A shki1 gene mutation site for detecting alpha-tocopherol content in sweet corn kernels and its application

Abstract

The invention discloses a shki1 gene variation site for detecting the alpha-tocopherol content of sweet corn kernels and its application, and includes the following two InDel sites: 1) InDel site at position 6672723-6672725 of chromosome 2 of the sweet corn genome, with a polymorphism of AGC / ; 2) InDel site at position 6672770-6672773 of chromosome 2 of the sweet corn genome, with a polymorphism of GGAG / ; the site is located at two linked InDel positions of the 5'UTR region of the corn gene shki1, and the site is related to the alpha-tocopherol content. The present invention utilizes association analysis technology to newly excavate and identify sequence variation sites and related genes related to control alpha-tocopherol in sweet corn kernels, and develops corresponding detection methods, supplementing and enriching genetic sites for molecular identification of alpha-tocopherol content in sweet corn kernels.

Description

Technical Field

[0001] The invention belongs to the field of genetic engineering, and in particular relates to a shki1 gene variation site for detecting the alpha-tocopherol content of sweet corn kernels and an application thereof. Background Art

[0002] Sweet corn is a fruit and vegetable crop and an important dietary source of micronutrients. Sweet corn kernels are rich in vitamin E, which is one of the ways for the human body to ingest tocopherols and tocotrienols. The structures of all vitamin E compounds differ only in the position and number of methyl substituents on the 2,3-dihydrobenzofuran ring, but their biological activities vary greatly. Vitamin E includes 8 fat-soluble isomers (including tocopherols and tocotrienols), among which alpha-tocopherol has the highest vitamin E activity and is most important for human health. However, the alpha-tocopherol content in most crop seeds is low. It is particularly important to increase the content of alpha-tocopherol in sweet corn kernel tissues through genetic breeding.

[0003] Methods based on genomics and population genetics provide important opportunities for analyzing the genetic basis of tocopherol synthesis. The rich genetic variation of sweet corn populations provides favorable conditions for the utilization of key genes. It creates conditions for the targeted manipulation of the levels and types of tocopherols and tocotrienols in crops. In previous studies, linkage and association analyses of tocopherol content in corn kernels provided a lot of important information for the genetic regulation of tocopherol synthesis and metabolism. However, most of the major quantitative trait genetic loci affecting tocopherol composition usually point to VTE4, that is, VTE4 is the key locus for vitamin E synthesis in corn. There are fewer studies on other loci, and even fewer loci that can be used for molecular marker-assisted selection. The results showed that sweet corn and Arabidopsis have similar tocopherol and tocotrienol biosynthesis pathways. Therefore, drawing on the research results in Arabidopsis, the researchers preliminarily analyzed the vitamin E synthesis pathway and related genes in corn. According to previous reports, sequence variations in VTE4 explain part of the phenotypic variation of alpha-tocopherol, and VTE1 and hggt1 are involved in the genetic regulation of tocotrienols in sweet corn kernels. Two molecular markers, InDel7 and InDel118, in the promoter and 5'UTR regions of VTE4 have been used to screen for high alpha-tocopherol content in sweet corn breeding programs. However, other genes / locus for high alpha-tocopherol content screening, except VTE4, are rarely used. Therefore, it is urgent to elucidate the genetic regulation characteristics of vitamin E content in maize kernels, especially alpha-tocopherol.

[0004] Currently, there are few molecular markers for predicting the alpha-tocopherol content in sweet corn through genetic markers. There is a rich genetic variation in the alpha-tocopherol content between different sweet corn germplasms. With the reduction in the price of whole genome sequencing, it is possible to obtain effective alpha-tocopherol-related genetic markers using population genetics analysis methods (association analysis, linkage analysis, etc.). In the patent "Nucleotide sequence for regulating corn tocopherol synthesis and its application", the inventor identified a gene ZmPOR1 that controls tocopherol content on chromosome 1 of the corn genome, and designed a molecular marker for screening corn tocopherol content. However, due to the limitation of sweet corn germplasm resources, this molecular marker is not applicable to sweet corn.

