A primer pair, a kit and application for early identification of sex of Gyantse seabuckthorn

Abstract

The present invention relates to the technical field of gene detection, and in particular to a primer pair, a kit and an application for early identification of the sex of Jiangzi seabuckthorn; the nucleotide sequence of the primer pair for early identification of the sex of Jiangzi seabuckthorn of the present invention is shown as SEQ ID NO.1 and SEQ ID NO.2; the present invention successfully constructs a primer pair for the sex detection of Jiangzi seabuckthorn, realizes the early screening for identifying the sex of Jiangzi seabuckthorn, and overcomes the problem of long sex identification period caused by the long fruiting period of Jiangzi seabuckthorn.

Description

Technical Field

[0001] The invention relates to the technical field of gene detection, and in particular to a primer pair, a kit and an application thereof for early identification of the sex of Gyantse seabuckthorn. Background Art

[0002] Jiangzi seabuckthorn (Hippophaegyantsensis Lian.), also known as vinegar willow, sour thorn, black thorn, etc., belongs to the genus Hippophaegyantsensis of the Elaeagnaceae family. It is a deciduous shrub or small tree that grows in high mountain valleys at an altitude of 3500-3800 meters. In China, it is mainly distributed in Lhasa, Jiangzi, and Yadong in Tibet. Jiangzi seabuckthorn has extremely strong stress resistance and wide adaptability. It can quickly restore vegetation in harsh environments and has good soil and water conservation ecological functions. As a non-leguminous nitrogen-fixing plant, it can not only improve the soil, but also improve soil fertility. The roots, stems, leaves, flowers, and fruits of Jiangzi seabuckthorn are rich in nutrients and chemical components, and have anti-tumor, anti-aging, and anti-vascular sclerosis effects. Therefore, Jiangzi seabuckthorn is a multifunctional and advantageous native tree species that integrates ecological, economic and social values.

[0003] Jiangzi seabuckthorn is a dioecious plant. The inflorescence axis of male flowers will fall off after the flowering period, while the inflorescence axis of female flowers will turn into twigs or thorns. The flowers of Jiangzi seabuckthorn are light yellow in color and usually bloom before the leaves unfold. Male flowers bloom earlier, each with 4 stamens; female flowers bloom later, with shorter pedicels. The flowering period is usually between April and May, and the fruits mature between September and October.

[0004] Most of the sea buckthorns in Jiangzi are bred by seedlings, and the fruiting period is relatively long. Generally, the fruiting begins 5 to 7 years after planting, and the male and female of the plants can be identified. This traditional breeding method takes a long time, has high production costs, and low economic benefits. Using molecular markers to identify the sex of dioecious plants can effectively identify the sex of Jiangzi sea buckthorn plants in the early stage, which is of great significance for the seedling identification, hybrid breeding, and regulation of breeding sex patterns of Jiangzi sea buckthorn, and has a high guiding value for the practical production of Jiangzi sea buckthorn. Summary of the invention

[0005] In view of the above-mentioned deficiencies in the prior art, the present invention aims to provide a primer pair, a kit and an application for early identification of the sex of Gyantse seabuckthorn, so as to achieve early identification of the sex of Gyantse seabuckthorn and solve the problem of long sex determination period of Gyantse seabuckthorn.

[0006] In order to solve the above problems, the present invention adopts the following technical solutions:

[0007] In a first aspect, the present invention provides a primer pair for early identification of the sex of Hippophae rhamnoides L. in Gyantse, wherein the nucleotide sequences of the primer pair are shown in SEQ ID NO.1 and SEQ ID NO.2.

[0008] Furthermore, the primer pair also includes a primer pair for detecting an internal reference gene, and the nucleotide sequence of the primer pair for detecting an internal reference gene is shown in SEQ ID NO.3 and SEQ ID NO.4.

[0009] In a second aspect, the present invention provides a kit for early identification of the sex of Gyantse seabuckthorn, comprising the primer pair for early identification of the sex of Gyantse seabuckthorn.

[0010] Further, it includes 15 μL of 2×Rapid Taq Master Mix, 0.3 μL of 10 μM upstream primers for detecting internal reference genes as shown in the nucleotide sequence of SEQ ID NO.3, 0.3 μL of 10 μM downstream primers for detecting internal reference genes as shown in the nucleotide sequence of SEQ ID NO.4, 1 μL of 10 μM upstream primers for early identification of the sex of Gyantse seabuckthorn as shown in the nucleotide sequence of SEQ ID NO.1, 1 μL of 10 μM downstream primers for early identification of the sex of Gyantse seabuckthorn as shown in the nucleotide sequence of SEQ ID NO.2, and 11.4 μL of ddH2O.

