pangolin is a mammal belonging to the order Pholidota, family Pangolinidae, and genus Pangolin. It is a widely distributed and abundant animal resource in my country, but due to its great edible and medicinal value, it has been hunted indiscriminately. Coupled with factors such as habitat destruction, the number of wild populations has dropped sharply and it is facing the danger of extinction. At present, the Chinese pangolin has been listed in Appendix I of the Convention on International Trade in Endangered Species of Wild Fauna and Flora (CITES), and is an endangered species that is prohibited from international trade. However, my country's "List of National Key Protected Wildlife" lists it as a national first-class protected animal for key protection and management. The 2020 edition of the "Chinese Pharmacopoeia" (Part I) no longer includes pangolins, which also means that Chinese pangolins are no longer circulated and used as traditional Chinese medicine. Despite this, some lawbreakers still hunt and poach Chinese pangolins indiscriminately in order to make huge profits. What's worse, some people smuggle and sell Chinese pangolin scales under the guise of ordinary animal scales, and evade customs and public security inspections by changing the appearance of the samples, such as processing them into powder products. Therefore, it is necessary to establish an accurate and simple detection method suitable for on-site inspections to achieve rapid species identification of Chinese pangolin samples.

[0003] Existing animal species identification methods mainly include detection technologies using characteristic proteins, specific metabolites and DNA as markers. Protein-based detection methods have high requirements for the purity of reactants, and the heat denaturation of the target protein will cause its antigenic epitope and solubility characteristics to change to varying degrees, making it difficult to be detected in antibody detection, thereby producing false negative identification results. Metabolite-based identification methods are controversial in their species specificity and have high requirements for detection equipment, so they are limited in their application in species detection. In contrast, DNA has recognized species specificity, interspecies polymorphism and thermal stability, is not limited by gene expression, has no phenotypic effects, and is not affected by the environment. It is the most common standard for measuring genetic differences between different individuals or species. The Sanger sequencing technology, which has always been regarded as the gold standard for DNA species identification, has the disadvantages of cumbersome operation steps, low efficiency and slow speed, and cannot accurately sequence mixed DNA from two or more species. Although the PCR-CE detection system and high-throughput sequencing technology based on species-specific genetic markers can identify the target species, they rely on sophisticated and expensive experimental equipment and corresponding reagents and consumables, and cannot meet the needs of customs and public security for rapid screening of Chinese pangolins in on-site testing environments. Therefore, with the increasing crackdown on wildlife crimes, and in view of the needs of frontline investigations involving wildlife, it is urgent to develop a rapid screening method that is simple to operate, less time-consuming, highly specific, and highly sensitive and can be used for on-site testing. Summary of the invention

[0004] In view of the above problems, the present invention provides a primer set for identifying Chinese pangolins. The primer set can solve one or more problems existing in on-site detection such as forensic practice and customs inspection, and plays an important role in combating illegal and criminal cases involving Chinese pangolins.

[0005] The present invention provides a primer set for identifying Chinese pangolins, comprising an RPA primer set, a Cas enzyme complex and a ssDNA probe, wherein the Cas enzyme complex comprises crRNA;

[0006] The RPA primer set is used to amplify a target sequence, the target sequence is selected from the Cytb gene, and the crRNA is used to identify the Cytb gene.

[0007] Recombinase polymerase amplification technology (Recombinase Polymerase Amplification, RPA) is a nucleic acid in vitro constant temperature amplification technology using T4 recombinase, which can complete amplification without the aid of a thermal cycler, but the technical difficulty is to design a primer set with strong species specificity and high amplification efficiency to exclude the interference of false positives and weak positives. Regular interval clustered short palindromic repeats Clustered Regularly Interspaced Short Palindromic Repeats, CRISPR) has been favored as a gene editing technology since its advent, but the current research on this technology is mostly applied to in vitro detection of genetic modification and pathogen nucleic acids, and there are few reports on the detection and application of animal-derived DNA, especially wild animal DNA. Based on this, the inventor proposes the above-mentioned primer set, which can be used to identify whether the sample to be tested contains Chinese pangolin DNA components through a single reaction, and realize accurate, sensitive and rapid detection of Chinese pangolin components, thereby solving one or more problems existing in on-site detections such as the above-mentioned forensic practice and customs inspection, and playing an important role in combating illegal and criminal cases involving Chinese pangolins.

