A rhizosphere fungus B-5 that promotes the accumulation of secondary metabolites of Bletilla striata and its application

Abstract

The invention relates to a rhizosphere fungus B‑5 for promoting the accumulation of secondary metabolites of Bletilla striata and an application thereof. A rhizosphere fungus B‑5 (Chaetomium globosum B‑5) is separated and screened from the rhizosphere soil of the medicinal plant Bletilla striata for the first time. The strain plays an important role in the accumulation of secondary metabolites of Bletilla striata, and brings broad application prospects for improving the quality of Bletilla striata medicinal materials.

Description

Technical Field

[0001] The invention belongs to the technical field of microbial application, and specifically relates to a rhizosphere fungus B-5 for promoting the accumulation of secondary metabolites of Bletilla striata and an application thereof. Background Art

[0002] Bletilla striata (Thunb.) Reichb.f. is a perennial herbaceous plant of the Orchidaceae family. It is a plant with rich medicinal and ornamental value. Its dried tubers are used as a traditional Chinese medicine. It has the effects of astringent hemostasis, swelling and tissue regeneration. It is often used for hemoptysis, hematemesis, traumatic bleeding, sores, swelling, skin cracks, etc. It is the raw material for the formulation of various Chinese patent medicines such as Baiji Granules, Weikangling and Baiji Chongji. Baiji mainly contains chemical components such as Baiji polysaccharides, 2-isobutylmalic acid glucose oxybenzyl ester, bibenzyls, phenanthrene, flavonoids, phenylpropanoids, steroids, triterpenes, etc. Among them, the secondary metabolite 1,4-di[4-(glucose oxygen) benzyl]-2-isobutyl malate (Millitarine) is one of the main components of Baiji to exert its medicinal effects. The 2020 edition of the Chinese Pharmacopoeia uses this component as an indicator component for the quality evaluation of Baiji medicinal materials.

[0003] In recent years, due to factors such as over-exploitation, habitat destruction, and low reproduction rate, the wild resources of Bletilla striata are in short supply and have been listed as a second-level protected plant in the National Key Plant List. At present, the traditional Chinese medicine Bletilla striata is basically derived from cultivation. Affected by the complex soil environment, the properties and medicinal quality of Bletilla striata vary greatly under different cultivation environments, especially the active ingredient 1,4-di[4-(glucose oxygen) benzyl]-2-isobutyl malate (Militarine). The content of Bletilla striata glycosides varies by 5.4 times between the various production areas in Guizhou alone, which largely causes the instability of clinical medication. Rhizosphere microorganisms play a vital role in the health and production of medicinal plants. Beneficial rhizosphere microorganisms can promote the growth of medicinal plants, enhance resistance, and promote the synthesis of secondary metabolites. Most orchid plants have an interactive relationship with rhizosphere microorganisms, and some rhizosphere microorganisms can promote the synthesis of secondary metabolites of orchid plants. Discovering beneficial microorganisms that promote the synthesis of 1,4-di[4-(glucose oxygen)benzyl]-2-isobutylmalate (Millitarine), a secondary metabolite of Bletilla striata, has a good application prospect in improving Bletilla striata production and resource utilization.

[0004] The inventors found that the synthesis of secondary metabolites of Bletilla striata was affected by soil microorganisms. Therefore, in order to better ensure the quality of Bletilla striata medicinal materials, the inventors screened out the rhizosphere fungus B-5 that can promote the synthesis of secondary metabolites of Bletilla striata. Summary of the invention

[0005] The invention aims to provide a Bletilla striata rhizosphere fungus B-5.

[0006] Another object of the present invention is to provide an application of a Bletilla striata rhizosphere fungus B-5 in the preparation of a product promoting the accumulation of secondary metabolites of Bletilla striata.

[0007] Another object of the present invention is to provide an application of a Bletilla striata rhizosphere fungus B-5 in the preparation of a product improving the quality of Bletilla striata.

[0008] The bletilla striata rhizosphere fungus B-5 described in the present invention is classified and named Chaetomium globosum B-5, and was deposited in the China Center for Type Culture Collection on September 12, 2023, with a preservation number of CCTCC NO: M 20231687.

