Application of an rRNA-derived fragment in the preparation of a drug for treating atherosclerosis
By using rRNA-derived fragment rRF-36 as a biomarker and therapeutic agent, the diagnosis and treatment problems of atherosclerosis are solved, the regulation of the function of vascular smooth muscle cells is achieved, and its abnormal proliferation and migration is inhibited, providing a new therapeutic target.
Patent Information
- Application Number
- CN202410974626.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-07-19
- Publication Date
- 2025-08-12
- Estimated Expiration
- 2044-07-19
AI Technical Summary
In the prior art, the role of rRNA-derived fragments in cardiovascular disease is rarely studied, and there is a lack of effective methods for treating and diagnosing atherosclerosis.
The rRNA-derived fragment rRF-36 is used as a biomarker to diagnose atherosclerosis by quantitatively detecting its expression level, and to inhibit the abnormal proliferation and migration of vascular smooth muscle cells by overexpressing rRF-36, and prepare corresponding drugs, including kits and pharmaceutical compositions.
Effective diagnosis and treatment of atherosclerosis is achieved, and new therapeutic targets are provided by regulating the function of vascular smooth muscle cells and inhibiting their abnormal proliferation and migration.
Smart Images

Figure CN118813779B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biomedicine technology, and particularly relates to the use of an rRNA-derived fragment in the preparation of a drug for treating atherosclerosis. Background Art
[0002] Atherosclerosis is a major health hazard to humans and the primary pathological basis for cardiovascular and cerebrovascular diseases such as coronary heart disease, myocardial infarction, and stroke. Patients with atherosclerosis primarily experience the formation of plaques, calcification, and amyloidosis in the lumen of coronary and carotid arteries, leading to stenosis and roughened vessel walls, resulting in a variety of serious cardiovascular events.
[0003] The development and progression of atherosclerosis is associated with functional abnormalities and phenotypic transitions in smooth muscle cells. Abnormal smooth muscle cell proliferation leads to insufficient apoptosis, disrupting the balance between smooth muscle cell proliferation and apoptosis and accelerating the progression of atherosclerosis. Studies have shown that multiple molecules and signaling pathways are involved in regulating the phenotypic transition of vascular smooth muscle cells. Among them, non-coding RNAs such as lncRNAs, microRNAs, and miRNAs play a crucial role in the proliferation, migration, and phenotypic transition of vascular smooth muscle cells. In particular, rRNA-derived fragments (rRFs) have recently gained significant attention as a novel small non-coding RNA. They are small RNA fragments produced by the cleavage of mature, intact rRNA under specific conditions. rRFs have distinct biological functions from their parent rRNAs and are a novel small regulatory RNA. They play important roles in cell proliferation, stress induction, inflammatory responses, and metabolic regulation by regulating gene expression. However, the role of rRFs in cardiovascular disease and their research are limited. Summary of the Invention
[0004] Our previous studies have shown that rRF-36 is significantly downregulated in the carotid artery ligation model of APOE mice fed a high-fat diet (see Examples 1 and 2). In vitro, overexpression of rRF-36 reverses the effects of PDGF-BB on vascular smooth muscle cell proliferation and migration (see Examples 3 and 4). Therefore, identifying genes that regulate smooth muscle cell proliferation and migration will lead to the development of highly effective and stable drugs for the treatment of coronary atherosclerosis.
[0005] Therefore, the first object of the present invention is to provide an rRNA-derived fragment for use as a biomarker in the preparation of a product for diagnosing atherosclerosis, wherein the sequence of the rRNA-derived fragment is shown in SEQ ID NO.1.
[0006] SEQ ID NO. 1: 5'-UUAGUGACGCGCAUGAAUGGAUGAACGAGAUUCCCA-3'.
[0007] In one aspect of the invention, the product comprises a reagent or a kit.
[0008] In one aspect of the invention, the reagents include primers for quantitatively detecting the rRNA-derived fragments.
