A capss specific primer pair for identifying materials with easy detachability of pepper mature fruit and fruit stalk, and a method for identifying the same
By designing CAPS-specific primer pairs for chili peppers, the trait of easy separation between mature fruit and pedicel can be identified using SNP sites. This solves the problem of difficulty in separating chili pepper fruit and pedicel, enabling efficient identification and mechanized harvesting, and improving economic benefits.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- INSTITUTE OF VEGETABLES & FLOWERS CHINESE ACADEMY OF AGRICULTURAL SCIENCES
- Filing Date
- 2024-08-21
- Publication Date
- 2026-06-19
AI Technical Summary
In existing technologies, the difficulty in separating pepper fruits from their pedicels makes mechanized harvesting challenging, impacting economic yield and production costs. Furthermore, existing molecular markers are significantly influenced by genetic background, making it difficult to effectively identify the trait of easy separation between fruits and pedicels.
A CAPS-specific primer pair for the SNP site located at 228965458 bp on chromosome 10 of pepper was developed. Through PCR amplification and EcoRI digestion, primers were designed using variations in the SNP site to achieve efficient identification of the easily separable trait of mature pepper fruit and pedicel.
This method enables efficient identification of the easily separable fruit and pedicel traits during the chili seedling stage with 100% accuracy, reducing production costs and improving economic benefits.
Smart Images

Figure CN118932101B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of molecular markers, specifically to a CAPS-specific primer pair and identification method for identifying easily separable traits of mature chili fruit and pedicel. Background Technology
[0002] Chili pepper (Capsicum spp.) is an annual or short-lived perennial crop belonging to the genus Capsicum in the family Solanaceae. Chili pepper fruits contain unique capsaicin and capsicum red pigments, and are widely used in primary and advanced processing in the food, feed, and medical industries. With the increasing market demand for processed chili peppers, the ease with which the receptacle separates from the mature fruit will significantly impact the economic yield of chili peppers. Breeding chili pepper varieties with easily separable mature fruits and receptacles will facilitate mechanized harvesting, reduce production costs, and improve economic efficiency.
[0003] The easy separation of mature fruit from the pedicel is a typical trait of wild chili peppers, facilitating seed dispersal by birds. In most chili pepper varieties, the mature fruit, placenta, and pedicel are tightly connected. This is likely due to the selective breeding of chili peppers with easily separable mature fruit and pedicels during domestication to ensure fruit yield. This easy separation of mature fruit from the pedicel is a dominant trait controlled by a single gene. The gene controlling this trait is located on chromosome 10 and is the pectin lyase homolog PG, which affects fruit firmness. A SNP at the 3' splice acceptor site of intron VIII of the PG gene results in a 90-amino acid truncation of the C-terminal region of the PG protein in chili peppers where the mature fruit does not easily detach. Some studies speculate that the restricted function of the truncated PG protein prevents the mature fruit from softening, thus hindering separation of the fruit from the pedicel. Currently, all reported molecular markers related to the gene for easy separation of chili fruit and pedicel are indel markers linked to the PG gene. Their application is significantly affected by the genetic background of different materials. Therefore, it is necessary to develop new practical molecular markers based on key SNPs within the PG gene. Summary of the Invention
[0004] The purpose of this invention is to provide a single-NP (single-parameter) in chili peppers that co-separates from the trait controlling the easy separation of the mature fruit and pedicel.
[0005] Another objective of this invention is to provide CAPS-specific primers for SNPs that control the co-separation of the trait of easy separation between ripening fruit and pedicel in chili peppers.
[0006] Another object of the present invention is to provide a method for identifying materials with the trait of easily separable mature chili pepper fruit from its pedicel.
[0007] According to the SNP in chili peppers of this application that controls the easy separation of mature fruit and pedicel, the SNP is located at 228965458bp on chromosome 10 of the reference genome CM334, where the reference genome base is A and the variant base is G.
[0008] The CAPS-specific primer pairs for chili peppers based on this application, which are related to the SNPs controlling the easy separation of mature fruit and pedicel in chili peppers, include the following primers:
[0009] Pre-primer: F:5'CTCTGCTTACACCGTCAGTA3',
[0010] Back primer: R:5'ACACCTAGTATACAAATCCCCTAAG3'.