[0009] The invention discloses an application of the bletilla striata rhizosphere fungus B-5 in preparing a product for promoting the accumulation of secondary metabolites of bletilla striata.

[0010] Preferably, the Bletilla striata rhizosphere fungus B-5 described in the present invention is used to promote the growth and quality of Bletilla striata products.

[0011] The present invention has the following beneficial effects:

[0012] 1. The present invention is the first to isolate and screen a rhizosphere fungus B-5 (Chaetomium globosum) from the rhizosphere soil of the medicinal plant Bletilla striata. The strain plays an important role in the accumulation of secondary metabolites of Bletilla striata, bringing broad application prospects for improving the quality of Bletilla striata.

[0013] 2. After the B-5 strain was inoculated on the modified CAS agar / siderophore detection medium, an orange halo appeared around the strain on the 5th day, indicating that B-5 has the ability to synthesize siderophores. The fermentation liquid of fungus B-5 mixed with CAS colorimetric solution showed a red reaction, and the color of sterile culture liquid mixed with CAS was dark blue. This shows that fungus B-5 has the ability to synthesize siderophores.

[0014] 3. The SU of strain B-5 was 91.85%, and the As / Ar value was less than 0.5, indicating that this strain was a high-yield iron carrier strain.

[0015] 4. After 90 days of planting, the content of Militarine in the tubers of Bletilla striata after inoculation of the fermented liquid of B-5 strain in the soil was significantly higher than that in the control group. The results showed that the rhizosphere fungus B-5 can promote the increase of Militarine content in Bletilla striata.

[0016] Storage information description:

[0017] The isolated strain was named Chaetomium globosum B-5.

[0018] Preservation unit: China Center for Type Culture Collection (CCTCC for short).

[0019] Storage address: No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province, Postal Code: 430072.

[0020] Date of preservation: September 12, 2023.

[0021] Deposit number: CCTCC NO: M 20231687. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 Colony morphology of Bletilla striata rhizospheric fungus B-5.

[0023] Figure 2 Detection of the iron carrier synthesis ability of the active strain of Bletilla striata rhizospheric fungus B-5.

[0024] Figure 3 Militarine content in symbiotic culture of sterile Bletilla striata seedlings and rhizospheric fungus B-5 (15 days after planting).

[0025] Figure 4 Phylogenetic relationships of rhizospheric fungi of Bletilla striata and its similar fungi.

[0026] Figure 5 Schematic diagram of potted inoculation experiment

[0027] Figure 6 Analysis of Militarine Content in Tubers of Bletilla striata Inoculated with B-5 Fermentation Broth DETAILED DESCRIPTION

[0028] The technical solution of the present invention is further described in detail below through specific embodiments.

[0029] Example 1: Isolation, screening and identification of strains

[0030] 1. Isolation of strains

[0031] Test materials: The rhizosphere soil of Bletilla striata was collected from the test site.

[0032] Culture medium: 1000mL potato dextrose agar medium (PDA medium): PDA medium contains 200g potato, 20g glucose, 15g agar, 100mg / L streptomycin 1mL, and the pH value of the culture medium is natural pH. 1000mL CAS agar / siderophore detection medium: weigh 166.24g CAS agar (30.24g piperazine diethanol sulfonic acid (100g glucose, 20g peptone, 0.5g magnesium sulfate heptahydrate, 0.5g calcium chloride, 15g agar powder), 10×CAS detection solution (0.06g CAS, 0.0027g FeCl3 6H 2 O, 0.073g HDTMA). 1000mL MS medium: weigh 4.74g MS medium powder, 20g sucrose, dissolve in 1000mL pure water, and adjust pH to 5.84-5.88.

[0033] Rhizosphere soil: The rhizosphere soil was taken from the roots of Bletilla striata planted in sandy loam for 2 years. The top 2-3 cm of soil and weeds were removed. After the Bletilla striata was uprooted, the large pieces of soil attached to the roots were gently shaken off, leaving only about 1-2 mm of soil tightly attached to the roots. After rapid transportation to the laboratory at 4°C, the rhizosphere soil was gently brushed off with a soft brush. The taken rhizosphere soil was evenly mixed and divided into 3 portions, quickly frozen with liquid nitrogen and stored in a -80°C refrigerator.

