Single cell 4C library construction and detection methods

Abstract

The present invention provides a method for constructing a single-cell 4C library, which includes the steps of cross-linking DNA in a multi-cell sample, enzyme-cutting DNA, reconnecting DNA, isolating single cells, decrosslinking, linearly amplifying reconnected fragments, adding single-link adapters, and library amplification. The method of the present invention can be used to realize the construction and detection of a 4C library at the single-cell level.

Description

Technical Field

[0001] The invention relates to a 4C library construction method and a detection method, and belongs to the technical field of gene sequencing. Background Art

[0002] Chromatin conformation capture (3C) mainly studies the interaction between two specific chromatin regions and is the basis of three-dimensional genomics. However, a chromatin region often interacts with multiple other chromatin regions. Studying only the interaction between two chromatin regions cannot obtain a complete picture of the three-dimensional regulation of a specific chromatin region. In order to study the interaction between a specific chromatin region and all other chromatin regions, 4C technology was derived.

[0003] 4C (Circular chromosome conformation capture) mainly studies the interaction between a specific chromatin region and all other interacting chromatin regions. 4C designs double restriction sites based on 3C, and through the form of a loop, only one pair of primers needs to be designed to detect the interaction of one site with multiple sites, thereby obtaining a three-dimensional conformational map of the interaction between this site and the entire genome.

[0004] In recent years, single-cell sequencing technology has become a commonly used method in biological and medical research. Sometimes, the heterogeneity of single cells will be overwhelmed in the study of a large number of samples. Single-cell sequencing can solve this problem by labeling the DNA / RNA of individual cells, allowing the research to reach the resolution of single cells, which is more accurate and in-depth. However, due to the low efficiency of the 4C circularization step and the extremely high requirements for the starting amount of samples (usually more than 10 million cells), it is impossible to process the trace DNA of single cells, so there are currently no reports of single-cell 4C. At the same time, due to the limited single-cell DNA, it is impossible to reduce the impact of false positives of traditional 4C through quantitative effects, so it is not feasible to directly use traditional 4C methods for single-cell operations.

[0005] Circularization is a key step in 4C technology. However, there are still many problems in the application of circularization in the construction of existing 4C libraries. For example, the efficiency of circularized DNA is usually very low, and higher requirements are placed on the sample amount in order to obtain products sufficient for sequencing, which has become a direct obstacle to the application of 4C technology at the single-cell level. In addition, the DNA ligase commonly used in circularization will cause misconnections between different DNA fragments, and these misconnections will produce false interaction data. In addition, the circularization reaction may also lead to some unpredictable non-specific PCR products, generating redundant data during sequencing, reducing the proportion of valid data. This causes single-cell technology, which already has limited data output, to face the challenge of effective data rate. That is, even if the existing technology can successfully construct a single-cell 4C library, it will still face the problem of insufficient effective data. In addition, the circularization technology itself has the problems of complex operation, long time consumption and unstable reduction efficiency. Summary of the invention

[0006] In view of the above-mentioned deficiencies in the prior art, the object of the present invention is to provide a single-cell 4C library construction method and detection method (library construction method and detection method of the present invention).

[0007] The present invention has conducted in-depth research to solve the above problems, and found that: by improving the 4C technology, linearly amplifying the DNA fragments reconnected with the selected region, marking the cell barcode at the same time, and then mixing the DNA of multiple single cells to add single-linked adapters to reduce the loss of trace DNA fragments containing the selected region, so that each step can be operated at a trace level, and a 4C library can be obtained without circularization, thereby completing the present invention. By adopting the single-cell 4C library construction method of the present invention, the construction and detection of the chromosome conformation library of DNA fragments interacting with the selected region at single-cell resolution can be achieved.

[0008] In addition, the library construction method of the present invention further performs 5' phosphorylation-specific exonuclease digestion on the linear amplification product connected to the single-stranded adapter to digest the nonlinear amplification product, which can effectively reduce background noise and improve the effective data rate.