[0008] In one embodiment, the RPA primer set is shown as SEQ ID NO.1 and SEQ ID NO.2; the crRNA is shown as SEQ ID NO.3; and the ssDNA probe is shown as SEQ ID NO.4.

[0009] Table 1 Nucleotide sequences of RPA primer sets, crRNA, and ssDNA probes

[0010]

[0011] The underlined sequence in the Chinese pangolin crRNA sequence information is the stem-loop sequence homologous to LbCas12a.

[0012] The present invention also provides a detection system for identifying Chinese pangolins, comprising an RPA constant temperature amplification reaction system and a CRISPR / Cas detection reaction system, wherein the RPA constant temperature amplification reaction system comprises the RPA primer set, and the CRISPR / Cas detection reaction system comprises the Cas enzyme complex and an ssDNA probe.

[0013] In one embodiment, the total volume of the RPA isothermal amplification reaction system is 50 μL, including: Abuffer 37 μL, dNTPs (10 mM) 1.5 μL, upstream primer (10 μM) 2 μL, downstream primer (10 μM) 2 μL, DNA template and ddH2O 5 μL, B buffer 2.5 μL. Among them, A buffer contains the necessary reaction components RPA buffer, recombinase, single-strand binding protein, strand displacement DNA polymerase, etc., and B buffer contains magnesium acetate as an enzyme performance auxiliary factor to start the RPA reaction.

[0014] In one embodiment, the total volume of the CRISPR / Cas detection reaction system is 30 μL, including 3 μL of CBuffer, 1 μL of LbCas12a Nuclease, 2 μL of Pentadactyla-crRNA, 6 μL of ssDNA probe, 1 μL of DNA template and an appropriate amount of nuclease-free H2O.

[0015] In one embodiment, the Cas enzyme in the Cas enzyme complex is Cas12a.

[0016] In one embodiment, the 5' end of the ssDNA probe is connected to a fluorescent group, and the 3' end of the ssDNA probe is connected to a quenching group.

[0017] In one embodiment, the 5' end of the ssDNA probe is labeled with a fluorescent group 6-carboxyfluorescein (6-FAM), and the 3' end of the ssDNA probe is labeled with a quenching group Black Hole Quencher 1 (BHQ1).

[0018] In one embodiment, the working concentration of the RPA primer set is 0.3-0.5 μM.

[0019] The working concentration is the concentration at which the above-mentioned components can achieve the expected effect when used. It can be understood that when preparing a reagent containing the above-mentioned RPA primer set, a technician in this field can prepare a mother solution or a stock solution with a higher concentration, and then dilute it when it is used. The mother solution or the stock solution and its concentration are all within the protection scope of the present invention.

[0020] The present invention also provides a kit for identifying Chinese pangolins, comprising the primer set or the detection system.

[0021] The method of using the above kit is as follows: amplify the sample to be tested using RPA specific primers, mix the amplified product with Cas12a protein, fluorescence-quenching labeled ssDNA probe and crRNA, and perform enzyme digestion reaction, and read the detection signal using a fluorescence detection device. The fluorescence detection device can be a real-time fluorescence quantitative PCR instrument or an enzyme marker.

[0022] In one embodiment, the kit further comprises a positive control and a negative control, wherein the positive control comprises a Cytb gene sequence fragment.

[0023] In one embodiment, the negative control is sterile water.

[0024] The present invention also provides a method for identifying Chinese pangolins, comprising the following steps: extracting nucleic acid from a sample to be tested, and using the kit for detection.