[0034] Soil suspension: weigh about 10 g of rhizosphere soil from Bletilla striata and put it into a 250 mL sterile conical flask. Add 90 mL of sterile water and shake it in a shaking incubator at 28°C for 30 min to support the soil suspension. Pipette 0.5 mL of soil suspension into a centrifuge tube containing 4.5 mL of sterile water to make a concentration of 10 -1 Soil suspension was diluted to 10 -2 , 10 -3 , 10 -4 50 μL of soil suspension of different concentrations was taken and spread evenly on the PDA plate medium, and cultured in a constant temperature incubator at 28°C for 3 to 7 days, during which the growth of the colony was observed.

[0035] Isolation and purification of strains: Observe the growth of colonies in the soil suspension-coated culture medium. Once fungal colonies grow, pick up the hyphae at the edge of a single colony with a sterile toothpick and inoculate it into a new PDA plate culture medium for cultivation. Repeat the transfer until a single colony appears.

[0036] The isolated rhizosphere fungi were inoculated into PDA plates and cultured at 28°C for 3 to 7 days before use.

[0037] 2. Screening

[0038] Symbiotic culture of sterile Bletilla striata seedlings and rhizospheric fungi was used to conduct a preliminary screening of the life-promoting properties of the rhizospheric fungi of the Bletilla striata.

[0039] Fungal fermentation liquid: The isolated rhizosphere fungi of Bletilla striata were inoculated into 150 mL of PDA liquid and cultured in a constant temperature shaking incubator at 28°C and 180 rpm for 7 days. The fungal hyphae and the fermentation liquid were separated by sterile gauze, and the fermentation liquid was retained.

[0040] Prepare MS liquid culture medium in advance, put a circle of filter paper with a width of about 3cm in a 250mL tissue culture bottle, close to the bottle wall. Each tissue culture bottle is filled with 50mL of culture medium, and sterilized at 121℃ for 20min. Take a one-year-old Bletilla striata tissue culture seedling, cut off the leaves and roots of Bletilla striata with sterile scissors, wash away the residual culture medium with sterile water, and use sterile filter paper to absorb the water; select Bletilla striata tubers of the same size, soak them in 75% alcohol for 1min, rinse them with sterile water 2-3 times, soak them in 0.1% HgCl solution for 4min, and rinse them with sterile water 3-4 times. Prepare MS liquid culture medium, PH = 5.84-5.88, add 50mL MS liquid culture medium and filter paper with a length of 30cm and a width of about 3cm in the tissue culture bottle, make the filter paper close to the wall of the tissue culture bottle, and sterilize at 121℃ for 20min. In the clean bench, use sandwich filter paper for culture, place the sterilized Bletilla tubers in the sandwich between the tissue culture bottle wall and the filter paper, and fix them. Inoculate 4 Bletilla tubers in each bottle, and finally add 3 mL of strain fermentation liquid to each bottle. Add sterile PDB culture medium cultured under the same conditions of shaking to the control group (CK), and inoculate 10 bottles in each group. Place in the light culture room for culture, the temperature is 23-25℃, the light time is 8-12h per day, and the light intensity is 2000-3000Lux. Regularly observe the growth of Bletilla striata tissue culture seedlings. After 15 days of continuous culture, take out the Bletilla striata control seedlings and experimental seedlings, absorb the water with filter paper, and detect the content of Militarine in the Bletilla striata tubers (see Table 1, Figure 3 ).

[0041] Refer to the processing method of Bletilla striata in the 2020 edition of the Chinese Pharmacopoeia, remove the fibrous roots, wash, place in boiling water and cook until the heart is white, remove the skin after drying (drying), and dry at 60°C; and grind the dried Bletilla striata into powder in a mortar, pass through a No. 3 sieve, and set aside. Preparation of test solution: Take about 0.05g of Bletilla striata powder, accurately weigh, add 25mL of 50% ethanol to extract, accurately weigh the weight, perform ultrasound for 30 minutes, accurately weigh after cooling slightly, make up the missing weight with 50% ethanol, filter, and take the filtrate through a 0.45μm filter membrane to obtain the test solution. Preparation of reference solution: Take an appropriate amount of Militarine reference substance, accurately weigh, and add 50% ethanol to make a 1mL solution containing 0.163mg. Chromatographic conditions (octadecylsilane bonded silica gel as filler, acetonitrile-0.1% phosphoric acid solution (22:78) as mobile phase, isocratic elution, detection wavelength at 223 nm.