[0009] That is, the present invention includes,

[0010] 1. A method for constructing a single cell 4C library, comprising:

[0011] Obtain multi-cell samples,

[0012] Cross-linking of DNA and proteins in multi-cell samples,

[0013] Use restriction endonucleases to cut DNA.

[0014] Rejoining DNA fragments,

[0015] Isolate single cells and treat each cell individually.

[0016] Uncrosslinked and reconnected DNA fragments,

[0017] A single primer with a cell barcode is used to amplify the reconnected DNA fragment, wherein the primer has a selected region sequence, and the amplification is linear amplification.

[0018] Combine multiple separately processed amplification reactions.

[0019] Single-stranded linkers were added to the linear amplification products, and library primer pairs were used to perform library amplification on the products with single-stranded linkers to obtain a single-cell 4C library.

[0020] 2. According to the single-cell 4C library construction method described in item 1, the restriction endonuclease is a four-base enzyme or a six-base enzyme.

[0021] 3. According to the single-cell 4C library construction method described in item 2, the restriction endonuclease is HindIII enzyme.

[0022] 4. According to the single-cell 4C library construction method described in item 1, the DNA fragments are fragmented after the linear amplification step.

[0023] 5. According to the single-cell 4C library construction method described in item 4, the enzyme used for fragmentation is DNase I.

[0024] 6. According to the single cell 4C library construction method described in item 4, the DNA fragmentation products are subjected to 5' phosphorylation exonuclease digestion treatment.

[0025] 7. According to the single-cell 4C library construction method described in item 4, the fragmented reconnected DNA fragments are not subjected to end repair and / or A addition treatment.

[0026] 8. According to the single cell 4C library construction method described in item 1, the linear amplification product is digested with 5' phosphorylated exonuclease.

[0027] 9. According to the single-cell 4C library construction method described in item 1, no purification is performed after the linear amplification step.

[0028] 10. According to the single-cell 4C library construction method described in item 1, the reconnected DNA fragments are not subjected to end repair and / or A addition treatment.

[0029] 11. According to the single-cell 4C library construction method of item 1, the single primers from 5' to 3' end are read1, cell barcode, and selected region primer sequence respectively.

[0030] 12. According to the single cell 4C library construction method of item 11, the single primer is SEQ ID NO: 1: 5'-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-NNNNNN NNNNNN-selected region primer sequence-3'.

[0031] 13. According to the single-cell 4C library construction method of item 1, the sequence of the single-chain linker is SEQ ID NO: 2: 5'-ATCTCGTATGCCGTCTTCTGCTTG-3'.

[0032] 14. A single-cell 4C library detection method, which comprises sequencing a library obtained by the single-cell 4C library construction method described in any one of items 1 to 13.

[0033] 15. According to the single-cell 4C library construction method described in Item 9, the sequencing is single-end sequencing.

[0034] According to one aspect of the present invention, a method for constructing a single-cell 4C library is provided, the method comprising: obtaining a multi-cell sample; cross-linking DNA and protein in the multi-cell sample; cutting DNA with a restriction endonuclease; reconnecting DNA fragments; isolating single cells and treating each single cell individually; decrosslinking the reconnected DNA fragments; amplifying the reconnected DNA fragments with a single primer with a cell barcode, the primer having a selected region sequence, and the amplification is linear amplification; combining multiple individually treated amplification reaction systems; adding a single-linked linker to the amplified product; and performing library amplification on the product with the single-linked linker using a library primer pair.

[0035] In the above-mentioned single cell 4C library construction method, the cross-linking step is to cross-link the DNA and protein in the sample cells to obtain a cross-linked body. The cross-linked body can maintain the physical interaction between the DNA fragments and the related proteins. The cross-linking reagent that can be used is, for example, formaldehyde.

[0036] In the present invention, the initial amount of sample cells can be as low as about 10,000-1 million, preferably the initial amount of cells can be less than about 100,000-500,000. The initial amount of sample cells that can usually be detected by 4C technology is about 20 million.

[0037] In the above single cell 4C library construction method, the enzyme cleavage step is to use a restriction endonuclease to cut the DNA in the cross-linked body to obtain cross-linked DNA fragments. In the present invention, the restriction endonuclease refers to a sequence-specific nuclease.