[0009] In one aspect of the present invention, the kit includes a micro RNA extraction kit, a reverse transcription kit, and the primers. The micro RNA extraction kit is used to extract RNA, and the reverse transcription kit is used to reverse the extracted RNA into cDNA. Due to the short sequence length of the rRNA-derived fragment, a stem-loop needs to be added to the 5' end of the rRNA-derived fragment to ensure the accuracy of reverse transcription. Reverse transcription system: 20 μL, 5×all in one qRT suppermix: 4 μL, enzymemix: 1 μL, stem-loop primer: 1 μL, RNA: 100 ng, add RNA-free H2O to 20 μL, reverse transcription program: 37°C 15 min, 85°C 5 s, 4°C forever.
[0010] Stem-loop primer (SEQ ID NO. 4): 5′-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTGGGAAT-3′;
[0011] In one aspect of the present invention, the primer sequences are shown in SEQ ID NO. 2~3.
[0012] SEQ ID NO.2: 5′-TCGGCAGGTTAGTGACCCGCATGA-3′;
[0013] SEQ ID NO. 3: 5'-TATCCAGTGCAGGGTCCGA-3'.
[0014] The second object of the present invention is to provide a use of a substance overexpressing the rRNA-derived fragment in the preparation of a drug for treating atherosclerosis, wherein the sequence of the rRNA-derived fragment is shown in SEQ ID NO.1.
[0015] In one aspect of the present invention, the drug is used to inhibit abnormally accelerated proliferation of vascular smooth muscle cells.
[0016] In one aspect of the present invention, the drug is used to inhibit abnormally accelerated migration of vascular smooth muscle cells.
[0017] In one aspect of the present invention, the drug is used to regulate the expression of vascular smooth muscle cell conversion-related proteins, specifically to inhibit the decrease of contractile proteins Vimentin and SMA22α and the increase of synthetic-related protein OPN.
[0018] A third object of the present invention is to provide a drug for treating atherosclerosis, wherein the drug comprises a substance that overexpresses the rRNA-derived fragment, wherein the sequence of the rRNA-derived fragment is shown in SEQ ID NO. 1, and the substance that overexpresses the rRNA-derived fragment comprises any one of the following:
[0019] 1) the rRNA-derived fragment;
[0020] 2) a recombinant vector containing a gene encoding the rRNA-derived fragment;
[0021] 3) A recombinant virus containing a gene encoding the rRNA-derived fragment.
[0022] In one aspect of the present invention, the drug further comprises a pharmaceutically acceptable carrier, and the carrier is preferably a diluent, a sustained-release agent, an excipient, a filler, a binder, a wetting agent, a disintegrant, an absorption promoter, an adsorption carrier, a surfactant and a lubricant.
[0023] The present invention has the following beneficial effects:
[0024] The present invention provides rRF, an rRNA-derived fragment (hereinafter referred to as rRF-36), associated with atherosclerosis. rRF-36 is significantly downregulated in a carotid artery ligation model of APOE mice fed a high-fat diet. Measuring rRF-36 expression levels can effectively diagnose atherosclerosis. Overexpression of rRF-36 can reverse the PDGF-BB-induced increase in vascular smooth muscle cell proliferation and migration, effectively reversing the PDGF-BB-induced decrease in the contractile proteins vimentin and SMA22α and the increase in the synthetic-related protein OPN in HASMCs. This invention provides a new target for the diagnosis and treatment of atherosclerosis. BRIEF DESCRIPTION OF THE DRAWINGS
[0025] Figure 1 The differentially expressed rRF results between shear stress model and normal APOE mice were screened for second-generation sequencing.
[0026] Figure 2 Real-time quantitative PCR was used to measure the expression level of rRF-36 in shear stress model and normal APOE mice.
[0027] Figure 3Real-time quantitative PCR was used to determine the expression of rRF-36 in HASMCs after PDGF-BB induction.
[0028] Figure 4 The expression of rRF-36 in HASMCs after intervention with different concentrations of si-Mimics.
