Application of LRP3 in the treatment of ischemic heart disease

Abstract

The present invention discloses the application of LRP3 in the treatment of ischemic heart disease. The present invention provides the application of an LRP3 promoter in the preparation of a pharmaceutical composition for the treatment of ischemic heart disease. The present invention provides a pharmaceutical composition for the treatment of ischemic heart disease. The present invention provides a method for screening drugs for the treatment of ischemic heart disease, a product for the diagnosis or prognosis risk assessment of ischemic heart disease, the present invention provides the application of the aforementioned LRP3 in the preparation of a product for the diagnosis or prognosis risk assessment of ischemic heart disease, and the present invention also provides a machine-readable storage medium for the diagnosis or prognosis prediction of ischemic heart disease and a device for the diagnosis or prognosis prediction of ischemic heart disease.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology and relates to application of LRP3 in the treatment of ischemic heart disease. Background Art

[0002] Myocardial infarction is a heart disease that seriously threatens human health. As a common manifestation of ischemic heart disease / coronary artery disease, it is the leading cause of death worldwide. Compared with non-ischemic heart disease, patients with ischemic heart disease have a shorter survival time and a higher incidence of recurrent myocardial infarction, with a 5-year survival rate of only 35% to 60%. In the past, myocardial ischemia was believed to be caused by coronary artery stenosis, but now it is believed that there are also causes such as coronary artery spasm, microcirculatory disorders, inflammation, platelet and coagulation mechanisms, and endothelial dysfunction.

[0003] In addition to promoting cardiac repair through myocardial regeneration, promoting angiogenesis and increasing blood supply to myocardial infarction and border zones is also a widely used strategy. There are many treatments to relieve myocardial ischemia, including drug therapy, revascularization (percutaneous coronary intervention, coronary artery bypass grafting), cell and gene therapy, etc., all of which are essentially to ensure that myocardial blood supply and demand reach a dynamic balance. Among the current medical interventions and treatment methods (1) for patients with ischemic cardiomyopathy, rapid revascularization and other rescue measures under the condition of myocardial survival can immediately save the lives of most patients with myocardial infarction, but the large area of ​​myocardial necrosis caused by it is irreversible, and the disease will gradually progress, causing pathological myocardial remodeling and heart failure, and ultimately leading to death; and restoring blood supply does not mean that metabolism in the microcirculation can be restored. Repairing damaged myocardial tissue requires the formation of new functional microvessels. (2) If angiotensin-converting enzyme inhibitors (ACEI), β-blockers and mineralocorticoid antagonists are used early, cardiac remodeling can be slowed down or reversed. However, treatment options for advanced heart failure are limited. Heart transplantation is the only solution for advanced heart failure, but it is not a realistic standard of care due to a shortage of donors and the complexity of the procedure. As a result, there is a lack of treatment options for patients with advanced coronary artery disease, chronic angina (chest pain caused by the heart muscle not getting enough oxygen. These symptoms are usually caused by completely blocked coronary arteries or diffuse coronary atherosclerosis) and refractory angina (patients who still have symptoms despite medical treatment and are unable to undergo physical therapy such as PCI and coronary artery bypass graft surgery (CABG). These patients currently have no treatment options and suffer from high morbidity and symptoms including chest pain, shortness of breath and fatigue, which seriously affect their quality of life. This clinical condition will become more common as the population ages and the incidence of diabetes increases. Summary of the invention

[0004] In order to solve the technical problems existing in the prior art, the present invention provides the following technical solutions:

[0005] The present invention provides the use of an LRP3 promoter in preparing a pharmaceutical composition for treating ischemic heart disease.

[0006] Further, the promoter promotes the level of LRP3;

[0007] Further, the level of LRP3 includes the mRNA level of LRP3 and the protein level of LRP3;

[0008] Furthermore, the promoter is an LRP3 overexpression vector or an LRP3 protein;

[0009] Furthermore, the overexpression vector includes a plasmid, a lentiviral vector, an adenoviral vector, and an adeno-associated viral vector.

[0010] Furthermore, the ischemic heart disease includes heart failure, coronary artery disease, myocarditis, myocardial infarction, congenital heart disease, arrhythmia, chronic angina pectoris, refractory angina pectoris, and coronary atherosclerosis;

[0011] Furthermore, the LRP3 treats ischemic heart disease by improving the decline in cardiac function, myocardial damage, infarct area, and fibrosis area caused by ischemia.

