A snp molecular marker related to different ages of chicken breast depth and application thereof

Abstract

The present application relates to a SNP molecular marker related to different ages of chicken breast depth and application. The present application discloses a SNP site related to chicken 4 weeks, 8 weeks and 12 weeks breast depth, which is located in the intron region of FNDC3A gene, and the genomic position is chr1: 170409400bp of GRCg6a 104 version genome. The SNP marker has three genotypes, C / C, T / T and C / T, wherein C / C corresponds to higher breast depth and body weight. In the high breast depth chicken, C is the dominant allele, and by selecting the C / C genotype of the SNP site, the early selection of chicken breast depth characteristics can accelerate the genetic breeding of chicken.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of molecular biology, in particular to a SNP molecular marker related to different ages of chicken deep chest and application. BACKGROUND

[0002] Chicken is one of the main meat varieties in China, which has the characteristics of high protein, low fat and low cholesterol. In recent years, China's chicken production has been growing continuously, and improving muscle yield and quality has been the long-term exploration of breeding scientists. Classical breeding methods have made great contributions to the improvement of agricultural animal production traits, and with the continuous advancement of genome work and the extensive development of genetic markers, breeding scientists can select chickens with good yield and quality characteristics for breeding according to specific genetic markers. These genetic markers can help breeding scientists more accurately assess and select the genetic potential of chickens and accelerate the breeding process.

[0003] SNP (Single Nucleotide Polymorphism) is one of the common genetic variations in genetics. SNP has the advantages of large quantity, high frequency and low mutation rate, and plays an important role in genetic research and molecular selection breeding. However, there is still a lack of molecular markers with clear function and significant effect in the practice of broiler molecular breeding. Therefore, it is the current research focus to excavate molecular markers with large effect and accuracy. Further, if the SNP molecular marker related to the target trait of chicken can be found and the molecular mechanism of the site is finally analyzed, it will greatly promote the genetic improvement of chicken and bring breakthrough progress to the field of poultry breeding. SUMMARY

[0004] In view of the defects in the prior art, the purpose of the present application is to provide a SNP molecular marker related to different ages of chicken deep chest and application. The present application discloses a SNP site related to chicken 4-week, 8-week and 12-week deep chest, which is located in the intron region of FNDC3A gene, and the genomic position is chr1: 170409400bp of GRCg6a 104 version genome. The SNP marker has three genotypes, C / C, T / T and C / T, wherein C / C corresponds to higher chest depth and body weight. In high chest depth chickens, C is the dominant allele, and by selecting the C / C genotype of the SNP site, early selection of chicken chest depth traits can accelerate the genetic breeding of chickens.

[0005] To achieve the above purpose, the technical scheme adopted by the present application is:

[0006] A SNP molecular marker related to different ages of chicken breast depth, characterized in that the SNP molecular marker is located at chr1: 170409400 bp of genome version GRCg6a 104, and the alleles of the SNP molecular marker are C and T.

[0007] The specific process of obtaining the SNP molecular marker is as follows:

[0008] Using resequencing technology, 1079 individuals of a chicken cross population with different age breast depth records are sequenced and subjected to GWAS analysis, and a SNP site significantly related to 4-week, 8-week and 12-week breast depth is obtained, which is rs14916459 (chr1: 170409400) of genome version GRCg6a 104, and the site contains C / C, T / T and C / T three genotypes.

[0009] On the basis of the above scheme, the dominant allele of the SNP molecular marker is C. The result is obtained by statistically analyzing the SNP frequency of the SNP in other low weight chicken species and high weight chicken species, and it is found that the SNP frequency distribution in low weight chicken species and high weight chicken species is significantly different, and C is the dominant allele in high weight chicken, and T is the dominant allele in low weight chicken.

[0010] On the basis of the above scheme, the SNP molecular marker is located at the 101st base of the nucleotide sequence shown in SEQ ID NO. 1. The sequence shown in SEQ ID NO. 1 is a fragment of 170409300 bp-170409500 bp in chr1 of genome version GRCg6a 104.

[0011] The application of a SNP molecular marker related to different ages of chicken breast depth in marker-assisted selection breeding of chickens.

[0012] On the basis of the above scheme, the marker-assisted selection breeding of chickens is specifically: breeding chickens with high breast depth by SNP site assisted selection.

[0013] On the basis of the above scheme, the application of the SNP molecular marker related to different ages of chicken breast depth in marker-assisted selection breeding of chickens comprises the following steps:

[0014] Step 1, detecting the genotype of the sample chicken at the SNP molecular marker;

[0015] Step 2, selecting chickens with C / C genotype for breeding.