[0025] In one embodiment, the detection includes an amplification reaction and a detection reaction. The temperature of the amplification reaction is 35-45°C and the time is 25-45 minutes; the temperature of the detection reaction is 35-45°C and the time is 30-40 minutes.

[0026] The present invention also provides the use of the primer set, the detection system or the kit in preparing a product for identifying Chinese pangolins.

[0027] Compared with the prior art, the present invention has the following beneficial effects:

[0028] A primer set and application thereof for identifying Chinese pangolins of the present invention, wherein the RPA primer set in the primer set can realize specific identification of the species of Chinese pangolins, and has the advantages of strong specificity, high sensitivity, good accuracy, and high amplification efficiency; crRNA can guide Cas12a to efficiently shear specific gene fragments of Chinese pangolins, and has no cross-reaction to DNA of Malayan pangolins, giant ground pangolins, tree pangolins, etc. The use of the primer set can solve one or more problems existing in the above-mentioned on-site detections such as forensic practice and customs inspection, and play an important role in combating illegal and criminal cases involving Chinese pangolins. The present invention is based on the demand for rapid on-site detection in forensic practice and customs inspection, and takes the Chinese pangolin, a common rare wild animal involved in the case, as the target, and realizes rapid identification of Chinese pangolins by specifically detecting the mitochondrial Cytb gene target of the target species, according to the change of the fluorescence signal of the RPA-CRISPR / Cas12a system. The present invention designs an RPA-CRISPR / Cas12a detection system for specific identification of Chinese pangolins for rare wild animals for the first time. The dual specificity detection of Chinese pangolins is carried out by combining RPA with CRISPR-Cas12a technology. The whole reaction can be carried out at 37℃~42℃. The results are interpreted by the fluorescence changes in the detection system, and the fluorescence signal curve is used for intuitive and clear result judgment, which is free from the limitations of traditional species identification sequencing instruments and the dependence on professional technicians. The detection has the advantages of simple operation, short time consumption, high sensitivity and strong specificity. The establishment of the detection method in the present invention can further realize the visual rapid detection of Chinese pangolin DNA by naked eye observation of fluorescence under blue light, assist in combating illegal trade activities involving Chinese pangolins, and provide scientific evidence for criminal proceedings in judicial cases. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 The electrophoresis gel imaging diagram of the amplification reaction of the standard plasmid and Chinese pangolin DNA by different RPA primers in Example 2 (upper figure) and the corresponding CIRSPR / Cas12a system fluorescence detection results (lower figure); wherein, Figure 1In the electrophoresis diagram above, M is Marker I DNA Ladder, and lanes 1, 3, 5, and 7 correspond to the results of amplifying standard positive plasmids with Pentadactyla-cytb-F3R3, Pentadactyla-cytb-F2R2, Pentadactyla-cytb-F1R1, and Pentadactyla-cytb-F4R4, respectively; lanes 2, 4, 6, and 8 correspond to the results of amplifying Chinese pangolin DNA with Pentadactyla-cytb-F3R3, Pentadactyla-cytb-F2R2, Pentadactyla-cytb-F1R1, and Pentadactyla-cytb-F4R4, respectively; Figure 1 The bar graph below shows the final fluorescence intensity of the amplification products of four pairs of RPA primers, Pentadactyla-cytb-F1R1, Pentadactyla-cytb-F2R2, Pentadactyla-cytb-F3R3, and Pentadactyla-cytb-F4R4, in the CRISPR system reaction;

[0030] Figure 2 The fluorescence detection results of the RPA-CRISPR / Cas12 detection method for specific identification of Chinese pangolins preliminarily established in Example 3;

[0031] Figure 3 It is the electrophoresis gel imaging image of the amplification product under various temperature conditions during the RPA reaction temperature optimization process in Example 4 and the corresponding fluorescence detection result of the RPA-CIRSPR / Cas12a system; wherein, Figure 3 In the electrophoresis diagram above, M is Marker I DNA Ladder, 1: 37°C, 2: 39°C, 3: 41°C; Figure 3 The bar graph below shows the final fluorescence intensity of the RPA amplification product in the CRISPR system reaction under various temperature conditions;