[0029] Figure 5 Proliferation of HASMCs induced by overexpression of rRF-36 combined with PDGF-BB.
[0030] Figure 6 The figure shows the migration of HASMCs induced by overexpression of rRF-36 combined with PDGF-BB.
[0031] Figure 7 The expression levels of proteins related to phenotypic conversion of HASMCs induced by overexpression of rRF-36 combined with PDGF-BB. DETAILED DESCRIPTION
[0032] The present invention will be described in detail below with reference to the accompanying drawings and specific examples, but they should not be construed as limiting the present invention. Unless otherwise specified, the technical means used in the following examples are conventional means well known to those skilled in the art, and the materials, reagents, etc. used in the following examples, unless otherwise specified, can be obtained from commercial sources.
[0033] Example 1: Initial screening of differential rRF
[0034] a. A shear stress model was established by partial unilateral carotid artery ligation in 8-week-old APOE mice (PL group). APOE mice of the same age were used as a sham-operated group (Sham group) and then fed a high-fat diet for 4 weeks.
[0035] a. Kill mice by cervical dislocation. Remove the left and right carotid arteries from the experimental and control groups, store them in liquid nitrogen, label them, and then send them for next-generation sequencing to screen for rRF expression.
[0036] The sequencing results are as follows Figure 1 As shown, the final Figure 1 The rRNA-derived fragment (rRF-36) gene indicated by the red arrow is under investigation.
[0037] Example 2: Identifying differentially expressed rRFs after successful shear stress modeling by real-time quantitative PCR
[0038] a. A shear stress model was established by partial unilateral carotid artery ligation in 8-week-old APOE mice (PL group). APOE mice of the same age were used as a sham-operated group (sham group) and then fed a high-fat diet for 4 weeks.
[0039] b. Mice were killed by cervical dislocation. The left and right carotid arteries of both groups of mice were removed and stored in liquid nitrogen in a tube containing Trizol reagent. The tubes were labeled accordingly. RNA was extracted using a micro RNA extraction kit.
[0040] c. Use a reverse transcription kit to convert the RNA to cDNA. Design a stem-loop primer for specific reverse transcription. Because the rRF-36 sequence is very short, a stem-loop primer needs to be added to the 5' end of rRF-36 to ensure accuracy of reverse transcription. Reverse transcription system: 20 μL, 5× all-in-one qRT supper mix: 4 μL, enzyme mix: 1 μL, stem-loop primer: 1 μL, RNA: 100 ng, add RNA-free HO to 20 μL, reverse transcription program: 37°C for 15 min, 85°C for 5 s, 4°C forever; stem-loop primer sequence (SEQ ID NO. 4): 5′-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTGGGAAT-3′;
[0041] d. Design rRF-36 real-time quantitative PCR primers as shown below,
[0042] rRF-36-F (SEQ ID NO.2): 5′-TCGGCAGGTTAGTGACCCGCATGA-3′;
[0043] REVERSE-O1 (SEQ ID NO. 3): 5′-TATCCAGTGCAGGGTCCGA-3′.
[0044] e. Perform RT-qPCR using SYBR Green mix on an ABI 7500 fluorescence quantitative PCR instrument;
[0045] f. Use 2 -ΔΔCt The relative expression levels of the above rRFs were analyzed by the method.
[0046] from Figure 2 It can be seen that the expression level of rRF-36 in the PL group was significantly downregulated compared with the sham group.
[0047] Example 3: Determination of rRF-36 expression after PDGF-BB induction by real-time quantitative PCR
[0048] a. Design rRF-36 real-time quantitative PCR primers as shown below:
[0049] rRF-36-F (SEQ ID NO.2): 5′-TCGGCAGGTTAGTGACCCGCATGA-3′;
[0050] REVERSE-O1 (SEQ ID NO. 3): 5′-TATCCAGTGCAGGGTCCGA-3′.
[0051] b. Culture vascular smooth muscle cells (HASMCs) using SMCM medium in an incubator at 37°C containing 5% CO2.