[0016] On the basis of the above scheme, step 1 uses direct sequencing, or the method of first amplifying the fragment containing the SNP molecular marker and then sequencing.

[0017] A primer pair for amplifying the fragment containing the SNP molecular marker, characterized in that the nucleotide sequence of the primer pair is shown as SEQ ID NO. 2 and SEQ ID NO. 3.

[0018] F: GTGAGATTTTTCTTCTTTCC (SEQ ID NO. 2)

[0019] R: TGTGAGGGGGGATCTAATCA (SEQ ID NO. 3)

[0020] The primer pair is used to amplify the fragment containing the SNP molecular marker from the sequence shown in SEQ ID No. 1.

[0021] The SNP molecular marker related to different ages of chicken deep chest and the application have the beneficial effects that:

[0022] Through the resequencing technology, GWAS research is conducted on 1079 hybrid populations of chickens with different ages of deep chest records, and through the analysis of the GWAS results, a SNP (chr1: 170409400) site significantly related to the chicken deep chest trait is obtained. The SNP frequency analysis of this site in other low chest deep chicken species and high chest deep chicken species shows that the SNP frequency distribution in low chest deep chicken species and high chest deep chicken species is significantly different, and T is the dominant allele in high chest deep chicken, and C is the dominant allele in low chest deep chicken. High chest deep chicken has higher body weight than low chest deep chicken, which shows that this SNP site can be used as a molecular marker for breeding of excellent chicken species. In the population with lower chest depth, by selecting individuals with allele T, the body weight of the population can be improved. The present application can early, quickly, low-cost and effectively predict whether the body weight is high or low by detecting the SNP molecular marker, and has wide application prospect in chicken breed improvement and can achieve excellent economic value. BRIEF DESCRIPTION OF DRAWINGS

[0023] The present application has the following drawings:

[0024] Fig. 1 It is a Manhattan plot of 4-week-old chest depth GWAS results;

[0025] Fig. 2 It is a Manhattan plot of 8-week-old chest depth GWAS results;

[0026] Fig. 3 It is a Manhattan plot of 12-week-old chest depth GWAS results. DETAILED DESCRIPTION

[0027] The following examples further illustrate the present application but should not be construed as limiting the application. Modifications or variations of the method, steps or conditions of the application are deemed to fall within the scope of the present application.

[0028] Example 1 Whole genome association analysis of body size traits in chicken

[0029] 1. Test materials

[0030] The individuals of chicken cross population were selected as the research object, and the chest depth of 1079 individuals was measured at 4 weeks, 8 weeks and 12 weeks of age. The measurement was strictly conducted according to the internal standard of the chicken farm.

[0031] 2. Test method

[0032] 2.1 Phenotype measurement

[0033] When the chicken reached the corresponding age, the chicken was placed on a flat surface with its chest upwards, and the body posture of the chicken was ensured to be naturally stretched. The highest point of the sternum was found, and the distance from the highest point of the sternum to the bottom of the chicken chest was measured vertically using a ruler, and the value was recorded.

[0034] 2.2 Chicken whole genome SNP typing method based on resequencing technology

[0035] The sequencing data was aligned to GRCg6a 104 reference genome using gtx align, SNP site detection was performed using Basevar, and STITCH was used to estimate the genotype probability of all individuals. For the SNP sites obtained by typing, filtering was performed according to MAF <0.05, site call rate <0.95, and info score <0.4, and a total of 7,901,521 high-quality sites were retained.

[0036] 2.3 Whole genome association analysis

[0037] FastGWA was used to perform whole genome association analysis on the 4-week chest depth, 8-week chest depth and 12-week chest depth phenotypes of 1079 chickens.

[0038] 2.4 SNP sites significantly associated with body size traits

[0039] For the detection of significant sites at the genome level, significant sites were identified according to FDR <0.05.

[0040] 3. Results and analysis

[0041] The present application takes 1079 chicken crossbreeding groups as the object, uses 7,901,521 SNPs obtained by resequencing technology for GWAS analysis of different age chest depth of chickens, determines a SNP (chr1: 170409400) site significantly related to different age chest depth of chickens, as shown in Figs. 1-3 .

[0042] Example 2: Frequency distribution of SNP (chr1: 170409400) in different chicken breeds

[0043] 1. Test material

[0044] Low weight chicken breeds: Mustache chicken (n = 15), tea flower chicken (n = 30), Dweishan miniature chicken (n = 33) and silk feather chicken (n = 57).