[0032] Figure 4 The electrophoresis gel images of the amplified products under different time conditions during the RPA reaction time optimization process in Example 4 and the corresponding RPA-CIRSPR / Cas12a system fluorescence detection results; wherein, Figure 4 In the electrophoresis diagram above, M is Marker I DNA Ladder, 1: 25 min, 2: 30 min, 3: 35 min, 4: 40 min; Figure 4 The bar graph below shows the final fluorescence intensity of the RPA amplification product in the CRISPR system reaction under various time conditions;

[0033] Figure 5This is the fluorescence intensity result diagram corresponding to different reaction temperatures during the reaction temperature optimization process of the RPA-CIRSPR / Cas12a system in Example 4;

[0034] Figure 6 This is a sensitivity test result diagram of the RPA-CRISPR / Cas12a fluorescence method in Example 5; wherein, Figure 6 In the first electrophoresis graph from top to bottom, M is MarkerⅠDNA Ladder, +: positive control, 1: 1ng / μL, 2: 0.1ng / μL, 3: 0.01ng / μL, 4: 0.001ng / μL, 5: 0.0001ng / μL; the second bar graph is the final fluorescence intensity of the RPA amplification product at each concentration in the CRISPR system reaction; the third curve graph is the fluorescence intensity curve result of the sensitivity test;

[0035] Figure 7 The electrophoresis gel imaging diagram of the RPA reaction products of different animal templates in the system specificity verification experiment in Example 6 and the corresponding CIRSPR / Cas12a system fluorescence detection result diagram; wherein, Figure 7 In the electrophoresis diagram above, M is MarkerⅠDNALadder, +: positive control, NC: positive control, 1, 11: Chinese pangolin, 2: Malayan pangolin, 3: Giant ground pangolin, 4, 5: Tree pangolin, 6: Pig, 7: Cow, 8: Chicken, 9: Duck, 10: Sheep; Figure 7 The curve below is the fluorescence intensity detection result of the RPA amplification products of different species in each cycle of the CRISPR system reaction;

[0036] Figure 8 The electrophoresis gel imaging diagram of the RPA reaction products of different animal templates in the system specificity verification experiment in Example 6 and the corresponding CIRSPR / Cas12a system fluorescence detection result diagram; wherein, Figure 8 In the electrophoresis diagram above, M is MarkerⅠDNALadder, NC: positive control, 12: zebra, 13: red panda, 14: African lion, 15: macaque, 16: red kangaroo, 17: bamboo rat, 18: Chinese pangolin, 19: addax, 20: Eld's deer, 21: Javan deer, 22: raccoon, 23: European mouflon, 24: dwarf horse, 25: Asian small otter; Figure 8 The curve below is the fluorescence intensity detection result of the RPA amplification products corresponding to different species in each cycle of the CRISPR system reaction. DETAILED DESCRIPTION

[0037] In order to facilitate the understanding of the present invention, the present invention will be described more fully below with reference to the relevant drawings. The preferred embodiments of the present invention are given in the drawings. However, the present invention can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the understanding of the disclosure of the present invention more thorough and comprehensive.

[0038] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those commonly understood by those skilled in the art of the present invention. The terms used in the specification of the present invention herein are only for the purpose of describing specific embodiments and are not intended to limit the present invention.

[0039] source:

[0040] Unless otherwise specified, the reagents, materials, and equipment used in this example are all commercially available; the experimental methods are all conventional experimental methods in the art unless otherwise specified.

[0041] Example 1

[0042] Design of specific crRNA and specific RPA primer pairs for detecting Chinese pangolin.

[0043] 1. Experimental method.

[0044] (1) All the mitochondrial cytochrome b gene (Cytb) sequences of Chinese pangolin, Malayan pangolin, Indian pangolin and other closely related species were downloaded and compared from the website of the National Center for Biotechnology Information (http: / / www.ncbi.nlm.nih.gov / ) for sequence comparison.