[0012] In the present invention, low-density lipoprotein receptor related protein (LDL receptor related protein, LRP): a type of transmembrane receptor containing the same repeating sequence as LDLR, expressed in multiple tissues and organs of the human body, can bind to more than 40 ligands with different structures and functions, and participate in various biological processes such as glucose and lipid metabolism, protein clearance and degradation, and cardiovascular homeostasis.

[0013] In the present invention, although LRP3 belongs to the LRP family, LRP3, ST7, and LRP9 are actually essentially different from the other LRP family molecules mentioned above. We call LRP3, ST7, and LRP9 distant relatives of the LRP family. This is mainly analyzed from the structure. The distant relatives share the LDLR sequence with the above molecules, so they are called LRP family proteins. This is mainly reflected in the functions related to lipid metabolism; and the functions of the above molecules in the cardiovascular field mainly depend on their EGF-like repeat sequences and YWTD and O-linked domains, while the distant relatives represented by LRP3 do not have the above domains, but have their own unique CUB domains, which means that the functions they play other than lipid metabolism are essentially different from those of the above molecules.

[0014] The present invention provides a pharmaceutical composition for treating ischemic heart disease, the pharmaceutical composition comprising an effective amount of an LRP3 promoter;

[0015] Further, the promoter promotes the level of LRP3;

[0016] Further, the level of LRP3 includes the mRNA level of LRP3 and the protein level of LRP3;

[0017] Furthermore, the promoter is an LRP3 overexpression vector or an LRP3 protein;

[0018] Furthermore, the overexpression vector includes a plasmid, a lentiviral vector, an adenoviral vector, and an adeno-associated viral vector;

[0019] Furthermore, the pharmaceutical composition further comprises a pharmaceutically acceptable excipient;

[0020] Furthermore, the pharmaceutically acceptable excipients include solvents, diluents, dispersants, suspending aids, surfactants, isotonic agents, thickeners, preservatives, solid binders, and lubricants.

[0021] In some embodiments, the excipients include any and all solvents, diluents or other liquid vehicles, dispersion or suspension aids, surfactants, isotonicity agents, thickeners or emulsifiers, preservatives, solid binders, lubricants, etc. suitable for preparing the particular dosage form desired. Some examples of materials that can be used as pharmaceutically acceptable carriers include, but are not limited to, sugars such as lactose, glucose and sucrose; starches such as corn starch and potato starch; cellulose and its derivatives such as sodium carboxymethylcellulose, ethylcellulose and cellulose acetate; powdered tragacanth; malt; gelatin; talc; excipients such as cocoa butter and suppository waxes; oils such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; glycols such as propylene glycol; esters such as ethyl oleate and ethyl laurate; agar; buffers such as magnesium hydroxide and aluminum hydroxide; alginic acid; pyrogen-free water; isotonic saline; Ringer's solution; ethanol and phosphate buffers, and other nontoxic compatible lubricants such as sodium lauryl sulfate and magnesium stearate, as well as colorants, release agents, coating agents, sweetening, flavoring and perfuming agents, preservatives and antioxidants may also be present in the composition, according to the judgment of the formulator.

[0022] The present invention provides a method for screening a drug for treating ischemic heart disease, the method comprising:

[0023] In the test group, the test compound is administered to the test subject, and the expression level V1 of LRP3 in the sample derived from the test subject in the test group is detected; in the control group, a blank control is administered to the test subject, and the expression level V2 of LRP3 in the sample derived from the test subject in the control group is detected; the expression level V1 and the expression level V2 detected are compared to determine whether the test compound is a candidate compound for treating ischemic heart disease;

[0024] Furthermore, the ischemic heart disease includes heart failure, coronary artery disease, myocarditis, myocardial infarction, congenital heart disease, arrhythmia, chronic angina pectoris, refractory angina pectoris, and coronary atherosclerosis;

[0025] Further, the sample includes a body fluid sample, a cell sample and / or a tissue sample;

[0026] Furthermore, the body fluid sample includes blood, serum, plasma, urine, saliva, lymph, cerebrospinal fluid, cerebrospinal fluid, amniotic fluid, and ascites;

[0027] Furthermore, the cell samples include cell samples derived from tissues and cell samples derived from in vitro culture;

[0028] Furthermore, the tissue samples include fresh tissue samples and fixed tissue samples.

[0029] The present invention provides a product for diagnosing ischemic heart disease or assessing the risk of prognosis, the product comprising a reagent for detecting the expression level of a marker in a sample, the marker comprising LRP3;

[0030] Furthermore, the ischemic heart disease includes heart failure, coronary artery disease, myocarditis, myocardial infarction, congenital heart disease, arrhythmia, chronic angina pectoris, refractory angina pectoris, and coronary atherosclerosis.