[0011] Furthermore, the kit for early identification of the sex of Gyantse seabuckthorn uses PCR amplification and agar electrophoresis detection to perform early identification of the sex of Gyantse seabuckthorn.

[0012] Furthermore, the PCR amplification procedure includes: pre-denaturation at 95°C for 3 minutes; denaturation at 94°C for 15 seconds, annealing at 56°C for 15 seconds, extension at 72°C for 30 seconds, for a total of 30 cycles; and extension at 72°C for 5 minutes.

[0013] Further, if the Gyantse seabuckthorn sample to be tested has a 302bp amplified fragment and a 528bp amplified fragment in the agar electrophoresis detection, then the Gyantse seabuckthorn sample to be tested is a male plant; if the Gyantse seabuckthorn sample to be tested has only a 302bp amplified fragment in the agar electrophoresis detection, then the Gyantse seabuckthorn sample to be tested is a female plant.

[0014] In a third aspect, the present invention provides a system for early identification of the sex of Jiangzi seabuckthorn, comprising a DNA extraction module, a PCR amplification module and an agar electrophoresis detection module;

[0015] The DNA extraction module is used to extract genomic DNA from the Jiangzi seabuckthorn sample to be tested;

[0016] The PCR amplification module is used to perform PCR amplification on the extracted genomic DNA of the Gyantse seabuckthorn sample to be tested using the primer pair for early identification of the sex of Gyantse seabuckthorn or the kit for early identification of the sex of Gyantse seabuckthorn;

[0017] The agar electrophoresis detection module is used to perform agar electrophoresis detection on the product after PCR amplification to obtain the identification result.

[0018] Furthermore, the identification result includes that if the Gyantse seabuckthorn sample to be tested has a 302bp amplified fragment and a 528bp amplified fragment in the agar electrophoresis test, the Gyantse seabuckthorn sample to be tested is a male plant; if the Gyantse seabuckthorn sample to be tested has only a 302bp amplified fragment in the agar electrophoresis test, the Gyantse seabuckthorn sample to be tested is a female plant.

[0019] In a fourth aspect, the present invention provides the use of the primer pair for early identification of the sex of Gyantse seabuckthorn or the kit for early identification of the sex of Gyantse seabuckthorn in the preparation of a Gyantse seabuckthorn sex identification reagent.

[0020] The beneficial effect of the present invention is that the present invention successfully constructs a primer pair for sex detection of Jiangzi seabuckthorn, realizes early screening for sex identification of Jiangzi seabuckthorn, and overcomes the problem of long sex identification period caused by long fruiting period of Jiangzi seabuckthorn. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 This is a diagram for identifying the sex determination region of the genome of the male plant of Hippophae rhamnoides L. in Jiangzi in the embodiment of the present invention.

[0022] Figure 2 The figure is a graph showing the electrophoresis results of 20 samples of sea buckthorn from Jiangzi to be tested in the embodiment of the present invention. DETAILED DESCRIPTION

[0023] The present invention is further described in detail below in conjunction with specific embodiments.

[0024] It should be noted that these embodiments are only used to illustrate the present invention rather than to limit the present invention. Simple improvements to the method based on the concept of the present invention all fall within the scope of protection claimed by the present invention.

[0025] Example 1

[0026] Construction of primer pairs for sex identification of Hippophae rhamnoides L. in Gyangze

[0027] 1.1 Test materials

[0028] Genome sequencing sample: A male leaf from a plant of Hippophae rhamnoides L., Elaeagnaceae.

[0029] Resequencing samples: 82 individuals collected from different populations, including 53 females and 29 males.

[0030] 1.2 Test methods

[0031] Extraction of genomic DNA from the samples of seabuckthorn in Jiangzi to be tested

[0032] Weigh ≤100 mg of fresh or frozen leaves, roots, stems or flowers and place them in a 2 mL grinding tube, add grinding beads, quickly place them in liquid nitrogen, and grind the samples with a grinder after quick freezing. Then use the Hipure SF Plant DNA Mini Kit from Beijing Meijimei Biotechnology Co., Ltd. to extract the genomic DNA of the tested Jiangzi Hippophae rhamnoides samples, perform electrophoresis on the obtained DNA with 1% agarose gel to detect purity, and use an ultraviolet spectrophotometer (NanoDrop micro-spectrophotometer from Thermo Fisher) to detect DNA concentration, and then place them in a -20 degree refrigerator for later use.

[0033] Genome sequencing and assembly of male Hippophae rhamnoides L. in Gyangze

[0034] An adult male plant of Hippophae rhamnoides Lhasa, Tibet was selected. After genomic DNA was extracted using the above method, the genome was sequenced using the Single Molecule Real Time (SMRT) sequencing technology of the Sequel II platform of PacBio, USA, and a total of 27,259,027 reads (hifi reads) were obtained, with a total data volume of 421.64G. The genome was assembled and typed using Hifiasm software, and two haploid genomes of the male plant of Hippophae rhamnoides Lhasa, with sizes of 1.287G (hap1) and 1.261G (hap2), respectively.