[0005] SNP and InDel markers in the corn genome basically evenly cover the entire genome with high density. SNP or InDel markers that are close enough to functional variations can be identified, and the markers can be prevented from becoming invalid due to recombination and other reasons. For the detection of SNP and InDel, KASP detection technology has the advantages of simple operation, low cost, short cycle, etc., and is very suitable as a technical means for molecular marker typing. Through association analysis, a genetic variation site significantly correlated with alpha-tocopherol content in the sweet corn genome was excavated. And the corresponding KASP molecular detection marker was developed. Based on this, the present invention is based on the development of molecular markers for detecting the alpha-tocopherol content in sweet corn kernels based on whole genome association analysis and KASP technology, which is of great significance for the genetic improvement of vitamin E in sweet corn. Therefore, a shki1 gene variation site for detecting the alpha-tocopherol content in sweet corn kernels and its application are needed. Summary of the invention

[0006] The purpose of the present invention is to provide a shki1 gene for detecting the alpha-tocopherol content of sweet corn kernels.

[0007] The present invention is achieved through the following technical solutions:

[0008] The sweet corn genome is genome B73, v5 version, and the application of the InDel site upstream of the shki1 gene on chromosome 2 of the sweet corn genome includes the following InDel sites:

[0009] 1) The InDel site at position 6672723-6672725 of chromosome 2 of the sweet corn genome has a polymorphism of AGC / -;

[0010] 2) The InDel site at position 6672770-6672773 of chromosome 2 of the sweet corn genome has a polymorphism of GGAG / -;

[0011] The site is located at two linked InDel positions in the 5'UTR region of the maize gene shki1 and is associated with the expression of the shki1 gene.

[0012] Furthermore, when the InDel site sequence is included, the shikimate kinase gene related to the alpha-tocopherol content of the sweet corn kernels is highly expressed, which is identified as a high alpha-tocopherol content in the sweet corn kernels; when the InDel site sequence is missing, the shikimate kinase gene related to the alpha-tocopherol content of the sweet corn kernels is low expressed, which is identified as a low alpha-tocopherol content in the sweet corn kernels.

[0013] In another aspect, a method for screening sweet corn with high alpha-tocopherol content comprises the following steps:

[0014] The genotypes of the InDel sites located at positions 6672723-6672725 and 6672770-6672773 of chromosome 2 of the sweet corn genome were identified, and sweet corn with the insertion sequence genotype was selected for molecular assisted breeding to achieve the breeding of sweet corn with high alpha-tocopherol content.

[0015] Compared with the prior art, the present invention adopts the above technical solution, and the biggest feature is:

[0016] The present invention utilizes association analysis technology to newly mine and identify InDel sites and related shki1 genes controlling alpha-tocopherol in sweet corn kernels, supplementing and enriching genetic sites for molecular identification of alpha-tocopherol content in sweet corn kernels.

[0017] The invention develops corresponding Sanger sequencing molecular markers based on two sequence variation sites in the 5'UTR region of the shikimate kinase (shki1) gene, which can quickly perform genotyping on sweet corn and are suitable for high-throughput detection. This site will greatly promote the future biofortification breeding of sweet corn with high alpha-tocopherol content. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 Association analysis and gene editing were used to locate and verify the shki1 gene;

[0019] in Figure 1 (a) is the correlation analysis of alpha-tocopherol content; Figure 1 (b) is the sequence variation of the candidate gene shki1; Figure 1 (c) is the result of gene editing experiment;

[0020] Figure 2 Comparison chart of correlation analysis between gene shki1 expression and alpha-content;

[0021] Figure 3 Comparison diagram of different alleles at the InDel4 locus in sweet corn materials;

[0022] in Figure 3 (a) is a comparison of the expression levels of the shki1 gene between different alleles at the InDel4 site; Figure 3 (b) is a comparison of alpha-tocopherol content between different alleles of the InDel4 locus; Figure 3 (c) is a comparison of the total vitamin E content in sweet corn kernels between different alleles of the InDel4 locus.

[0023] Figure 4 The alpha-tocopherol content is significantly different between the shki1 knockout sweet corn materials and the wild materials;

[0024] in Figure 4 (af) are comparison diagrams showing significant differences in the contents of alpha-tocopherol, beta-tocopherol, delta-tocotrienol, gamma-tocotrienol, gamma-tocopherol and total vitamin E between the shki1 knockout sweet corn materials and the wild materials.