[0038] In the above-mentioned single-cell 4C library construction method, the step of reconnecting DNA fragments refers to rebinding the DNA fragments that have been cleaved by enzymes. The DNA fragments that have been cleaved by enzymes are fixed by proteins through cross-linking, and these DNA fragments that are adjacent in three-dimensional space are combined with a high probability, that is, the fragments containing the selected region and the DNA fragments that may have an interaction relationship with it are reconnected, so that it is possible to detect which fragments have an interaction relationship with the selected region.

[0039] In the present invention, the selected region refers to a specific DNA region targeted for research, such as a gene coding region, a gene regulatory region, etc. The selected region is a DNA fragment containing a selected region sequence. The DNA fragment interacting with the selected region refers to a DNA fragment adjacent to the selected region in the chromatin spatial distribution. For example, the distal promoter, enhancer or silencer of the selected region coding gene, the coding gene enhanced by the enhancer, the coding gene silenced by the silencer, the coding gene activated by the promoter, and the gene element or regulatory element located in the same topological heterogeneous domain of the selected region. The step of separating single cells is to separate single cells from a large number of sample cells, so that the operation of the subsequent steps can process each single cell separately. Methods such as flow cytometer sorting, capillary aspiration under a microscope, gradient dilution or direct dilution are usually used. For example, a single sample cell is aspirated using a capillary under a microscope and placed in a multi-well plate at a density of 1 cell per well.

[0040] In the above-mentioned single-cell 4C library construction method, the cross-linking removal step is to remove the cross-linking between the reconnected DNA fragments and the protein to release the reconnected DNA fragments, that is, the DNA fragments obtained by reconnecting the fragments of the selected region and the DNA fragments that may have an interactive relationship with the selected region, that is, the reconnected DNA fragments. The cross-linking removal can be performed using a reagent containing proteinase K. In the present invention, the cross-linking removal step includes a heating step, which can rupture the cell membrane of the single cell, thereby releasing the DNA fragments in the cell.

[0041] In the above-mentioned single-cell 4C library construction method, a single primer is used in the step of linear amplification of the reconnected fragments. The primer carries the sequence of the selected region and the cell barcode. The cell barcode is used to mark a single cell, usually a sequence of 10-20 random bases. The primer also includes a nucleotide sequence used to read the sequence to be tested during the first round of sequencing, for example, it can be read1 provided by the Illumina sequencing platform, which is usually used as the starting point of DNA synthesis in the first round of sequencing when sequencing on the Illumina sequencing platform, that is, the starting point of sequencing detection. Combine multiple individually processed single-cell linear amplification reaction systems. Among them, each individually processed amplification reaction system processes a single cell after membrane rupture. The cell membrane of the single cell ruptures during the cross-linking process.

[0042] In the above-mentioned single-cell 4C library construction method, adding a single-stranded adapter to the linear amplification product refers to adding a single-stranded adapter to the single-stranded DNA obtained by linear amplification. The sequencing adapter includes a sequence used to bind the library DNA to the sequencing chip during sequencing, for example, it can be P7 provided by the Illumina sequencing platform, which is usually used to bind to the corresponding reverse complementary sequence on the sequencing chip during sequencing on the Illumina sequencing platform to fix the DNA and serve as the starting point for bridge PCR to generate DNA clusters.

[0043] In the above-mentioned single-cell 4C library construction method, library primer pairs are used to perform library amplification on the products with single-stranded adapters.

[0044] In the present invention, library amplification refers to amplifying the fragment to be tested by library primers to obtain a DNA library that can be used for sequencing by a sequencer. The reagents used for library amplification can be selected from one or more of DNA polymerase, primers and buffer systems.

[0045] In the present invention, the library primer pair is a pair of primers used for amplifying a DNA fragment library, and the primer pair carries different sequence library structure sequences used to bind the library DNA to the sequencing chip during sequencing, such as P5, P7, index sequences, etc. provided by the Illumina sequencing platform.

