Polysporus cucurbitae and its application

Abstract

The invention discloses a polysporon of cucurbitacin and an application thereof. The polysporon of cucurbitacin ( Stagonosporopsis cucurbitaceae ) strain number is JSAFC 2218, and it was deposited in the General Microbiological Center of China Microbiological Culture Collection Administration on May 20, 2024, with the deposit number CGMCC No. 41307. This application obtained a species of Pseudomonas aeruginosa ( Stagonosporopsis cucurbitaceae ). This strain can inhibit the growth of Psoralea labyrinthina, promote the development of peach trees, and regulate plant growth, which is of great significance for the future development of biocontrol agents for wood rot.

Description

Technical Field

[0001] The invention belongs to the technical field of microorganisms and relates to Polysporus cucurbitae and application thereof. Background Art

[0002] Peach is native to northwest my country and is a fruit tree widely distributed in my country and even in the world. Peach is a perennial deciduous fruit tree belonging to the genus Prunus in the Rosaceae family. It has a long history of cultivation in my country. Peach is one of the main fruit trees planted in China. With the continuous adjustment of the agricultural industrial structure in recent years, the planting area of ​​peach in most parts of my country has also been increasing. However, the occurrence of diseases often has a serious impact on the growth of peach trees. Labyrinthine fungus ( Trametes gibbosa ) mainly harms the branches and heartwood of peach trees, causing the core wood to rot and form a ring-shaped pattern. The infected tree's xylem becomes white and loose, soft and brittle, and easily decays and breaks, often leading to tree weakness, yellowing of leaves or premature leaf fall.

[0003] At present, chemical pesticides are commonly used to prevent and control plant diseases. However, long-term use will cause many pathogens to develop resistance, reducing the disease prevention effect. Frequent and high-concentration use will pollute the environment, and excessive residual toxicity will threaten human health. There are many beneficial microorganisms in the environment around plants. These microorganisms will not only not cause plant diseases, but some can even induce plant resistance and improve the survival ability of plants under biotic or abiotic stress conditions. In addition, these microorganisms come from the natural environment and are pollution-free. Using these microorganisms to prevent and control plant diseases is conducive to maintaining ecological balance. Summary of the invention

[0004] Purpose of the invention: The purpose of the present invention is to provide a kind of Stagonosporopsis cucurbitacearum ), and its application in inhibiting the growth of Labyrinthine Fungus and promoting the growth of peach trees.

[0005] Technical solution: The present invention provides a kind of cucurbitacin ( Stagonosporopsis cucurbitacearum ), the Pseudomonas cucurbitae ( Stagonosporopsis cucurbitacearum ) is JSAFC 2218, and was deposited in the General Microbiology Center of China Microbiological Culture Collection Administration on May 20, 2024, with the deposit number CGMCC No. 41307.

[0006] Furthermore, the nucleotide sequence of the ITS gene of Pseudomonas cucurbitae is as shown in SEQ ID NO.1, rpb2 The nucleotide sequence of the gene is shown in SEQ ID NO.2.

[0007] The present invention also provides a biocontrol fungus agent, wherein the active ingredient of the biocontrol fungus agent is the above-mentioned Polysporus cucurbitae (Stagonosporopsis cucurbitacearum ).

[0008] The present invention also provides the above-mentioned Polysporus cucurbitae ( Stagonosporopsis cucurbitacearum ), the application of biocontrol bacteria and agents in inhibiting the growth of Borrelia spp.

[0009] The present invention also provides the above-mentioned Polysporus cucurbitae ( Stagonosporopsis cucurbitacearum ), the application of biocontrol fungi in promoting the growth of peach trees.

[0010] Further, the application is specifically to use Pseudomonas cucurbitae ( Stagonosporopsis cucurbitacearum ) The spore suspension of JSAFC 2218 was used to irrigate the roots of peach trees to promote the plant height and root growth of peach trees.

[0011] Furthermore, the preparation method of the spore suspension is as follows: (1) taking the biocontrol fungus Pseudomonas aeruginosa JSAFC 2218 strain, under sterile conditions, picking up mycelium with an inoculation needle, inoculating it into a sterilized PDA culture medium, and culturing it for 5-7 days; (2) under sterile conditions, scraping the mycelium, washing the mycelium with sterile water and filtering it with gauze; (3) under sterile conditions, adjusting the spore concentration with sterile water.

[0012] Furthermore, the culture conditions in step (1) are 25° C., 65% humidity, and dark culture.

[0013] Further, the concentration of the spore suspension is 10 5 / ml.

[0014] Furthermore, the spore suspension is applied in an amount of 5 mL / time / 2 days for 30 days.

[0015] Beneficial effects: Compared with the prior art, the present invention has the following outstanding advantages: The present invention obtains a species of Pseudomonas cucurbitae ( Stagonosporopsis cucurbitacearum ). This strain can inhibit the growth of Psoralea labyrinthina, promote the development of peach trees, and regulate plant growth, which is of great significance for the future development of biocontrol agents for wood rot. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 : Stagonosporopsis cucurbitacearum Phylogenetic tree of JSAFC 2218.