[0035] Identification of the Sex Determining Region (SDR) of Hippophae rhamnoides L. in Gyangze

[0036] A total of 82 leaf samples from 53 female and 29 male plants of Hippophae rhamnoides L. in Jiangzi were resequenced using the Illumina platform. After removing low-quality sequences and adapter sequences from the resequencing data, the high-quality sequences were aligned to the assembled genome of the male plants of Hippophae rhamnoides L. in Jiangzi using the BWA software. Low-quality reads were removed using the Samtools software, and only unique alignment sequences were retained. Single nucleotide polymorphism (SNP) sites, short insertion and deletion markers (InDels), and multiple nucleotide polymorphisms in the sequences were identified using the Freebayes (v0.9.1061) software. Freebayes set the parameter "-use-best-n-alleles6" to limit the total number of alleles at each site. Plink (v1.962) software was used to set the parameters "-maf0.05-geno0.1" to screen variant SNPs at the population level, and QCTool (v2.0.1) software was used to convert them into gene dosage files. Then, GEMMA (v0.98.1) software was used to perform a SNP-based genome-wide association study (GWAS) between SNPs and sex phenotypes using a linear mixed model (LMM). Figure 1 As shown in the figure, with -log10(Pvalue)>10 as the threshold, a candidate region on chromosome 2 that was highly correlated with sex was identified and defined as the sex determining region (SDR) of Hippophae rhamnoides L. in Gyangze.

[0037] Example 2

[0038] Synthesize specific molecular marker primers

[0039] According to the peak of GWAS analysis ( Figure 1 ), a male-specific DNA fragment was screened in the SDR region of chromosome 2, the chromosome location is chr2_RaGOO:134985201-134985801, and its sequence is shown in SEQ ID NO.5:

[0040] TATGTTGAAAAATGAGAAAAAGGGGTGAGTGAAGTGATAAAGTTTTTGAAACATTTAAGAAAAGTGTTATTTTGATCTAGTTTCTCGCGTTTGGAAGGTTTTTTTGTGTTTAAAACTTACACGGGTTGCGGCACACAAAATCATGTCATA ATGAAAATAAATCCCTAGAATCCAACTTGAGACTAGTGTGCCAATGCACACTTAAAATCATGTCACCATGCAAACTAAGCATTATGGCATTGTGGACACAAACTTATCAGTGATGCATAAATAAAAGTTCTAAATTTTTTTCTTTCCAA AATTCCAATTTCGCCAAATTTAATCAAAAATCTAAAAAAATATGAATGAATAAGAATGGCTATTGAAAAAAGTTACTAAATAAAAATAGTATTCGATGATAATGCATCATTCACCCCAACCTAAGTCCAGTAATGTCCGCATTACAATCA AATGAAAAAAATAACAAAACATAATAGTAAATATAAAATGAATTAAAAACTAATGTTCAATTGAAAGTAAAATAAAAAATCAATGGGTTTAATCCCATATAGGGCTTGTTTAACGTCGTCAGCCCGATGGATGTAACTTATAGCAGATGTT

[0041] According to the characteristics of the fragment, primer5 software was used to design and synthesize specific amplification primer pairs. The primer design principles were as follows: primer length was 18bp-25bp, GC content was 40%-60%, Tm was 55℃-65℃, and primer amplification length was 400-1100bp. A pair of primers, HySDR-F and HySDR-R, were designed, and their sequences were shown in SEQ ID NO.1 and SEQ ID NO.2, respectively, as shown in Table 1. At the same time, the AtActin8 internal reference gene of Arabidopsis thaliana was used as the reference gene, and the blast function of Tbtools software (e value≤1e-5) was used to align the homologous gene in the genome of Hippophae rhamnoides L. as the actin gene (HyActin8) of Hippophae rhamnoides L. in Gyangze. According to the DNA sequence of the HyActin8 gene, the primer pair HyActin8-F and HyActin8-R were designed, and their sequences were shown in SEQ ID NO.3 and SEQ ID NO.4, respectively, as shown in Table 1.

[0042] Table 1 Primer sequence list

[0043]

[0044] Example 3

[0045] Identification of male and female individuals of Hippophae rhamnoides L. in Gyangze

[0046] 1.1 Extraction of sample genomic DNA

[0047] The leaves, roots or stems of the plants were collected, and the method described in Example 1 was used to extract and detect the genomic DNA of the individual plants.

[0048] 1.2 PCR amplification

[0049] PCR amplification was performed using the primer pair and kit described in Example 2. The reaction system is shown in Table 2.