[0046] Furthermore, in the above-mentioned library construction method, the DNA fragments are subjected to fragmentation treatment after the step of combining multiple separately processed amplification reaction systems. In library construction, fragmentation generally refers to fragmenting longer DNA fragments into library insert fragments of a length suitable for a sequencer by methods such as enzyme digestion, preferably fragmenting into an average fragment length of 200-900 bp, more preferably fragmenting into an average fragment length of 300-800 bp, and most preferably fragmenting into an average fragment length of 400-700 bp. Fragmentation can be performed by methods such as non-restriction endonuclease digestion.

[0047] In the present invention, it is not necessary to perform end repair and / or A addition treatment on the fragmented DNA fragments, such as the fragmented reconnected DNA fragments. That is, it is not necessary to perform end repair and / or A addition treatment on the DNA fragments obtained in the previous step before adding the linker.

[0048] Furthermore, in the above library construction method, the linear amplification product is digested with 5' phosphorylation exonuclease. In the present invention, the nonlinear amplification fragment is digested with 5' phosphorylation exonuclease to effectively remove impurity fragments and increase the proportion of target fragments.

[0049] Furthermore, in the above-mentioned library construction method, no purification is performed after the linear amplification step. After the amplification step, the reagent reaction system of the amplification step may affect the reaction of the next step such as end repair and A addition. Therefore, it is usually necessary to purify the amplified product. However, the present invention does not perform such an operation.

[0050] Furthermore, in the above library construction method, the single primers from 5' to 3' end are read1, cell barcode, and selected region primer sequences respectively.

[0051] In the present invention, cell barcode refers to a marker used to distinguish individual cells, which can identify and track individual cells by introducing a unique DNA sequence marker. The cell barcode is directly connected to the selected region primer sequence.

[0052] In the present invention, read1 is set at the 5' end of a single primer sequence.

[0053] Furthermore, in the above library construction method, the single primer is the nucleotide sequence shown in SEQ ID NO: 1.

[0054] SEQ ID NO: 1: 5'-TCGTCGGCAGCGTCAGATGTGTATAAGAGACA G-NNNNNNNNNNNNNN-selected region primer sequence-3'.

[0055] In the above single cell library construction method, a cell barcode is added to the library linker, such as a nucleotide sequence consisting of multiple Ns in SEQ ID NO: 1, to mark the single cell so as to distinguish different single cells during data analysis. The cell barcode can be a nucleotide sequence of about 10-20 bp.

[0056] Furthermore, in the above library construction method, the single-stranded linker is the nucleotide sequence shown in SEQ ID NO:2.

[0057] SEQ ID NO: 2: 5'-ATCTCGTATGCCGTCTTCTGCTTG-3'.

[0058] In the present invention, the restriction endonuclease that can be used is a four-base restriction endonuclease or a six-base restriction endonuclease. Preferably, the restriction endonuclease is a four-base restriction endonuclease, such as HindIII, DpnII, NlaIII, etc., preferably HindIII.

[0059] Furthermore, in the above-mentioned library construction method, reagents such as DNA ligase, DNA ligase buffer, etc. can be used to connect the single-stranded adapters.

[0060] Furthermore, in the above-mentioned library construction method, library amplification can use PCR reagents such as NEB Q5 high-fidelity polymerase and KAPA HiFi Hot Start ReadyMix.

[0061] According to another aspect of the present invention, a single cell 4C library is also provided, which is obtained by the above library construction method.

[0062] According to another aspect of the present invention, a single-cell 4C library detection method is also provided, which comprises sequencing the library obtained by the single-cell 4C library construction method.

[0063] The method of the present invention linearly amplifies the cross-linked DNA sample at the single-cell level, marks the cell barcode for the DNA fragment reconnected with the selected region sequence, and then mixes the DNA of multiple single cells to add single-linked adapters and other multi-step optimizations, making it possible to construct a single-cell single-cell 4C library. However, the existing 4C technology cannot obtain data at the single-cell level. At the same time, compared with the existing 4C method, the method of the present invention is more convenient, has a short library construction time period, does not require cyclization, and has a high proportion of valid data. That is, compared with the prior art, the present invention realizes the construction and detection of a single-cell 4C library. BRIEF DESCRIPTION OF THE DRAWINGS

[0064] Figure 1 Schematic diagram of the library construction method of Example 1.