[0017] Figure 2 :The biocontrol bacteria of the present invention Stagonosporopsis cucurbitacearum JSAFC 2218 was cultured in confrontation with Trametes labyrinthus.

[0018] Figure 3 :The biocontrol bacteria of the present invention Stagonosporopsis cucurbitacearumEffects of JSAFC 2218 on root growth of peach trees. DETAILED DESCRIPTION

[0019] The technical solution of the present invention is further described below in conjunction with the accompanying drawings.

[0020] As described in the present invention, the term "biocontrol bacteria" refers to beneficial microorganisms that can prevent and control plant diseases, mainly bacteria, fungi, and actinomycetes.

[0021] Embodiment 1: Stagonosporopsis cucurbitacearum Isolation and identification of JSAFC 2218

[0022] 1. Stagonosporopsis cucurbitacearum Separation of JSAFC 2218

[0023] Take the soil with good root growth of Jurong peach trees and separate it from it Stagonosporopsis cucurbitacearum JSAFC 2218, the colony characteristics are as follows: when cultured on PDA flat medium, the colonies are initially white, gradually turn brown as the culture time increases, and adhere to the surface of the medium.

[0024] 2. Stagonosporopsis cucurbitacearum JSAFC 2218 Molecular Biology Identification

[0025] (1) The genomic DNA of strain JSAFC 2218 was extracted using a kit produced by TIANGEN.

[0026] (2) Amplify the ITS and rpb2 Gene.

[0027] DNA amplification was performed in a 30 μL reaction volume, including 15 μL 2×EasyTaq PCR SuperMix (+dye), primer pair ITS1 (SEQ ID NO.3: 5'-CTTGGTCATTTAGAGGAAGTAA-3') & ITS4 (SEQ ID NO.4: 5'-TCCTCCGCTTATTGATATGC-3'), rpb2 -5F (SEQ ID NO.5: 5'- GAYGAYMGWGATCAYTTYGG-3')& rpb2 -7cR (SEQ ID NO.6: 5'-CCCATRGCTTGYTTRCCCAT-3') 1 μL (10 μM), 2 μL template DNA and 11 μL ddH2O, PCR amplification program conditions are as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 54℃ annealing for 45 s ( rpb2 genes were annealed at 59°C for 45 s), extended at 72°C for 60 s, for a total of 35 cycles; and finally extended at 72°C for 10 min.

[0028] (3) The amplified PCR products were subjected to 1% agarose gel electrophoresis and observed under ultraviolet light. The PCR products with target bands were sent to Nanjing Qingke Biotechnology Co., Ltd. for sequencing. The sequencing results were as follows: The ITS gene sequence of strain JSAFC 2218 was SEQ ID NO.1 (GCGGCCTTGCCTGCCATCTCTTACCCATGTCTTTTGAGTACCTTCGTTTCCTCGGCGGGTTCGCCCGCCGATTGGACAAAACTTAAACCCTTTGTAATTGAAATCAGCGTCTGAAAAAAACATAATAGTTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTG AACGCACATTGCGCCCCTTGGTATTCCATGGGGCATGCCTGTTCGAGCGTCATTTGTACCTTCAAGCTCTGCTTGGTGTGGTGTTTGTCTCGCCTCTGCGCGCAGACTCGCCTCAAAACGATTGGCAGCCGGCGTATTGATTTCGGAGCGCAGTACATCTCGCGCTTTGCACTCACAACGACGACGTCCAAAAAGTACATTTTTACACTCTTGACCTCGGATCAGGTAGGGATACC), rpb2The gene sequence is SEQ ID NO.2 ().

[0029] (4) Compare SEQ ID NO.1 and SEQ ID NO.2 on the NCBI database website and build a phylogenetic tree, see Figure 1 The comparison results are shown in Table 1. According to the results in Table 1, it can be inferred that the biocontrol bacteria JSAFC 2218 of the present invention is Stagonosporopsis cucurbitacearum , named Stagonosporopsis cucurbitacearum JSAFC2218, and the strain was deposited in the General Microbiological Center of China Microbiological Culture Collection Administration on May 20, 2024, with the deposit number CGMCC No. 41307 and the classification name Stagonosporopsis cucurbitacearum JSAFC 2218, deposited at Institute of Microbiology, Chinese Academy of Sciences, No. 3, Beichen 1, Chaoyang District, Beijing.

[0030] Table 1 Sequence alignment results of SEQ ID NO.1~2

[0031]

[0032] Embodiment 2: Stagonosporopsis cucurbitacearum Inhibitory effect of JSAFC 2218 on Trametes labyrinthus

[0033] (1) On a clean bench, a 4 mm diameter cake of JSAFC 1020 was inoculated onto one side of a PDA medium plate as a control group. Stagonosporopsis cucurbitacearum The 4 mm diameter cake of JSAFC 2218 was inoculated on the symmetrical side of the PDA medium as the experimental group; and the medium plate inoculated with only Psoralea corylifolia was used as the control.

[0034] (2) The experimental group and control group cultures of step (1) were inverted and cultured in a constant temperature incubator at 25°C under the conditions of 8 h of light and then 16 h of dark culture.