[0052] c. Change the medium every 36 hours and perform subculture every 72 hours;
[0053] d. HASMCs in the logarithmic growth phase were seeded into 6-well cell culture plates. After the cells were fully adhered, they were treated with 25 μg / ml platelet-derived factor-BB (PDGF-BB, PEPRO TECH, Cat. No. 052304) for 24 hours to prepare the cell model (PDGF-BB) group. Normally cultured cells served as the control group. Three replicates were set up for each group.
[0054] e. After treatment, RNA from each group was extracted using Trizol reagent;
[0055] f. Reverse to cDNA using a reverse transcription kit;
[0056] g. RT-qPCR was performed using SYBR Green mix on an ABI 7500 fluorescence quantitative PCR instrument;
[0057] h. Use 2 -ΔΔCt The relative expression level of rRF-36 was analyzed by the above-mentioned method.
[0058] from Figure 3 It can be seen that compared with the Control group, the relative expression level of rRF-36 in the PDGF-BB group was significantly downregulated, indicating that rRF-36 is expressed consistently with that in mice; therefore, the present invention chose to interfere with rRF-36 to study whether it could inhibit PDGF-BB-induced HASMCs cell dysfunction.
[0059] Example 4: Detection of the effect of overexpression of rRF-36 on the accelerated proliferation of HASMCs induced by PDGF-BB
[0060] a. 30,000 HASMCs were seeded into a 12-well cell culture dish with a slide. After the cells were fully attached, si-NC (as shown in SEQ ID NO. 5, sequence: UGGGAAUCUCGUUCAUCCAUUCAUGCGCGUCACUAA) and si-Mimics were transfected into the HASMCs using jetPRIME (Note: si-Mimics (SEQ ID NO. 1) was designed and synthesized based on the rRF-36 transcript sequence, with the sequence: 5′-UUAGUGACGCGCAUGAAUGGAUGAACGAGAUUCCCA-3′).
[0061] The interference results verified by PCR are as follows Figure 4 ,The results showed that si-Mimics could significantly enhance the expression of rRF-36;
[0062] b. 24 hours after transfection, the cells in the two groups were incubated with 25 μg / ml PDGF-BB medium for 24 hours. The normally cultured cells were designated as the NC group.
[0063] c. After the culture, the cell proliferation was measured using the BeyoClick™ EdU-594 cell proliferation detection kit;
[0064] d. Add EDU solution to each well, incubate for 4 hours, and then fix with 4% paraformaldehyde at room temperature for 15 minutes;
[0065] e. Remove the fixative and wash the cells three times with 1 ml of washing solution per well, each time for 3-5 minutes;
[0066] f. Remove the wash solution and incubate each well with 1 mL of permeabilization solution (you can use Beyotime's Immunostaining Strong Permeabilization Solution P0097, Immunostaining Washing Solution P0106, or PBS containing 0.3% Triton X-100) at room temperature for 10-15 minutes.
[0067] g. Remove the permeabilization solution and wash the cells 1-2 times with 1 ml of washing solution per well for 3-5 minutes each time;
[0068] h. Add 0.25 ml of Click reaction solution to each well and gently shake the plate to ensure that the reaction mixture evenly covers the samples. Incubate at room temperature in the dark for 30 minutes.
[0069] i. Aspirate the Click reaction solution and wash three times with washing solution for 3-5 minutes each time. Block with blocking solution containing DAPI and then take pictures and count.
[0070] like Figure 5As shown in the figure, the proliferation of HASMCs cells was significantly accelerated after NC+PDGF-BB treatment (P<0.001). Compared with the NC+PDGF-BB group, the proliferation of the si-Mimics+PDGF-BB group was significantly inhibited (P<0.05). The above results indicate that overexpression of rRF-36 can effectively inhibit the accelerated proliferation of HASMCs caused by PDGF-BB.