[0025] Figure 5 Sanger sequencing was used to identify the alleles at the InDel3 and InDel4 sites. DETAILED DESCRIPTION

[0026] The technical scheme of the present invention is further described below in conjunction with embodiments and comparative examples, but they should not be construed as limiting the present invention:

[0027] The objective of the present invention is achieved through the following technical solutions:

[0028] Example 1 Mining and analysis of alpha-tocopherol related gene shki1

[0029] 1. Sweet corn association analysis population

[0030] 295 sweet corn inbred line materials were selected from widely representative inbred line materials collected from the main sweet corn growing areas in the world (including China, the United States, Thailand, Japan, Argentina, etc.) to form a sweet corn association analysis population. Leaf tissues were collected at the seedling stage, and whole genome resequencing was performed on the llumina Hiseq 2500 platform after genomic DNA extraction, library construction and other steps. The average sequencing depth was 11X, and about 9.86 million high-quality SNP data sets were identified on the entire genome. Secondly, the grain tissues of the sweet corn materials in the population were sampled 15 days after pollination, and a transcriptome sequencing library with an insert size of 300-500bp was constructed. Transcriptome sequencing was performed using 150bp double-end paired RNA sequencing technology, and transcriptome sequencing of the whole grain tissue was performed on the llumina Hiseq 2500 sequencing platform, generating a total of 31.27 million read bases. After bioinformatics analysis, the expression data of each gene in each material in the sweet corn population were obtained. Thus, the expression results of the grain tissue in the sweet corn population were completed.

[0031] In 2019, 295 sweet corn lines were planted at the Field Experiment Station of Guangdong Academy of Agricultural Sciences (E113°224, N23°093) with a planting pattern of about 12 plants per row. The experiment adopted a randomized block design, with 3 replicates for each inbred line. All sweet corn lines in each plot were self-pollinated, and pollination data were recorded. 20 days after pollination, an appropriate amount of grains were harvested from 3 plants in each row. Immediately after harvesting, the grains were frozen in liquid nitrogen until transferred to a -80°C refrigerator for storage.

[0032] 2. Determination of alpha-tocopherol

[0033] Vitamin E extraction: Sweet corn kernels were precooled with liquid nitrogen and then ball-milled for 60 seconds at 30 Hz using a mill (MM400; Retsch). 2 g of fresh sweet corn flour was accurately weighed in a frozen state. The sample was saponified with 2 mL of ethanol (95%). Antioxidants (1 mL of sodium chloride, 176 mg / mL; 4 mL of pyrogallol ethanol, 63.055 g / L; 1 mL of ascorbic acid, 176 mg / mL) and 2 mL of potassium hydroxide (600 g / L) were then added and mixed using a vortex mixer. The mixture was then extracted with n-hexane / ethyl acetate (9:1, v / v). The liquid phase of the organic layer was collected and concentrated to dryness using a concentrator under nitrogen. The residue was dissolved in 1% isopropanol in n-hexane for HPLC analysis.

[0034] Quantitative detection of vitamin E: The quantitative detection of vitamin E adopts normal phase high performance liquid chromatography (NP-HPLC) method. The NP-HPLC system includes a Waters 515 high performance liquid chromatography pump and a Waters 2475 multi-λ fluorescence detector. The chromatographic column is Agilent (ZORBAX RX-SIL, 250mm×4.6mm), and the flow rate is 1mL / min. The mobile phase is 0.85% n-hexane-2-propanol, and 20μL is injected. The excitation wavelengths of the detection are 290nm and 330nm. The content of each vitamin E component is calculated using a standard curve constructed using 8 external standards.

[0035] 3. Sweet corn population SNP profile and expression level identification

[0036] Leaf tissues were collected at the seedling stage, and after genomic DNA extraction and library construction, whole genome resequencing was performed on the llumina Hiseq2500 platform. The average sequencing depth was 11×, and about 9.86 million high-quality SNP maps were identified on the entire genome. Secondly, the grain tissues were sampled 15 days after pollination, and a transcriptome sequencing library with an insert size of 300-500bp was constructed. The transcriptome sequencing of the whole grain tissue was performed on the llumina Hiseq 2500 sequencing platform using 150bp double-end paired RNA sequencing technology, and a total of 31.27 million read bases were generated. Thus, the expression results of genes in the grain tissue of each individual in the sweet corn population were completed.