[0035] (3) After the experimental group and control group culture medium of step (2) were artificially cultured under the above culture conditions for 7 days, the colony radius of the labyrinthine fungus was measured by the plate confrontation method, and the Stagonosporopsis cucurbitacearum The inhibitory effect of JSAFC2218 on Trametes labyrinthus.

[0036] The results are as follows Figure 2 As shown in the figure, the colony radius of the blank control group was 2.82 cm; in the experimental group, the average radius of the pathogen of the labyrinthine fungus was only 0.73 cm as determined by the plate confrontation method. Stagonosporopsis cucurbitacearum JSAFC 2218 has a significant inhibitory effect on Pseudomonas aeruginosa.

[0037] Embodiment 3: Stagonosporopsis cucurbitacearum Effects of JSAFC 2218 on the Growth of Peach Trees

[0038] (1) Use a hole punch to take a piece of the strain with a diameter of 5 mm Stagonosporopsis cucurbitacearum Mycelial blocks of JSAFC 2218 were inoculated into a 9-cm diameter culture dish (containing 15 ml of PDA medium) and cultured in the dark at 25°C and 65% humidity for 7 days.

[0039] (2) The cultured cells were cultured for 7 days. Stagonosporopsis cucurbitacearum JSAFC 2218, under sterile conditions, scrape the mycelium, rinse it with sterile water and filter it with gauze, then adjust the spore concentration to 10 5 / ml.

[0040] (3) Select pots with a diameter of 12 cm and transplant one healthy peach seedling (Sand Red variety) with consistent growth into each pot. The experiment was set up in two groups (control group and treatment group), with 10 replicates for each treatment. The experimental group was: each pot was irrigated with 5 mL ofStagonosporopsis cucurbitacearum JSAFC 2218 spore suspension; control group: each pot was watered with 5 mL of sterile water.

[0041] (4) Water each group of peach seedlings every 2 days. After 30 days, count the height of the peach trees and observe their growth and development.

[0042] The results are as follows Figure 3 And as shown in Table 2.

[0043] Table 2 Statistical results of peach tree height

[0044] Control group Experimental group Plant height (cm) 64.56±0.19 83.28±0.21

[0045] The numerical expression of plant height in the table is mean ± standard error.

[0046] From the data in Table 2, we can see that the plant height of the experimental group is significantly better than that of the control group. Stagonosporopsis cucurbitacearum JSAFC 2218 promotes the growth of peach trees. Figure 3 It can be seen Stagonosporopsis cucurbitacearum JSAFC 2218 to promote root growth of peach trees.

Claims

1. A Pseudomonas cucurbitae ( Stagonosporopsis cucurbitacearum ), characterized in that, The Polysporus cucurbitae ( Stagonosporopsis cucurbitacearum ) is JSAFC 2218, and was deposited in the General Microbiology Center of China Microbiological Culture Collection Administration on May 20, 2024, with the deposit number CGMCC No. 41307.

2. The polysporus cucurbitae according to claim 1 ( Stagonosporopsis cucurbitacearum ), characterized in that, The nucleotide sequence of the ITS gene of Pseudomonas cucurbitae is as shown in SEQ ID NO.1, rpb2 The nucleotide sequence of the gene is shown in SEQ ID NO.

2.

3. A biocontrol agent, characterized in that: The active ingredient of the biocontrol fungus agent is the Pseudomonas cucurbitae described in any one of claims 1 to 2 ( Stagonosporopsis cucurbitacearum ).

4. The Polysporus cucurbitae described in any one of claims 1 to 2 ( Stagonosporopsis cucurbitacearum ), use of the biocontrol agent according to claim 3 in inhibiting the growth of Borrelia labyrinthina.

5. The Polysporus cucurbitae described in any one of claims 1 to 2 ( Stagonosporopsis cucurbitacearum ), use of the biocontrol fungus agent according to claim 3 in promoting the growth of peach trees.

6. The use according to claim 5, characterized in that: The application is specifically to use Pseudomonas cucurbitae ( Stagonosporopsis cucurbitacearum ) The spore suspension of JSAFC 2218 was used to irrigate the roots of peach trees to promote the plant height and root growth of peach trees.

7. The use according to claim 6, characterized in that: The preparation method of the spore suspension is as follows: (1) taking the biocontrol fungus Pseudomonas aeruginosa JSAFC 2218, picking up mycelium with an inoculation needle under sterile conditions, inoculating the mycelium with a sterilized PDA culture medium, and culturing for 5-7 days; (2) scraping the mycelium under sterile conditions, washing the mycelium with sterile water and filtering with gauze; (3) adjusting the spore concentration with sterile water under sterile conditions.

8. The use according to claim 7, characterized in that: The culture conditions in step (1) are 25°C, 65% humidity, and dark culture.

9. The use according to claim 6, characterized in that: The concentration of the spore suspension is 10 5 / ml.

10. The use according to claim 6, characterized in that: The spore suspension was applied in an amount of 5 mL / time / 2 days for 30 days.

Images