[0071] Example 5: Detection of the effect of overexpression of rRF-36 on the enhanced migration of HASMCs induced by PDGF-BB
[0072] a. Seed 30,000 HASMCs cells per well into a 12-well cell culture dish. After the cells are fully attached, transfect the HASMCs with si-NCs and si-Mimics using jetPRIME (Note: si-Mimics (SEQ ID NO. 1) is a single-stranded design synthesized based on the rRF-36 transcript sequence; the sequence is: 5′-UUAGUGACGCGCAUGAAUGGAUGAACGAGAUUCCCA-3′).
[0073] b. 24 hours after transfection, cells were starved with 0.5% serum medium for 12 hours, and then stimulated with PDGF-BB (final concentration 25 ng / ml) for 24 hours. HASMCs (NC / NC+PDGF / Mimics+PDGF) after 24 hours of stimulation were removed from the 12-well plate and centrifuged, resuspended, and counted.
[0074] c. Transfer the corresponding amount of cell suspension to a 1.5ml EP tube, centrifuge, and resuspend the cells in 200μL of blood-free and antibiotic-free culture medium;
[0075] d. Add 600 μL / well of complete culture medium to a new 24-well plate as the Transwell lower chamber medium. Heat the tweezers with an alcohol burner and insert the transwell into the well containing the lower chamber medium (be careful to avoid air bubbles during this process). Add 200 μL of blood- and antibiotic-free culture medium to each transwell, followed by the cells resuspended in each well.
[0076] After 24 hours, wash the Transwell chamber lightly with PBS and fix it in 600 μL / well of 4% paraformaldehyde at room temperature for 30 minutes. Place the chamber in a clean beaker filled with RO water and use forceps to gently shake the chamber three times. Place the cleaned chamber in 600 μL / well of crystal violet staining solution and stain for 10 minutes.
[0077] f. After staining, remove the chamber and wash it three times in a beaker, dry it, and place the chamber under an inverted microscope. Randomly select five fields of view for counting, and use the average value to represent the number of migrating cells.
[0078] The calculation results are as follows Figure 6 As shown in the figure, the migration of HASMCs cells was significantly accelerated after NC+PDGF-BB treatment (P<0.001). Compared with the NC+PDGF-BB group, the migration of the si-Mimics+PDGF-BB group was significantly inhibited (P<0.05). The above results indicate that overexpression of rRF-36 can effectively inhibit the migration of HASMCs caused by PDGF-BB.
[0079] Example 6: Detection of the effect of overexpression of rRF-36 on PDGF-BB-induced phenotypic conversion-related proteins in HASMCs
[0080] a. HASMCs were seeded into 6-well cell culture dishes at a density of 75,000 cells per well. After the cells were fully adhered, si-NC and si-Mimics were transfected into the HASMCs using jetPRIME. (Note: si-Mimics (SEQ ID NO. 1) was designed and synthesized based on the rRF-36 transcript sequence, with the sequence: 5′-UUAGUGACGCGCAUGAAUGGAUGAACGAGAUUCCCA-3′)
[0081] b. 24 hours after transfection, cells were starved with 0.5% serum medium for 48 hours. After 48 hours, the medium was replaced with fresh 0.5% serum medium and then stimulated with PDGF-BB (final concentration 25 ng / ml) for 24 hours.
[0082] c. After removing the culture medium, wash with PBS, add protein lysis buffer and lyse on ice to extract total protein, and measure the protein concentration with the BCA protein detection kit;
[0083] d. Perform electrophoresis using polyacrylamide gel electrophoresis. After electrophoresis, perform electrotransfer using a semi-dry transfer apparatus.
[0084] e. After electroporation, remove the membrane and place it in blocking solution for 1 hour. Then, incubate with primary antibodies for Vimentin, SMA22α, OPN, and GAPDH at 4°C overnight.
[0085] f. After washing the membrane, incubate with secondary antibody at room temperature for 1 hour. After washing the membrane, add chemiluminescent solution for color development. The results are as follows Figure 7 shown.