[0045] (2) MEGA7 was used to align the above Cytb gene sequences, screen the conserved regions of Chinese pangolins, and Primer Premier and Oligo7.0 software were used to design specific crRNA sequences and specific RPA primer sequences. In order to screen RPA primer pairs with higher amplification efficiency, multiple candidate primer sets were designed, and some candidate primer sets are shown below.

[0046] (3) The designed RPA primers, crRNA, and ssDNA probes were synthesized by Guangzhou Aidi Gene Technology Co., Ltd.

[0047] 2. Experimental results

[0048] (1) The specific sequence of the design is as follows:

[0049] The crRNA sequence information used to detect Chinese pangolins is as follows:

[0050] Pentadactyla-crRNA:

[0051] 5'- UAAUUUCUACUAAGUGUAGAU UCCUCCCCUUCGCAAUCCUAGGC-3′;

[0052] 5'- TAATTTCTACTAAGTGTAGAT TCCTCCCCTTCGCAATCCTAGGC-3' (SEQ ID NO. 3) The above sequence is an RNA sequence, wherein T is the letter standard representation in the WIPO Sequence sequence table, which is uracil U; the underlined sequence is the stem-loop sequence homologous to LbCas12a;

[0053] The ssDNA-Probe sequence information used to detect Chinese pangolins is as follows:

[0054] 6-FAM-TTATT-BHQ1;

[0055] The specific RPA amplification primer sequence information used to detect Chinese pangolins is as follows:

[0056] RPA upstream primer Pentadactyla-cytb-F1 (SEQ ID NO.1):

[0057] 5'-ATGAAACATCGGCATCCTACTCCTATTCGC-3';

[0058] RPA downstream primer Pentadactyla-cytb-R1 (SEQ ID NO.2):

[0059] 5'-TTGGATACGATTCCTATTGGGTTGTTTGAC-3';

[0060] RPA upstream primer Pentadactyla-cytb-F2 (SEQ ID NO.4):

[0061] 5'-ACATCGGCATCCTACTCCTATTCGC-3';

[0062] RPA downstream primer Pentadactyla-cytb-R2 (SEQ ID NO.5):

[0063] 5'-GAGTTGGATACGATTCCTATTGGGT-3';

[0064] RPA upstream primer Pentadactyla-cytb-F3 (SEQ ID NO.6):

[0065] 5'-CGGACGAGGCATCTATTATGGATCTTACGC-3';

[0066] RPA downstream primer Pentadactyla-cytb-R3 (SEQ ID NO.7):

[0067] 5'-TGTCTGAGTTGGATACGATTCCTATTGGGT-3';

[0068] RPA upstream primer Pentadactyla-cytb-F4 (SEQ ID NO.8):

[0069] 5′-ATTCGCAGCAATAGCAACCG-3′;

[0070] RPA downstream primer Pentadactyla-cytb-R4 (SEQ ID NO.9):

[0071] 5′-TTCCTATTGGGTTGTTTGAC-3′.

[0072] Example 2

[0073] Screening of optimal RPA primers.

[0074] 1. Experimental method.

[0075] (1) Design and construct the standard plasmid of the target gene of Chinese pangolin: PCR primers were designed according to the flanks of the target sequence of the Cytb gene of Chinese pangolin, and the target sequence of Cytb was obtained by ordinary PCR amplification. The target sequence was connected to the pMD-18T vector and transformed into DH-5α Escherichia coli competent cells; the recombinants were screened by blue-white spots and sent to Sangon Biotech (Shanghai) Co., Ltd. for DNA sequencing verification. A large number of copies of the recombinant plasmid were obtained by culturing and extracting the recombinant Escherichia coli, and the appropriate amount of dilution was used as the positive control.

[0076] (2) Use QIAGEN's TIANamp Genomic DNA Kit (blood / cell / tissue genomic DNA extraction kit) to extract Chinese pangolin DNA and dilute it to 10 ng / μL.