[0011] According to the method for identifying the easily separable trait of mature fruit and pedicel of chili pepper material according to this application, the method includes the step of amplifying the sample to be tested using the CAPS-specific primers of the SNP that controls the easily separable trait of mature fruit and pedicel of chili pepper.
[0012] According to the method for identifying the easily separable mature fruit and pedicel of chili pepper material in this application, the PCR amplification product is digested with EcoRI. When the SNP site is the variant base G, the PCR product contains two EcoRI digestion sites, and the product is digested into three fragments with sizes of 330bp, 169bp, and 49bp, respectively. Agarose gel electrophoresis shows two bright bands (330bp and 169bp), indicating that the mature fruit and pedicel of the material are easily separated. When the SNP site is the reference genomic base A, the PCR product contains one EcoRI digestion site, and the product is digested into two fragments with sizes of 499bp and 49bp, respectively. Agarose gel electrophoresis shows one bright band of 499bp, indicating that the mature fruit and pedicel of the material are not easily separated.
[0013] According to the method for identifying the easy separation of mature fruit and pedicel of chili pepper material in this application, when the SNP site base is A, the tensile force required for the separation of mature fruit and pedicel is greater than 30N, and the fruit and pedicel are not easily separated; when the SNP site base is G, the tensile force required for the separation of mature fruit and pedicel is less than 10N, and the fruit and pedicel are easily separated.
[0014] This invention application combines BSA-seq preliminary and fine mapping to locate the gene controlling the easy separation of mature fruit and pedicel on chromosome 10, and clarifies that the SNP at the 3' end splice acceptor site of intron VIII of the PG gene is the variation leading to the easy separation of mature fruit and pedicel. This application utilizes CAPS primers designed based on the SNP variation site. This SNP site has broad application value; the development and utilization of this marker can identify pepper lines with the easy separation of fruit and pedicel at the seedling stage, demonstrating highly efficient identification results. Attached Figure Description
[0015] Figure 1 The results of PCR amplification and enzyme digestion are shown. Figure a: Agarose gel electrophoresis results of PCR amplification; Figure b: Agarose gel electrophoresis results of PCR amplification products after enzyme digestion; Figures 1-6 are materials of mature fruit and pedicel that are not easily separated; Figures 7-12 are materials of mature fruit and pedicel that are easily separated; M, marker D2000. Detailed Implementation
[0016] Example 1
[0017] Fruit detachment force (FDF) was measured in the *Solanum melongata*, Ac1979, and (Ac1979 × *Solanum melongata*) F2 populations (360 plants). Phenotypes were categorized into two types: those with easily separable mature fruits and pedicels and those with difficult separability. Four parental pools were established: one with easily separable mature fruits and pedicels (Ac1979), one with difficult separability (*Solanum melongata*), one pool of 30 single plants with easily separable mature fruits and pedicels (DQ), and one pool of 30 single plants with difficult separability (ND-Q). Resequencing was performed, and the sequencing data were quality checked.
[0018] Using the chili pepper CM334 (Kim et al., 2014) genome as a reference genome, BWAmen algorithm version 0.7.17 (Qin et al., 2014) was used for alignment, filtering out reads with an alignment quality of less than 30. Variation detection was performed using GATK software (Bathke & Luhken, 2021), extracting variant sites with a quality value greater than 70, a site coverage depth greater than 5, and parental genotypic differences. A total of 14,480,011 valid SNP sites were obtained for BSA analysis. The SNP-index values for easily separable pools (DQ) and difficult-to-separate pools (ND-Q) of mature fruit and pedicel within each chromosomal region were calculated to obtain the Δ(SNP-index) value, ultimately locating a 2Mb significantly associated region on chromosome 10.