[0042] Table 1 Militarine content in Bletilla striata

[0043]

[0044] The results showed that one rhizospheric fungus that promoted the accumulation of secondary metabolites in Bletilla striata was obtained and was named B-5.

[0045] 3. Identification

[0046] (I) Morphological characteristics of strains

[0047] Observation of bacterial morphological characteristics: Inoculate the endophytic fungus strain B-5 to be identified on PDA medium and culture at 28°C. Observe its culture characteristics and color changes on the 3rd, 7th and 15th days. Observe the stable and mature color characteristics as its culture characteristics and as the basis for identification. Observe and record the color of aerial hyphae, and the size, color, tissue shape, surface shape, etc. of the colony as reference characteristics.

[0048] like Figure 1 As shown, the morphological characteristics of the colonies are: on the PDA culture medium, the colonies are round, the hyphae in the culture medium are filamentous and radiant, producing brown pigments, and the aerial hyphae are white and cotton-like.

[0049] (II) ITS sequence and phylogenetic analysis of strains

[0050] Preparation of DNA template

[0051] Reagents: Lysis Buffer solution: Trish-HCl (12.44 g), NaCl (81.816 g), Na2EDTA (7.45 g), CTAB (20 g), DIECA (1 g), PVPK-30 (200 mg), β-mercaptoethanol (2 mL), constant volume 1000 mL, adjust pH = 8.0. PCI solution (25:24:1): balanced phenol (250 mL), chloroform (240 mL), isoamyl alcohol (10 mL). CI solution (24:1): chloroform (240 mL), isoamyl alcohol (10 mL).

[0052] DNA extraction

[0053] Take an appropriate amount of mycelium in a 2mL EP tube, add 1000μL Lysis Buffer solution, add a steel ball, grind in a sample tissue grinder for 5min, take it out and let it stand for 10min, and centrifuge at 12000r / min for 10min. Aspirate the supernatant and add an equal volume of PCI solution, shake slowly for 2-3min, and centrifuge at 12000r / min for 10min. Aspirate the supernatant and add an equal volume of CI solution for extraction, shake slowly for 2-3min, and centrifuge at 12000r / min for 10min. Aspirate the supernatant in a 1.5mL EP tube, add 800mL of anhydrous ethanol, shake slowly for 2-3min, and centrifuge at 12000r / min for 10min. Pour out the supernatant, add 750μL75% ethanol, and centrifuge at 12000r / min for 3min. Pour out the supernatant, dry at room temperature, and add 30-50μL ddH 2O to dissolve.

[0054] (1) PCR instrument: C1000 Touch™ Thermal Cycler (BIO-RAD, USA).

[0055] (2) Amplification primers: ITS1 (5'-TCCGTAGGTGAACCTGCGG-3') and ITS4 (5'-TCCTCCGCTTATTGATATGC-3').

[0056] (3) Amplification system: The ITS sequence PCR amplification system is shown in Table 2.

[0057] Table 2 ITS sequence PCR amplification system

[0058]

[0059] The PCR reaction conditions are shown in Table 3.

[0060] Table 3 PCR reaction conditions

[0061]

[0062] Note: Step 2 was performed for 35 cycles.

[0063] Electrophoresis detection of PCR amplification products:

[0064] The electrophoresis conditions were 1% agarose gel (containing 0.8 g agarose, 90 mL TAE buffer), 1X TAE electrophoresis buffer, 360 V for 15 min, and 1 μL of PCR product was loaded, mixed with 1 μL Loading Buffer and then spotted.

[0065] Observe the results under the UV light of the gel imaging system, and use the 2000 DNA Marker as the nucleic acid standard molecular weight reference to determine the length of the amplified fragment. The amplified product band should be at the position of 400-700bp of the standard.

[0066] PCR product purification and sequencing: performed by Shanghai Bioengineering.

[0067] Construction of phylogenetic tree:

[0068] Log in to NCBI, compare the fungal rDNA ITS sequence obtained by sequencing with the sequence in the GenBank database, record its accession number, most similar strain, similarity, etc., and download the rDNA ITS sequence of the strain, use MEGA7 to perform cluster analysis and construct a phylogenetic tree. The ITS sequence table of B-5 is shown.