[0037] 4. Genome-wide association analysis of alpha-tocopherol

[0038] Association analysis was performed using ultra-high density molecular markers (SNPs, 9.86 million), and mixed linear models were used to perform association analysis on alpha-tocopherol content, identifying genetic loci controlling alpha-tocopherol. A genome-wide single nucleotide polymorphism (SNP) association analysis of alpha-tocopherol phenotypic traits was performed using a mixed linear model (MLM, controlling for population structure and kinship). The number of effective SNPs in the whole genome was estimated using the GEC (Genetic Type I error calculator) software with default parameters. P-value = 1 / n was used as the significance threshold for genome-wide association analysis (n, the number of effective SNPs in the whole genome).

[0039] Through genome-wide association analysis of alpha-tocopherol content, a VE synthesis pathway upstream gene shki 1 (gene ID: Zm00001 eb069000, chr2: 6672361-6675839; reference genome version: B73 V5) was identified on chromosome 2. Two linked InDel (InDel3 and InDel4) sites in the 5'UTR region of this gene are related to the expression of shki 1, and the expression of shki 1 is significantly positively correlated with the alpha-tocopherol content. InDel3 and InDel4 can significantly affect the content of alpha-tocopherol. Through gene editing experiments, shki 1 was knocked out in maize inbred lines, and the results showed that the alpha-tocopherol content in the knockout line was significantly lower than that in the wild-type material. This proves that shki 1 can regulate the content of alpha-tocopherol in sweet corn kernels by regulating the expression level. The two selected InDel sites (InDel3 and InDel4) can regulate the expression of shki 1 and thus the alpha-tocopherol content. By developing molecular markers that can quickly detect InDel3 and InDel4, the alpha-tocopherol content in sweet corn kernels can be quickly predicted. The specific information of InDel3 and InDel4 is as follows:

[0040] Table 1 High alpha-tocopherol molecular sites associated with the shikimate kinase (shki1) gene

[0041] serial number name chromosome Location InDel Favorable allele 1 InDel3 2 6672723-6672725 AGC / - AGC 2 InDel4 2 6672770-6672773 GGAG / - GGAG

[0042] Table 2 Results of gene-based association analysis of alpha-tocopherol

[0043]

[0044] aCandidate genes are genes that are target genes in gene-based association analysis and reach a significant level.

[0045] The chromosome information of the b gene was determined by referring to the V5 sequence of the corn B73 reference genome.

[0046] c Genome sites that are significantly associated with phenotypes, including SNP and InDel sites.

[0047] d The proportion of phenotypic variation explained by the variant site was calculated using Tassel V3.0 software.

[0048] Example 2 Gene editing verification of the effect of gene shki1 on alpha-tocopherol content

[0049] To verify the function of gene shki1 on alpha-tocopherol content, the exon region of shki1 gene was edited using gene editing technology to obtain the homozygous knockout line of this gene. Two sgRNAs were designed in the first exon region of gene shki1, and this region was edited using CRISPR-cas9 editing system. The gene editing experiment was completed by Weimi Biotechnology Co., Ltd. Using the same vitamin E determination method, the content of various vitamin E components including alpha-tocopherol in the grain tissues of the knockout line and wild line was determined.

[0050] The knockout line of the shki1 gene was obtained by CRISPR-cas9 editing technology, which produced a large sequence deletion in the first exon region of the gene, thereby causing the gene to lose its function ( Figure 1 ). This verifies the function of the gene in the wild-type material. The content of vitamin E components in the shki1 knockout line was identified, and a total of 6 vitamin E components were identified. The content of these 6 vitamin E components was significantly different between the knockout line and the wild-type line ( Figure 4 ; P<0.05). The content of alpha-tocopherol was significantly reduced in the knockout line, which was consistent with the results in the population, that is, shki1 affected the content of alpha-tocopherol through its expression level, and the expression level of shkil was positively correlated with the content of alpha-tocopherol. Based on this, the content of alpha-tocopherol can be increased by screening the shkil high expression allele in the sweet corn population.

[0051] Example 3 Molecular marker development

[0052] 1. Development of Sanger sequencing molecular markers

[0053] Targeting the InDel3 and InDel4 variant sites in the alpha-tocopherol-related shikimate kinase region, screening markers based on PCR and Sanger sequencing were developed for screening favorable allele genetic sites with high alpha-tocopherol content. A PCR primer covering the InDel3 and InDel4 regions was designed, and the specific alleles of InDel3 and InDel4 can be accurately identified using first-generation sequencing. The design of the above marker primers was completed using the NCBI-BLAST program.