[0045] High weight chicken breeds: Lingnan yellow feather broiler (n = 16), white feather broiler (n = 20), Kobao chicken (n = 33) and recessive white feather chicken (n = 113).

[0046] 2. Test method

[0047] 2.1 Data collection

[0048] The whole genome resequencing data of the above-mentioned from 4 low weight chicken breeds and 4 high weight chicken breeds was downloaded from the SRA database of NCBI (https: / / ncbi.nlm.nih.gov / sra).

[0049] 2.2 SNP typing using GATK

[0050] The gVCF of the above-mentioned resequencing samples was constructed based on the GRCg6a 104 reference genome using the GTX server gtx wgs command, and then the joint variant detection was performed on all gVCF samples using the gtx gi and gtx joint commands, and the genotype VCF file was obtained.

[0051] 2.3 Filtering and quality control of SNPs

[0052] After joint variant detection, the SelectVariants tool of the GATK software package was used to extract the SNP site, and then the VariantFiltration tool of the GATK software package was used to quality control the whole genome resequencing data according to the following hard filtering parameters: MQ<40.0, FS>60.0, SOR>3.0, MQRankSum<-12.5, ReadPosRankSum<-8.0, QUAL<30, and finally after the above quality control, a total of 44,272,587 resequencing SNPs sites were obtained.

[0053] 2.4 Calculate the allele frequency of chr1: 170409400 in different chicken breeds

[0054] The allele frequency of chr1: 170409400 in different chicken breeds was calculated using vcftools--freq2.

[0055] 2.5 Amplification of target fragments

[0056] The blood tissue of the hybrid population sample was used to extract DNA using the total DNA extraction kit of Beijing Tiangeng Biological Technology Co., Ltd. The OD value of the extracted DNA was detected by NanoDrop 2000 spectrophotometer to determine the concentration and purity of the DNA, and the integrity of the DNA was detected by agarose gel electrophoresis. The genomic DNA of the hybrid population sample was used as a template, and the corresponding primers were designed using Oligo7 software. The sequence was amplified using Novozyme 2xTaq Master Mix, and the reaction system was as follows: 95℃, pre-denaturation for 3min; 95℃, denaturation for 15s, 60℃, annealing for 15s, 72℃, extension for 15s, 30 cycles; 72℃, complete extension for 5min. Finally, the product fragment size was detected by agarose gel electrophoresis.

[0057] 3. Results and analysis

[0058] The SNP frequency distribution of SNP(chr1: 170409400) in different low-weight chicken breeds and high-weight chicken breeds is shown in Table 1, and there is a significant difference between low-weight chicken breeds and high-weight chicken breeds. In high-weight chickens, C is the dominant allele (high breast depth), and in low-weight chickens, T is the dominant allele (low breast depth).

[0059] Table 1 SNP frequency of SNP(chr1: 170409400) in different low-weight chicken breeds and high-weight chicken breeds

[0060]

[0061] Analysis found that a SNP molecular marker related to chicken breast depth at different ages, in the population with low breast depth (corresponding to body weight), breeding individuals with allele C / C can improve the body weight of the breeding population.

[0062] Although the present application has been described in detail in the foregoing description, general description, specific embodiments and experiments, some modifications or improvements can be made on the basis of the present application, which is obvious to those skilled in the art. Therefore, these modifications or improvements made on the basis of not deviating from the spirit of the present application, all belong to the scope of protection claimed by the present application.

[0063] That which is not described in detail in the specification is considered to be of prior art to those skilled in the art.

Claims

1. Application of a SNP molecular marker related to different ages of chicken breast depth in 4 weeks, 8 weeks and 12 weeks of chicken breast depth trait assisted selection breeding of chicken; The SNP molecular marker is located at chr1: 170409400 bp of the genome version GRCg6a; The alleles of the SNP molecular marker are C and T.

2. The application of claim 1, wherein: The assisted selection breeding is specifically breeding chickens with high breast depth through SNP site assisted selection.

3. Use according to claim 2, wherein the compound is ###0002### Comprising the following steps: Step 1, detecting the genotype of sample chicken at the SNP molecular marker; Step 2, selecting chickens with genotype C / C for breeding.

4. The application of claim 3, wherein: The step 1 is performed by direct sequencing, or by amplifying the fragment containing the SNP molecular marker first and then sequencing.

Images