[0065] Figure 2 It is a multi-cell chromosome interaction map obtained by combining the single-cell 4C sequencing results of all cells in sample 1 of Example 1.

[0066] Figure 3 These are the five chromatin regions interacting with the selected region with the largest number of positive cells in Example 1 and their corresponding numbers of cells tested positive.

[0067] Specific embodiments of the invention Example

[0068] The present invention is further described in detail below in conjunction with the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are for explaining the present invention, not for limiting the present invention.

[0069] Example 1 A method for constructing a sequencing library for detecting chromosome conformation of a target region in a single cell

[0070] (I) Library construction

[0071] 1. Cross-linking DNA and proteins in multi-cell samples

[0072] Centrifuge 100,000 mouse embryonic stem cell lines (ESC) at 500G for 5 minutes, remove the supernatant, and resuspend the cells in the following solution:

[0073]

[0074] The mixture was shaken at room temperature for 10 minutes for cross-linking. The mixture was centrifuged at 3000 G for 5 minutes, the supernatant was removed, and the pellet was washed three times with 1 mL of PBS.

[0075] 2. Enzyme Digestion

[0076] Resuspend the pellet from the last wash in the following solution:

[0077]

[0078] Incubate at 37°C for 1 hour. Centrifuge at 3000G for 5 minutes, remove the supernatant, and wash the pellet three times with 1 mL of PBS.

[0079] 3. Reconnection

[0080] Resuspend the pellet from the last wash in the following solution:

[0081]

[0082]

[0083] Resuspend the nuclei and incubate at 20°C for 0.5 h. Centrifuge at 3000G for 5 min, remove the supernatant, and wash the pellet 3 times with PBS.

[0084] 4. Isolation of Single Cells

[0085] Single cells were picked up by capillary under microscope, and each single cell was transferred to a well of a 384-well PCR plate. A total of 2 plates and 768 cells were picked up. These 768 cells are collectively called sample 1.

[0086] 5. Decrosslinking

[0087] Add the following solution to each well:

[0088] NEB Thermolabile Proteinase K 0.5μL (final concentration 12U / mL)

[0089] Place the 384-well PCR plate on the corresponding PCR instrument and incubate at 37 degrees Celsius for 15 minutes, then incubate at 55 degrees Celsius for 10 minutes.

[0090] 6. Linear Amplification

[0091] Add the following solution to each well:

[0092]

[0093] Place the 384-well PCR plate on the PCR instrument and run the following reaction program:

[0094]

[0095] 7. Combine the products from the previous step and fragment

[0096] Collect the solutions from all wells into a 15 ml Falcon tube. Add the following solutions:

[0097] ThermoFisher DNase I, RNase-free (1U / μL) 7.68μL (1U / mL)

[0098] Vortex to mix. Incubate at 37 degrees Celsius for 5 minutes, add 384 μL 0.5M EDTA and mix to terminate the reaction. Purify DNA using 4 mL of AmpureXP beads and elute into 60 μL EB buffer.

[0099] 8. Phosphorylation exonuclease digestion

[0100] Add the following solution:

[0101]

[0102] Incubate at 37°C for 10 min and then at 75°C for 5 min to inactivate the enzyme.

[0103] 9. Add single link connector

[0104] Add the following solution:

[0105]

[0106] Place in PCR instrument and run the following program:

[0107]

[0108] 10. Library Amplification

[0109] Add the following solution:

[0110]

[0111]

[0112] Place in PCR instrument and run the following program:

[0113]

[0114] The library was screened and purified using 0.5x-0.8x AmpereXP beads to obtain a single cell 4C library.