[0069] The rDNA ITS sequence was compared with BLAST homology in GeneBank to obtain the representative strain with the highest similarity, and its accession number, most similar strain, similarity, etc. were recorded. The rDNA ITS sequence of the strain was downloaded and a phylogenetic tree was constructed (e.g. Figure 4 The strains with the highest similarity to strain B-5 are shown in Table 4.

[0070] Table 4 The strains most similar to fungus B-5

[0071]

[0072] A 500-600 bp fragment was amplified from the genomic DNA of the strain using primers ITS1 and ITS4, and the sequencing results were compared using BLAST in GenBank.

[0073] The results showed that strain B-5 had high base sequence similarity with fungi in the genus Chaetomium, so the reference strain sequence of the genus Chaetomium was downloaded from GenBank for phylogenetic analysis, with Chaetomium globosum (MF682405.1) in the genus Chaetomium as the outgroup. In the constructed phylogenetic tree, B-5 ​​and multiple strains of Chaetomium globosum clustered together to form a terminal branch with a support strength of 100%.

[0074] The comparison of base similarity results showed that the base sequence similarity between B-5 and Chaetomium fungi was more than 99%. Therefore, based on the comprehensive morphological and molecular biological characteristics, the B-5 strain was preliminarily identified as Chaetomium globosum.

[0075] Example 2: Detection of growth characteristics of active strains

[0076] 1. Detection of the iron-loving ability of active strain B-5

[0077] Prepare 1000mL of modified CAS agar / siderophore detection medium, weigh 166.24g of CAS agar, add 900mL of pure water to dissolve, adjust pH to 6.8±0.2, sterilize at 121℃ for 20min, cool to 50-60℃, slowly add 100mL of CAS detection solution along the bottle wall, mix evenly without generating bubbles, and pour the plate. Inoculate the activated strain into the modified CAS agar / siderophore detection medium, culture at 28℃ for 3-7 days, and observe whether an orange halo is formed around the strain. Cultivate the fermentation broth of the strain, centrifuge the fermentation broth at 12000r / min for 10min, take 2mL of the supernatant, pass it through a 0.22μm microporous filter for sterilization, add 2mL of CAS detection solution, mix well and let it stand for 1h, detect its absorbance at 680nm as Ax, take another 2mL of uninoculated PDB culture medium and 2mL of CAS detection solution and mix them thoroughly as a control group, and detect its absorbance at 680nm as Ay. Calculate the concentration of synthetic iron carriers of the strain, expressed as iron carrier activity units (SU), SU = ((Ay-Ax) / Ay) × 100%. The larger the SU value, the stronger the ability to synthesize iron carriers. Ax / Ay represents the relative content of iron carriers in the culture fluid. The smaller the value, the higher the iron carrier content. Generally, the Ax / Ay of bacteria with high iron carrier production ability is less than 0.5.

[0078] CAS (Chrome azurol S) test solution is a complex composed of chrome azurol sulphonate (CAS), hexadecy-ltrimethyl-ammonium bromide (HDTMA) and iron ions, and is bright blue. When the iron ions in the blue test plate are taken away by the siderophore secreted by microorganisms, an orange halo will be formed around the colony where the microorganism grows. Therefore, CAS agar medium plates can be used for the detection of siderophore production by microorganisms.

[0079] In nature, iron exists mostly in the form of ferrous oxide and ferric hydroxide complexes, which are insoluble and difficult for organisms to utilize. Siderophores are a class of small molecule metal ion chelates produced by microorganisms. 3+ Has strong affinity.

[0080] like Figure 2 As shown in Table 5, after the B-5 strain was inoculated on the modified CAS agar / siderophore detection medium, an orange halo appeared around the strain on the 5th day, indicating that B-5 has the ability to synthesize siderophores. The fermentation liquid of fungus B-5 mixed with CAS color developing solution showed a red reaction, and the color of sterile culture liquid mixed with CAS was dark blue. This shows that fungus B-5 has the ability to synthesize siderophores (as shown in Table 5).