[0031] Further, the reagents include reagents for detecting marker expression levels by digital imaging technology, protein immunoassay technology, dye technology, nucleic acid sequencing technology, nucleic acid hybridization technology, chromatography technology, and mass spectrometry technology;

[0032] Further, the reagents include antibodies, primers, probes, sequencing libraries, nucleic acid chips or protein chips;

[0033] Further, the primers include primers for qPCR detection;

[0034] As used herein, the term "primer" refers to a short nucleic acid chain with a free 3' hydroxyl group that forms a base pair with a complementary template so as to serve as the starting point for generating a new template chain. In addition to the primer, DNA synthesis or replication requires a suitable buffer, appropriate temperature, a polymerase (DNA polymerase or reverse transcriptase) and four nucleotide triphosphates.

[0035] Furthermore, the products include test kits, test strips, and chips;

[0036] Furthermore, the kit includes an RT-PCR kit, a competitive RT-PCR kit, a real-time RT-PCR kit, a DNA chip kit or a protein chip kit.

[0037] The present invention provides the use of a reagent for detecting the expression level of a marker in the preparation of a product for diagnosing ischemic heart disease or predicting the risk of prognosis, wherein the marker is LRP3;

[0038] Furthermore, the ischemic heart disease includes heart failure, coronary artery disease, myocarditis, myocardial infarction, congenital heart disease, arrhythmia, chronic angina pectoris, refractory angina pectoris, and coronary atherosclerosis.

[0039] The present invention provides a machine-readable storage medium for diagnosing or predicting the prognosis of ischemic heart disease, wherein the machine-readable storage medium stores a plurality of computer instructions, and when the computer instructions are executed, the following processing is performed: diagnosing or predicting the prognosis of a subject according to the LRP3 detection value of the subject;

[0040] Furthermore, the ischemic heart disease includes heart failure, coronary artery disease, myocarditis, myocardial infarction, congenital heart disease, arrhythmia, chronic angina pectoris, refractory angina pectoris, and coronary atherosclerosis;

[0041] Further, when the computer instruction is executed, the following processing is performed:

[0042] Collect information on samples to be tested from subjects;

[0043] Obtaining a detection value of the LRP3;

[0044] Perform diagnosis or prognosis prediction on the subject.

[0045] In some embodiments, more specific examples of "machine-readable storage medium" include, but are not limited to: an electrical connection having one or more conductors, a portable computer disk, a hard disk, a random access memory (RAM), a read-only memory (ROM), an erasable programmable read-only memory (EPROM or flash memory), optical fiber, a portable compact disk read-only memory (CD-ROM), an optical storage device, a magnetic storage device, or any suitable combination of the foregoing.

[0046] The present invention provides a device for diagnosing or predicting the prognosis of ischemic heart disease, the device comprising:

[0047] at least one processor;

[0048] at least one memory for storing at least one program;

[0049] When the at least one program is executed by the at least one processor, the at least one processor implements the following steps: obtaining the detection value of the LRP3; diagnosing or predicting the prognosis of the subject;

[0050] Furthermore, the ischemic heart disease includes heart failure, coronary artery disease, myocarditis, myocardial infarction, congenital heart disease, arrhythmia, chronic angina pectoris, refractory angina pectoris, and coronary atherosclerosis.

[0051] The term "device" or "memory device" may include a device having a memory, but is not limited to a device having only a memory. For example, a device or memory device may include a memory, a processor, and / or other components or functions. For example, a device or memory device may include a system on a chip (SOC).

[0052] The functions of the various elements shown in the figures may be provided by dedicated hardware, as well as hardware capable of executing software in association with appropriate software. When provided by a processor, these functions may be provided by a single dedicated processor, by a single shared processor, or by multiple individual processors (some of which may be shared). In addition, the explicit use of the term "processor" or "controller" should not be interpreted as exclusively referring to hardware capable of executing software, but may implicitly include, but are not limited to: digital signal processor (DSP) hardware, read-only memory (ROM), random access memory (RAM), and non-volatile storage devices for storing software.