[0050] Table 2 PCR amplification reaction system

[0051]

[0052]

[0053] Reaction procedure: pre-denaturation at 95°C for 3 minutes; denaturation at 94°C for 15 seconds, annealing temperature at 56°C for 15 seconds, extension at 72°C for 30 seconds, for a total of 30 cycles; extension at 72°C for 5 minutes.

[0054] The product was detected by electrophoresis on 1.0% agarose gel, observed under ultraviolet light and photographed to record the results.

[0055] 1.3 Determination of the sex of Gyangze seabuckthorn

[0056] The individuals that obtained two bands of 302 bp and 528 bp in length by PCR amplification in genomic DNA using the above two primer pairs were male plants of Hippophae rhamnoides L., and the individuals that obtained only a band of 302 bp in length but no band of 528 bp in length were female plants of Hippophae rhamnoides L.

[0057] Example 4

[0058] The genomic DNA extracted in Example 1 was used as a template, and the primers designed in Example 2 were used to perform amplification detection according to the PCR amplification method in Example 3. The electrophoresis results of the 20 samples of seabuckthorn in Jiangzi to be tested are as follows: Figure 2 shown.

[0059] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit it. Although the present invention has been described with reference to the preferred embodiments of the present invention, it should be understood by those skilled in the art that various changes may be made in form and details without departing from the spirit and scope of the present invention as defined in the appended claims.

Claims

1. A kit for early identification of the sex of Gyantse seabuckthorn, characterized in that: Includes primer pairs for early identification of sex of Hippophae rhamnoides L. in Gyangze; The nucleotide sequences of the primer pair are shown in SEQ ID NO.1 and SEQ ID NO.2; The primer pair also includes a primer pair for detecting an internal reference gene, and the nucleotide sequence of the primer pair for detecting an internal reference gene is shown in SEQ ID NO.3 and SEQ ID NO.4; The kit for early identification of the sex of Jiangzi seabuckthorn uses PCR amplification and agar electrophoresis detection to perform early identification of the sex of Jiangzi seabuckthorn; If the agar electrophoresis test of the Jiangzi seabuckthorn sample shows a 302bp amplified fragment and a 528bp amplified fragment, the Jiangzi seabuckthorn sample to be tested is a male plant; if the agar electrophoresis test of the Jiangzi seabuckthorn sample to be tested shows only a 302bp amplified fragment, the Jiangzi seabuckthorn sample to be tested is a female plant.

2. The kit for early identification of sex of Gyantse seabuckthorn according to claim 1, characterized in that: The method comprises 15 μL of 2×Rapid Taq Master Mix, 0.3 μL of 10 μM upstream primers for detecting internal reference genes as shown in the nucleotide sequence of SEQ ID NO.3, 0.3 μL of 10 μM downstream primers for detecting internal reference genes as shown in the nucleotide sequence of SEQ ID NO.4, 1 μL of 10 μM upstream primers for early identification of the sex of Gyantse seabuckthorn as shown in the nucleotide sequence of SEQ ID NO.1, 1 μL of 10 μM downstream primers for early identification of the sex of Gyantse seabuckthorn as shown in the nucleotide sequence of SEQ ID NO.2 and 11.4 μL of ddH2O.

3. The kit for early identification of sex of Gyantse seabuckthorn according to claim 1, characterized in that: The PCR amplification procedure includes: pre-denaturation at 95°C for 3 minutes; denaturation at 94°C for 15 seconds, annealing at 56°C for 15 seconds, extension at 72°C for 30 seconds, for a total of 30 cycles; and extension at 72°C for 5 minutes.

4. A system for early identification of the sex of Gyangze seabuckthorn, characterized in that: It includes a DNA extraction module, a PCR amplification module and an agar electrophoresis detection module; The DNA extraction module is used to extract genomic DNA from the Jiangzi seabuckthorn sample to be tested; The PCR amplification module is used to perform PCR amplification on the extracted genomic DNA of the Gyantse seabuckthorn sample to be tested using the kit for early identification of the sex of Gyantse seabuckthorn according to claim 1; The agar electrophoresis detection module is used to perform agar electrophoresis detection on the product after PCR amplification to obtain the identification result; The identification result includes that if the Jiangzi seabuckthorn sample to be tested has a 302bp amplified fragment and a 528bp amplified fragment in the agar electrophoresis test, the Jiangzi seabuckthorn sample to be tested is a male plant; if the Jiangzi seabuckthorn sample to be tested has only a 302bp amplified fragment in the agar electrophoresis test, the Jiangzi seabuckthorn sample to be tested is a female plant.

5. Use of the kit for early identification of the sex of Gyantse seabuckthorn according to claim 1 in the preparation of a reagent for sex identification of Gyantse seabuckthorn.

Images