[0086] from Figure 7As can be seen from the figure, the grayscale of contraction-related proteins Vimentin and SMA22α in HASMCs cells treated with PDGF-BB was significantly lower than that in the NC group, while the grayscale of synthesis-related protein OPN was significantly higher than that in the NC group, indicating that PDGF-BB can effectively inhibit the protein expression of Vimentin and SMA22α and promote the expression of synthesis-related protein OPN;
[0087] g. After overexpression of Mimics, the grayscale of Vimentin and SMA22α increased, and the grayscale of OPN decreased, indicating that overexpression of Mimics can effectively reverse the decrease of contractile proteins Vimentin and SMA22α and the increase of synthesis-related protein OPN in HASMCs cells caused by PDGF-BB.
[0088] Based on the above Examples 1-6, it can be concluded that low shear stress inhibits the expression of rRF-36 in vascular smooth muscle cells, and PDGF-BB treatment also leads to a decrease in the expression of rRF-36 in vascular smooth muscle cells. Overexpression of rRF-36 can effectively inhibit the abnormal proliferation and migration of vascular smooth muscle cells caused by PDGF-BB. Referring to the prior art "Miano JM, Fisher EA, Majesky MW. Fate and State of Vascular Smooth Muscle Cells inAtherosclerosis. Circulation. 2021 May 25;143(21):2110-2116." and "GrootaertMOJ, Bennett MR. Vascular smooth muscle cells in atherosclerosis: time for are-assessment. Cardiovasc Res. 2021 Sep 28;117(11):2326-2339." It can be concluded that abnormal proliferation and migration of vascular smooth muscle cells can cause coronary atherosclerosis. Therefore, the present invention discovered that gene rRF-36 can regulate coronary atherosclerosis caused by abnormal proliferation and migration of vascular smooth muscle cells.
[0089] Although the preferred embodiments of the present invention have been described, those skilled in the art may make additional changes and modifications to these embodiments once they have learned the basic creative concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present invention.
[0090] Obviously, those skilled in the art may make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if such changes and modifications fall within the scope of the claims and their equivalents, the present invention is intended to include such changes and modifications.
Claims
1. Use of an rRNA-derived fragment as a biomarker in the preparation of a product for diagnosing atherosclerosis, characterized in that: The sequence of the rRNA-derived fragment is shown in SEQ ID NO.
1.
2. The use of the rRNA-derived fragment as a biomarker in the preparation of a product for diagnosing atherosclerosis according to claim 1, characterized in that: The product includes a reagent or a kit.
3. The use of the rRNA-derived fragment as a biomarker in the preparation of a product for diagnosing atherosclerosis according to claim 2, characterized in that: The reagents include primers for quantitatively detecting the rRNA-derived fragments.
4. The use of the rRNA-derived fragment as a biomarker in the preparation of a product for diagnosing atherosclerosis according to claim 3, characterized in that: The primer sequences are shown in SEQ ID NO. 2~3.
5. Use of a substance overexpressing the rRNA-derived fragment of claim 1 in the preparation of a drug for treating atherosclerosis, characterized in that: The sequence of the rRNA-derived fragment is shown in SEQ ID NO.
1.
6. Use of the substance derived from rRNA fragments according to claim 5 in the preparation of a drug for treating atherosclerosis, characterized in that: The drug is used for inhibiting abnormally accelerated proliferation of vascular smooth muscle cells.
7. Use of the substance derived from rRNA fragments according to claim 5 in the preparation of a drug for treating atherosclerosis, characterized in that: The drug is used for inhibiting the abnormally accelerated migration of vascular smooth muscle cells.
8. Use of the substance derived from rRNA fragments according to claim 5 in the preparation of a drug for treating atherosclerosis, characterized in that: The drug is used to regulate the expression of vascular smooth muscle cell conversion-related proteins, specifically to inhibit the decrease of contractile proteins Vimentin and SMA22α and the increase of synthetic-related protein OPN.
Citation Information
Patent Citations
miRNAs marker used for diagnosing carotid atherosclerotic plaques and applications thereof
CN110229893A
Composition for removing rRNA and Globin mRNA in human total RNA
CN112094892A