[0053] The term "agent" used in the present invention should not be interpreted narrowly, but should be extended to small molecules, protein molecules such as peptides, polypeptides and proteins, and compositions comprising them, as well as genetic molecules such as RNA, DNA and their mimetics and chemical analogs and cellular agents. BRIEF DESCRIPTION OF THE DRAWINGS

[0054] Figure 1 This is a graph showing the purity of the LRP3-overexpressing AAV vector;

[0055] Figure 2 This is a statistical chart of all-cause mortality in patients with myocardial infarction;

[0056] Figure 3 This is a statistical chart of cardiac mortality in patients with myocardial infarction;

[0057] Figure 4 This is a graph showing the results of bioinformatics analysis of LRP3 expression levels in peripheral blood mononuclear cells of patients in the acute phase of myocardial infarction and one month and one year after myocardial infarction;

[0058] Figure 5 This is the result of ELISA testing of plasma LRP3 in healthy people and myocardial infarction patients;

[0059] Figure 6 This is the result graph of LRP3 expression level at different days after myocardial infarction in mice;

[0060] Figure 7 This is the ultrasound result of myocardial infarction in mice after LRP3 knockout;

[0061] Figure 8 This is the statistical result of EF and FS of myocardial infarction in mice after LRP3 knockout;

[0062] Fig. 9 This is the result of Masson staining and myocardial fibrosis after myocardial infarction;

[0063] Fig.10 This is a picture of the results of TTC staining and myocardial injury marker detection in the heart of mice after myocardial infarction;

[0064] Fig.11 This is the result diagram of the migration ability of endothelial cells after LRP3 knockdown;

[0065] Fig.12 This is the result diagram of blood vessel formation ability after LRP3 knockdown;

[0066] Fig.13 This is the result of CD31 positive staining after LRP3 knockdown;

[0067] Fig.14 This is the result of fluorescent staining of new blood vessels in heart tissue;

[0068] Fig.15 This is a graph showing the results of the mouse lower limb ischemia experiment at different days after surgery;

[0069] Fig.16 This is a graph showing the recovery of cardiac function caused by ischemia in mice after overexpression of LRP3;

[0070] Fig.17 This is a graph showing the recovery of myocardial damage caused by ischemia in mice after overexpression of LRP3;

[0071] Fig.18 This figure shows the recovery of infarct area and fibrosis area caused by ischemia in mice after overexpression of LRP3. DETAILED DESCRIPTION

[0072] As used herein, the terms "including", "having" or "comprising" include "comprising", "mainly consisting of", "substantially consisting of", and "consisting of"; "mainly consisting of", "substantially consisting of" and "consisting of" are subordinate concepts of "containing", "having" or "including".

[0073] As used herein, the term "prognosis prediction" refers to the act of predicting the course and outcome of a disease in advance. More specifically, the course of a particular disease may change with the patient's physiological or environmental conditions over time, and prognosis prediction can be understood to mean all actions that predict the course of the disease by taking into account the patient's overall condition. The results of the disease predicted in advance include: a good prognosis and a poor prognosis, wherein a good prognosis means that the patient's survival rate is high over time, and a poor prognosis means that the patient's survival rate is low over time.

[0074] As used herein, the term "subject" refers to any animal, including humans and non-human animals. The non-human animals include all vertebrates, for example, mammals, such as non-human primates (particularly higher primates), sheep, dogs, rodents (such as mice or rats), guinea pigs, goats, pigs, cats, rabbits, cattle, and any livestock or pets; and non-mammals, such as chickens, amphibians, reptiles, etc. In a specific embodiment of the present invention, the subject is preferably a human.

[0075] As used herein, the term "sample" refers to other fluid samples and tissue samples that can be obtained from the blood and biological sources of the subject, such as biopsy tissue samples or tissue cultures or cells derived therefrom. The source of the tissue sample can be solid tissue, such as from fresh, frozen and / or preserved organ or tissue samples, biopsy tissues or aspirates; blood or any blood component; body fluid; cells from any time of individual pregnancy or development; or plasma. The sample includes biological samples that have been processed in any way after it is obtained, such as reagent treatment, stabilization, or enrichment for certain components (such as proteins or polynucleotides), or embedded in a semi-solid or solid matrix for sectioning purposes. The samples described in the present invention include, but are not limited to: blood, serum, plasma, tissue, blood-derived cells, lymph, synovial fluid, cell extracts and combinations thereof. In a preferred embodiment, the sample is blood, serum and / or plasma.

[0076] As used herein, the term "machine-readable storage medium" may be a computer-readable signal medium or a computer-readable storage medium. A computer-readable storage medium may be, for example, but not limited to, an electrical, magnetic, optical, electromagnetic, infrared, or semiconductor system, device, or device, or any combination thereof. In the present invention, the machine-readable storage medium may be any tangible medium containing or storing a program that may be used by or in conjunction with an instruction execution system, device, or device.