[0077] (3) RPA primers were used to amplify 1 ng / μL standard plasmid and Chinese pangolin DNA. The reaction system was 37 μL A buffer, 1.5 μL dNTPs (10 mM), 2 μL downstream primer (10 μM), 2 μL upstream primer (10 μM), 1 μL DNA template and 2.5 μL B buffer. ddH2O was added to the total volume of the system to 50 μL.

[0078] (4) The RPA reaction procedure is: react at 37°C for 35 min to obtain the amplified product.

[0079] (5) The RPA reaction product in step (3) is subjected to agarose gel electrophoresis and imaging analysis.

[0080] (6) The amplified products of each RPA primer pair were subjected to CRISPR / Cas12a reaction detection. The specific reaction system included: 3 μL C Buffer, 1 μL LbCas12a Nuclease, 2 μL crRNA, 6 μL fluorescent ssDNA probe, 1 μL RPA product, and the remainder was supplemented to 30 μL by nuclease-free H2O.

[0081] (7) Place the reaction system in QuantStudio TM In the 7 Flex real-time fluorescence quantitative PCR system, select the FAM fluorescence channel, set the program to react at 37°C for 30 minutes, collect the fluorescence signal every 30 seconds, and observe the fluorescence signal curve to interpret the results.

[0082] 2. Experimental results.

[0083] (1) Figure 1 As shown, all four pairs of RPA primers can effectively amplify the standard plasmid product, but when amplifying the Chinese pangolin DNA sample, the amplification band of Pentadactyla-cytb-F4R4 is diffuse, and Pentadactyla-cytb-F2R2 has a more obvious non-specific amplification band. At the same time, in the repetitive experiment, the fluorescence intensity results of the parallel experiment of primers F3 / R3 are quite different, and the fluorescence intensity results of the parallel experiment of primers F1 / R1 are relatively stable. F1 / R1 and F3 / R3 both have high amplification efficiency. This patent preferably uses primers F1 / R1 for system construction, optimization and testing.

[0084] Based on the analysis of the final fluorescence intensity results of each primer pair in the CRISPR reaction system and the previous species specificity test results, Pentadactyla-cytb-F1R1 (SEQ ID NO.1 and SEQ ID NO.2) with strong species specificity and high primer amplification efficiency was selected as the Chinese pangolin RPA primer pair for this detection combination.

[0085] Example 3

[0086] Construction of RPA-CRISPR / Cas12a detection system for Chinese pangolin identification.

[0087] 1. Experimental method.

[0088] (1) RPA primers were used to amplify 1 ng / μL standard plasmid and Chinese pangolin DNA to obtain an amplification product containing the crRNA complementary region as the Cas12a cleavage target dsDNA.

[0089] (2) The RPA amplification product was subjected to CRISPR / Cas12a reaction detection. The specific reaction system included: 3 μL CBuffer, 1 μL LbCas12a Nuclease, 2 μL crRNA, 6 μL fluorescent ssDNA probe, 1 μL RPA product, and the remainder was supplemented to 30 μL by nuclease-free H2O; standard plasmid DNA was used as a positive control, and sterile water instead of DNA template was used as a negative control.

[0090] (3) Place the reaction system in QuantStudio TM In the 7 Flex real-time fluorescence quantitative PCR system, select the FAM fluorescence channel, set the program to react at 37°C for 30 minutes, collect the fluorescence signal every 30 seconds, and observe the fluorescence signal curve to interpret the results.

[0091] 2. Experimental results.

[0092] (1) Figure 2 As shown in the figure, the RPA amplification products of standard plasmid DNA and Chinese pangolin DNA can show typical fluorescence signal curves in the CRISPR system detection, indicating that the crRNA / Cas12a complex in the system specifically recognizes the target dsDNA sequence and cuts the ssDNA probe, the quenching group is separated from the fluorescent group, and the fluorescence of the DNA probe is excited. In contrast, the negative control lacks this typical fluorescence signal curve.