[0115] Table 1:

[0116]

[0117] (II) Library sequencing strategy and analysis strategy

[0118] Miseq was used to perform single-end sequencing of the single-cell library with a read length of 100bp. A total of 18Mreads were measured. After the data was split off the machine, the different libraries split by Index 2 were data of different single cells. The residual Illumina library adapter sequence was first trimmed. In the measured read1 data, the first 12bp are the cell barcodes, and the reads are clustered into different cells according to different cell barcodes. If the sequencing data of 13-33bp is CCGCCAAGTTCACAAAGCTT, it is retained, otherwise the read is discarded. The data after 34bp are chromatin fragments that interact with the selected region. The data was analyzed using the peakC analysis package of R language.

[0119] 3. Statistics and analysis of sequencing data

[0120] In order to reflect the chromosome interaction in all cell sets of sample 1, the single-cell 4C sequencing library data of all cells were combined for 4C interaction analysis, and the results were obtained. Figure 2 The chromatin interaction map shown shows the distribution and intensity of chromatin regions that interact with the selected region across all cells.

[0121] Thanks to the fact that this method adds cell barcodes to each single cell for differentiation, this method can detect the heterogeneity of single cells in terms of chromatin regions interacting with the selected region. Given that each cell has only one positive chromatin region interacting with the selected region, the heterogeneity of cell chromatin interactions is counted here by counting the number of cells that are positive in different chromosome regions in terms of interacting with the selected region. The top five chromatin regions interacting with the selected region with the largest number of positive cells are shown in Figure 3 .

[0122] According to the above statistical data, it can be seen that the method of this embodiment can detect the chromatin regions of different cells that interact with the selected region and find the heterogeneity between each single cell. At the same time, the results of all cells are aggregated together to find the overall chromatin region that interacts with the selected region. However, there is no report on the single-cell 4C library in the prior art. It can be seen that the single-cell 4C library constructed by the present invention can realize single-cell 4C sequencing, and can effectively detect the heterogeneity of chromosome conformation in selected regions between single cells.

[0123] According to the present invention, other methods for studying single-cell nucleic acid sequencing can be used in combination to study cell characteristics or functions, and their relationship with chromatin conformation. These other methods for studying DNA, RNA, and protein include but are not limited to: single-cell RNA sequencing, single-cell DNA sequencing, single-cell ATAC sequencing, single-cell methylation sequencing, single-cell small RNA sequencing, single-cell CHIP-seq, single-cell CUT&RUN, single-cell CUT&Tag, and single-cell Ribo-seq.

[0124] It should also be noted that modifications and changes made by those skilled in the art that do not depart from the spirit and scope of the present invention should all be within the scope of protection of the claims attached to the present invention.

Claims

1. A method for constructing a single cell 4C library, comprising: Obtain multi-cell samples, Cross-linking of DNA and proteins in multi-cell samples, Use restriction endonucleases to cut DNA. Rejoining DNA fragments, Isolate single cells and treat each cell individually. Uncrosslinked and reconnected DNA fragments, A single primer with a cell barcode is used to amplify the reconnected DNA fragment, the single primer has a selected region sequence, the amplification is linear amplification, the single primer from 5' to 3' end is read1, cell barcode, selected region primer sequence, and the single primer does not include a 5' end phosphorylation mark, Combine multiple separately processed amplification reactions. The linear amplification product was fragmented and digested with 5' phosphorylated exonuclease, wherein the enzyme used for the fragmentation was DNase I, Add single-stranded adapters to the linear amplification products. The library primer pairs were used to amplify the products with single-stranded adapters to obtain the single-cell 4C library.

2. According to the single-cell 4C library construction method of claim 1, the restriction endonuclease is a four-base enzyme or a six-base enzyme.

3. According to the single-cell 4C library construction method of claim 1, the fragmented reconnected DNA fragments are not subjected to end repair and / or A addition treatment.

4. According to the single cell 4C library construction method of claim 1, no purification is performed after the linear amplification step.

5. A single-cell 4C library detection method, which sequences the library obtained by the single-cell 4C library construction method according to any one of claims 1 to 4.

6. According to the single-cell 4C library detection method of claim 5, the sequencing is single-end sequencing.

Images