[0081] Table 5 Quantitative detection of siderophore production by strains

[0082]

[0083] As shown in Table 5, the SU of strain B-5 was 91.85%, and the As / Ar value was less than 0.5, indicating that the strain was a high-producing siderophore strain.

[0084] Example 3: Potted plant inoculation experiment

[0085] Experimental method: Inoculate B-5 in PDB culture medium, oscillate in a constant temperature shaking incubator at 28°C and 180rpm / min for 7 days, and use sterile gauze to filter the fermentation liquid for later use. Set up 20 parallel pots in each group, including 10 pots in the CK group and 10 pots in the strain treatment. Add soil matrix to 2 / 3 of each pot. Take sterile seedlings of Bletilla striata with the same source and growth (only keep the tuber part), disinfect them with 75% alcohol and 0.1% HgCl solution, and plant 3 Bletilla striata seedlings in each pot according to the soil covering depth of 3cm. Finally, add 2mL of B-5 strain fermentation liquid around each Bletilla striata (once a week), and the CK control group uses PDB culture medium without inoculation of strains treated under the same conditions. Cover the pots with plastic wrap to prevent contamination by miscellaneous bacteria in the air, and mark each pot ( Figure 5 ). Cultivate in a lighted culture room. The ambient temperature should be controlled at 23-25°C and the humidity should be controlled at 40%-50%. Provide 12 hours of light per day. Irrigate with sterile water weekly according to specific growth requirements. Implement artificial pest control measures. Figure 5

[0086] Experimental results: Figure 6 As shown, after 90 days of planting, the content of Militarine in the tubers of Bletilla striata after inoculation of the fermented liquid of B-5 strain in the soil was significantly higher than that in the control group. The results showed that the rhizosphere fungus B-5 can promote the increase of Militarine content in Bletilla striata.

[0087] In summary, the endophytic fungus strain B-5 of Bletilla striata has a strong ability to promote the accumulation of secondary metabolites of Bletilla striata and has the ability to synthesize iron carriers. Therefore, in terms of ecological cultivation of Bletilla striata, the rhizosphere fungus strain B-5 of Bletilla striata has the potential to significantly promote the quality formation of Bletilla striata.

[0088] The embodiments described in the present invention are merely descriptions of the preferred implementation modes of the present invention, and are not intended to limit the concept and scope of the present invention. Without departing from the design concept of the present invention, various modifications and improvements made to the technical solutions of the present invention by those skilled in the art should all fall within the protection scope of the present invention.

[0089] Sequence Listing

[0090] GGGGGATTCGGGTTGCAAACTCCCTAACCATTGTGAACGTTACCTATACCGTTGCTTCGGCGGGCGGCCCCGGGGTTTACCCCCCGGGCGCCCCTGGGCCCCACCGCGGGCGCCCGCCGGAGGTCACCAAAC TCTTGATAATTTATGGCCTCTCTGAGTCTTCTGTACTGAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGT GAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCATCAAGCCCCCGGGCTTGTGTTGGGGACCTGCGGCTGCCGCAGGCCCTGAAAAGC AGTGGCGGGCTCGCTGTCGCACCGAGCGTAGTAGCATACATCTCGCTCTGGTCGCGCCGCGGGTTCCGGCCGTTAAACCACCTTTTTAACCCAAGGTTGACCTCGGATCAGGTAGGAAGACCCGCTGAACTTA AGCATATCAAAAGGCGGAGGAA

[0091] The embodiments described in the present invention are merely descriptions of the preferred implementation modes of the present invention, and are not intended to limit the concept and scope of the present invention. Without departing from the design concept of the present invention, various modifications and improvements made to the technical solutions of the present invention by those skilled in the art should all fall within the protection scope of the present invention.

Claims

1. A Chaetomium globosum B-5 rhizosphere fungus that promotes the accumulation of secondary metabolites of Bletilla striata, characterized in that: The strain was named: Chaetomium globosum B-5, and was deposited in the China Center for Type Culture Collection (CCTCC) with a deposit number of CCTCCNO: M 20231687.

2. The use of Chaetomium globosum B-5 for promoting the accumulation of secondary metabolites of Bletilla striata according to claim 1, characterized in that: Application of Chaetomium globosum B-5, a rhizospheric fungus of Bletilla striata, in promoting the increase of Militarine content in Bletilla striata.

Images