[0093] Example 4

[0094] Optimization of RPA-CRISPR / Cas12 detection system for identification of Chinese pangolin

[0095] 1. Experimental method.

[0096] (1) Optimization of RPA amplification reaction temperature: 1 ng / μL Chinese pangolin DNA was amplified using RPA primers, and the reaction system was the same as in Example 2. Multiple reaction temperatures, such as 37°C, 39°C, and 41°C, were set for RPA reaction, and then the amplified products were subjected to agarose gel electrophoresis and CRISPR / Cas12a reaction detection. The final fluorescence signal intensity at different RPA amplification temperatures was observed to screen out the optimal RPA reaction temperature.

[0097] (2) Optimization of RPA amplification reaction time: 1 ng / μL Chinese pangolin DNA was amplified using RPA primers, and the reaction system was the same as in Example 2. The system was placed at the above-mentioned optimal reaction temperature and amplified for 25 min, 30 min, 35 min and 40 min, respectively. The resulting reaction products were subjected to agarose gel electrophoresis and CRISPR / Cas12a reaction detection. The specific reaction system was the same as in Example 3. The final fluorescence signal intensity of the amplified products under different RPA reaction times was observed to screen out the optimal RPA reaction time.

[0098] (3) Optimization of CRISPR / Cas12a reaction temperature: Based on the optimal reaction temperature and optimal reaction time of RPA, 1 ng / μL Chinese pangolin DNA was amplified using RPA primer pairs, and the reaction system was the same as in Example 2. Multiple groups of CRISPR / Cas12a reaction temperatures, such as 37°C, 42°C, and 45°C, were set to detect the RPA amplification product. The specific reaction system was the same as in Example 3. The final fluorescence signal intensity obtained at different CRISPR enzyme cleavage reaction temperatures was observed to screen out the optimal CRISPR enzyme cleavage reaction temperature.

[0099] 2. Experimental results.

[0100] (1) Figure 3 As shown in the figure, the electrophoresis results of the products corresponding to the three RPA reaction temperatures can all show bright and clear target bands; in the CRIPSR / Cas12a reaction system, the final fluorescence signal intensity detected by the RPA amplification product under 37°C is the highest, so 37°C is selected as the optimal reaction temperature in the RPA reaction.

[0101] (4) Figure 4 As shown, the corresponding electrophoresis results of the RPA amplification products at each reaction time can show bright and clear target bands; in the CRIPSR / Cas12a reaction system, the final fluorescence intensity detected by the RPA amplification product under the condition of 35 minutes is the highest, so 35 minutes is selected as the optimal reaction time in the RPA reaction.

[0102] (5) Figure 5 As shown in the figure, when the CRISPR / Cas12a reaction temperature is 42°C, the final fluorescence signal intensity detected by the reaction system is the highest, so 42°C is selected as the optimal reaction temperature in the CRISPR / Cas12a reaction.

[0103] In summary, in the RPA-CRISPR / Cas12 detection system, the optimal reaction temperature of the RPA reaction is 37°C and the reaction time is 35 min; the temperature of the CIRPSR / Cas12a reaction is 42°C.

[0104] Example 5

[0105] Sensitivity test of the RPA-CRISPR / Cas12a detection system for identification of Chinese pangolins

[0106] 1. Experimental method.

[0107] (1) The Chinese pangolin DNA with a concentration of 1 ng / μL was diluted by a 10-fold gradient gradient to obtain a DNA template with a concentration range of 1 ng / μL to 0.1 pg / μL, and the RPA-CRISPR / Cas12a reaction was performed on the DNA templates of each concentration to obtain the sensitivity detection limit of the system. The RPA reaction system was the same as in Example 2, the CRISPR / Cas12a reaction system was the same as in Example 3, and the reaction procedure used the optimized reaction procedure in Example 4.

[0108] 2. Experimental results.