[0054] Sanger sequencing marker primer information:

[0055] SEQ ID NO.1:ATAAAACGCCCGCAAACCAC

[0056] SEQ ID NO.2: GATTTTGGCGTTGTGCCCAT

[0057] 2. Sanger sequencing molecular marker detection method

[0058] Utilize the above primers, and take the sweet corn material DNA to be tested as template for PCR amplification. The amplified product is determined whether the PCR amplification is successful by agarose gel electrophoresis, and the fragment size of the amplified product is checked. The PCR amplified product that meets the experimental expectation is sequenced by Sanger sequencing technology, and the sequenced sequence is compared with the InDel3 and InDel4 position sequence, so that the allele information of the InDel3 and InDel4 sites can be accurately identified. Since the InDel3 and InDel4 sites are completely linked, when the sweet corn material DNA sequence contains the favorable alleles of InDel3 and InDel4, that is, when it contains the sequences AGC and GGAG, the test material shows a high alpha-tocopherol content, and when the sweet corn material DNA sequence does not contain the favorable alleles of InDel3 and InDel4, the test material shows a low alpha-tocopherol content. Thereby completing the typing analysis of the sample, obtaining the genotype information of the sweet corn material, and then screening the alpha-tocopherol content at the gene level.

[0059] The PCR amplification reaction system is shown in Table 3 (96-well ordinary PCR plate, 33 μL reaction system). The PCR amplification reaction program is shown in Table 4.

[0060] Table 3 PCR reaction system

[0061] Element volume DNA 2μL (20ng / μL) 2×Tagmix 15μL Primer(F+R) 4μL <![CDATA[ddH2O]]> 9μL DMSO 3μL Total 33μL

[0062] Table 4 PCR amplification reaction program

[0063]

[0064] After PCR amplification, 1% agarose gel electrophoresis was used to detect the PCR amplification effect. The electrophoresis voltage was 160V, the electrophoresis time was 15 minutes, and the nucleic acid color dye used was GoldView. The reaction products of normal PCR amplification were sequenced by Sanger method to detect the genotypes of InDel3 and InDel4 ( Figure 5 The KASP primers developed by the present invention are highly flexible and can quickly complete the detection of a small amount or a large amount of sweet corn material genotypes, and can quickly screen sweet corn materials with high alpha-tocopherol content. Figure 5 As shown in the figure, the genotyping results of the Sanger sequencing markers are completely consistent with the high-throughput sequencing results. It has high stability and universality. The application of this molecular marker in the improvement of sweet corn alpha-tocopherol will play an important role in promoting the high-quality breeding of sweet corn.

[0065] The above description is only a preferred specific implementation manner of the present invention, but the protection scope of the present invention is not limited thereto. Any technician familiar with the technical field can make equivalent replacements or changes according to the technical scheme and inventive concept of the present invention within the technical scope disclosed by the present invention, which are all covered by the protection scope of the present invention.

Claims

1. A method for screening sweet corn with high alpha-tocopherol content, characterized in that: The following steps are involved: The genotypes of the InDel sites at positions 6672723-6672725 and 6672770-6672773 of chromosome 2 of the sweet corn genome are identified, and sweet corns with the inserted sequence genotype are selected for molecular assisted breeding to achieve the breeding of sweet corns with high alpha-tocopherol content. When the polymorphism of the InDel site at positions 6672723-6672725 of chromosome 2 of the sweet corn genome is "AGC", the gene shki1 is highly expressed, and the sweet corn kernels are identified as having high alpha-tocopherol content; when the InDel sequence polymorphism at positions 6672723-6672725 of chromosome 2 of the sweet corn genome is "-", the gene shki1 is lowly expressed, and the sweet corn kernels are identified as having low alpha-tocopherol content; When the polymorphism of the InDel site at position 6672770-6672773 of chromosome 2 of the sweet corn genome is "GGAG", the gene shki1 is highly expressed, which is identified as a high alpha-tocopherol content in the sweet corn kernels; when the InDel sequence polymorphism at position 6672770-6672773 of chromosome 2 of the sweet corn genome is "-", the gene shki1 is lowly expressed, which is identified as a low alpha-tocopherol content in the sweet corn kernels.

Images