[0019] Recombinant plants were screened within a 2Mb significantly associated region using parental resequencing data and an expanded F2 population (1083 plants). Fruit abscission strength was measured in these recombinant plants to determine the easy separability phenotype between the fruit and pedicel. The results precisely identified the pectin lyase homolog PG as the candidate gene controlling the easy separability of the mature fruit receptacle. Furthermore, the SNP at the 3' splice acceptor site of intron VIII of the PG gene was verified as the variant leading to the easy separability of the mature fruit and pedicel. The physical location of this SNP is at chromosome 10, position 228,965,458 bp, with base A in the reference genome and base G as the variant.
[0020] CAPS primers were designed for the SNP site Chr10:228965458. The front primer was F:5'CTCTGCTTACACCGTCAGTA3' and the back primer was R:5'ACACCTAGTATACAAATCCCCTAAG3'.
[0021] The PCR amplification product of the above primers is 548 bp, such as Figure 1 Figure a shows the marker D2000. The PCR product was digested with EcoRI. When the SNP site was the reference genomic base A, the PCR product contained one EcoRI site, resulting in two fragments: 499 bp and 49 bp. A bright band (499 bp) was observed on agarose gel electrophoresis, while the 49 bp fragment was not clearly visible. Figure 1 Lanes 1-6 of Figure b. When the SNP site is the variant base G, the PCR product contains two EcoRI restriction sites, and the product is digested into three fragments with sizes of 330bp, 169bp, and 49bp, respectively. Agarose gel electrophoresis shows two bright bands (330bp and 169bp), as shown below. Figure 1 Lanes 7-12 in diagram B.
[0022] Molecular markers indicating easy separation of the receptacle from mature fruits were used to verify that the parents were an F2 population exhibiting both easy and difficult separation of the receptacle from mature fruits. A 1cm sample of young leaves from a single plant in the population was collected. 2 DNA was extracted. 5 μL of PCR product or 7 μL of enzyme digestion product was loaded onto the sample. A D2000 bp DNA ladder was used as a standard to indicate molecular weight. Electrophoresis buffer was 0.5×TBE, and the electrophoresis was performed at a constant voltage of 180V for 25 min. After electrophoresis, the gel was developed under a BIO-RAD UV gel imaging system, and polymorphic bands were statistically analyzed.
[0023] The F2 population comprised 192 individual plants. In the field, 146 samples showed easy separation of mature fruit from the receptacle; their PCR products, after EcoRI digestion and gel electrophoresis, all showed fragments of 330 bp and 169 bp. The remaining 46 samples showed difficulty in separating mature fruit from the receptacle; their PCR products, after EcoRI digestion and agarose gel electrophoresis, all showed a fragment of only 499 bp. Using this CAPS marker to verify the easy separation of mature fruit receptacles in this F2 population of 192 individual plants, the accuracy rate was 100%.
[0024] The above embodiments are only used to understand the technical solutions of this application and do not limit the scope of protection of this application.
Claims
1. A method for identifying materials of hot pepper having a trait of easy separation of mature fruit from fruit stalk, characterized in that, The method includes the following steps: Genomic DNA was extracted from the material to be tested and PCR amplified using CAPS-specific primer pairs associated with SNPs that control the easy segregation of ripe fruit and pedicel in peppers. The CAPS-specific primer pairs included the following primers: Pre-primer: F: 5'CTCTGCTTACACCGTCAGTA3', Back primer: R: 5'ACACCTAGTATACAAATCCCCTAAG3'; The PCR amplification product was digested with EcoRI. If the PCR product had two EcoRI restriction sites, the product was digested into three fragments with sizes of 330bp, 169bp, and 49bp, respectively. Agarose gel electrophoresis showed two bright bands at 330bp and 169bp, indicating that the mature fruit and pedicel of the tested material were easily separated. If the PCR product had one EcoRI restriction site, the product was digested into two fragments with sizes of 499bp and 49bp, respectively. Agarose gel electrophoresis showed one bright band at 499bp, indicating that the mature fruit and pedicel of the material were not easily separated.
Citation Information
Patent Citations
Molecular marker closely linked or co-separated with stem removal property of ripe capsicum fruits and application of molecular marker
CN111172307A
Molecular marker related to easy-to-separate character of ripe pepper fruit and stem as well as application and detection method of molecular marker
CN115786574A