[0109] (1) Figure 6 As shown in the agarose electrophoresis pattern, the target product fragments can be seen at each DNA template concentration, and the amplified product fragments of the template with a concentration above 0.01ng / μL are bright and clear. The fluorescence detection results of the CRIPSR / Cas12a reaction system show that when the DNA is diluted to 0.1pg / μL, a strong fluorescence signal can still be detected, indicating that the sensitivity of using the fluorescence method to detect Chinese pangolin DNA can reach 0.1pg / μL.

[0110] Example 6

[0111] Specificity test of the RPA-CRISPR / Cas12a detection system for identification of Chinese pangolins.

[0112] 1. Experimental method.

[0113] (1) QIAGEN's TIANamp Genomic DNA Kit (blood / cell / tissue genomic DNA extraction kit) was used to extract DNA from pangolins such as Chinese pangolin, Malayan pangolin, giant ground pangolin, and tree pangolin. DNA from common animals such as chicken, duck, pig, cattle, and other common animals, as well as DNA from a variety of wild animals such as macaques, red pandas, ponies, zebras, and addax were also extracted.

[0114] (2) RPA primers were used to amplify DNA from different animals. The preparation of the RPA reaction system and the reaction procedure were referred to Example 2. After the amplification was completed, the RPA amplification products were detected by agarose gel electrophoresis and imaged for analysis.

[0115] (3) Take 1 μL RPA product in step (2) and add it to the CRISPR / Cas12a cleavage reaction system. The preparation of the cleavage system, reaction procedure and detection steps refer to Example 2-4.

[0116] 2. Experimental results.

[0117] like Figure 7 , Figure 8 As shown, only the Chinese pangolin DNA can amplify the product fragment of the expected size, and no target product fragment was found in the DNA of other animals. In the fluorescence signal detection, only the corresponding system of the Chinese pangolin showed a fluorescent signal, while the others showed no fluorescence, indicating that the RPA-CRISPR / Cas12a detection system of the Chinese pangolin has good specificity.

[0118] The technical features of the above-described embodiments may be arbitrarily combined. To make the description concise, not all possible combinations of the technical features in the above-described embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0119] The above-mentioned embodiments only express several implementation methods of the present invention, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the invention patent. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims.

Claims

1. A primer set for identifying Chinese pangolin, characterized in that: It includes an RPA primer set, a Cas enzyme complex and a ssDNA probe, wherein the Cas enzyme complex includes crRNA; the Cas enzyme in the Cas enzyme complex is LbCas12a; The RPA primer set is used to amplify a target sequence, the target sequence is selected from the Cytb gene, and the crRNA is used to identify the Cytb gene; The RPA primer set is shown in SEQ ID NO.1 and SEQ ID NO.2; the crRNA is shown in SEQ ID NO.3; and the sequence of the ssDNA probe is shown in TTATT.

2. A detection system for identifying Chinese pangolins, characterized in that: It comprises an RPA isothermal amplification reaction system and a CRISPR / Cas detection reaction system, wherein the RPA isothermal amplification reaction system comprises the RPA primer set according to claim 1, and the CRISPR / Cas detection reaction system comprises the Cas enzyme complex and ssDNA probe according to claim 1.

3. The detection system according to claim 2, characterized in that: The 5' end of the ssDNA probe is connected to a fluorescent group, and the 3' end of the ssDNA probe is connected to a quenching group.

4. The detection system according to any one of claims 2-3, characterized in that: The working concentration of the RPA primer set is 0.3-0.5 μM.

5. A kit for identifying Chinese pangolins, characterized in that: The method comprises the primer set according to claim 1, or comprises the detection system according to any one of claims 2 to 4.

6. The kit according to claim 5, characterized in that The kit also includes a positive control substance and a negative control substance, and the positive control substance includes a Cytb gene sequence fragment.

7. A method for identifying Chinese pangolins, characterized in that: The following steps are involved: Extract the nucleic acid of the sample to be tested, and use the kit described in any one of claims 5-6 for detection.

8. Use of the primer set of claim 1, the detection system of any one of claims 2 to 4, or the kit of any one of claims 5 to 6 in the preparation of a product for identifying Chinese pangolins.

Images