[0077] Example

[0078] 1. Origin and follow-up of the myocardial infarction cohort

[0079] The selection and follow-up of the clinical cohort in this study strictly referred to the guidelines and methods in the same field at home and abroad, and rigorous inclusion and exclusion criteria were designed. The total number of subjects in the study was 863, and the experimental subjects were followed up once every quarter for 10 consecutive years. Routine information such as gender, age, smoking history, drinking history, and past medical history were collected through questionnaires, and physiological data such as height, weight, blood pressure, and heart rate were collected through physical examinations. 10 mL of peripheral venous blood was drawn from each person and placed in a collection tube containing an appropriate amount of anticoagulant.

[0080] According to the inclusion and exclusion criteria established in the early stage, the myocardial infarction group population cohort required for this study was established. The inclusion criteria were: ① Age 18-40 years old; ② Diagnosis of ischemic cardiomyopathy. The exclusion criteria were: ① Related chronic diseases and special medical history; ② History of smoking and drinking; ③ Long-term use of lipid-lowering drugs, hormones or other drugs.

[0081] 2. Experimental methods

[0082] 2.1 AAV virus packaging

[0083] AAV recombinant plasmid construction and extraction

[0084] Using C-12715 as a template, primers C-12761-F and C-12761-R were used for template amplification to amplify 12761-ORF with a length of 3278bp. At the same time, the EB361 plasmid was digested and gel-recovered to obtain the vector skeleton 12761-Vector. Then, the fragment 12761-ORF and the skeleton 12761-Vector were recombined to form a complete plasmid by seamless cloning. Finally, it was transformed into Escherichia coli and commissioned to sequence to identify the correct clone. After sequencing, it was confirmed that the target sequence had been correctly transformed into the vector. The specific sequence is shown in SEQ ID NO:1:

[0085]

[0086] 2.2 293T cell culture

[0087] Thawing of Cryopreserved 293T Cells

[0088] 2.2.1 Recovery of frozen 293T cells

[0089] 1. Add 10 ml of DMEM growth medium into a 15 ml conical bottom tube;

[0090] 2. Place the cell cryopreservation tube stored at -80℃ in a 37℃ water bath and gently shake for 1-2 minutes to thaw it. Take out the cryopreservation tube from the water bath and disinfect it by wiping the surface of the tube with 75% ethanol (room temperature). Note that only the tube body can be placed in the water bath, and the tube cap must not be immersed together, otherwise the water in the water bath will be sucked into the cryopreservation tube;

[0091] 3. Transfer the thawed cell suspension to the conical tube prepared in the first step;

[0092] 4. Centrifuge at 200g for 3 minutes at room temperature to pellet the cells. Discard the supernatant.

[0093] 5. Add 5 ml of fresh growth medium to the conical tube and gently pipette up and down to suspend the cells. At this time, the cells have just recovered and are relatively fragile, so it is better to suspend the cells when pipetting and avoid excessive pipetting;

[0094] 6. Transfer 5 ml of the cell suspension to a 15 cm cell culture plate containing 30 ml of fresh growth medium. Place the cells in a 37°C, 5% CO 2 Incubator;

[0095] 7. Monitor cell density every day. When the cells reach 50% confluence, subculture them. Then subculture 293T cells.

[0096] 2.2.2 Passaging of 293T cells

[0097] 1. Preheat DMEM complete medium and trypsin-EDTA solution in a 37°C water bath;

[0098] 2. Remove the growth medium and wash the cells once with 10 ml PBS (phosphate-buffered saline);

[0099] 3. Digest the cells with 5 ml of trypsin-EDTA solution for 1-3 minutes;

[0100] Note: The digestion time with trypsin-EDTA solution should be the shortest time required to make the adherent cells detach from the culture flask. This process can be observed using an inverted microscope. Over-digestion will damage or kill the cells.

[0101] 4. Dilute the cells with 5 ml of culture medium to inactivate trypsin and transfer the cell suspension to a 15 ml conical bottom tube;

[0102] 5. Centrifuge at 200g for 3 minutes at room temperature to precipitate the cells and discard the supernatant;

[0103] 6. Resuspend the cell pellet with 10 ml of culture medium and transfer 2 ml of the cell suspension to each 75 cm 2 5 flasks of cell culture were prepared. Each flask contained 28 ml of growth medium. The cells were placed in a 37°C, 5% CO 2 Incubator. Check the cell density every day and keep the cell confluence below 50%.

[0104] 2.3AAV virus production and packaging

[0105] 2.3.1293T Cell Preparation

[0106] Add 10 ml of DMEM growth medium to each tissue culture dish and add 3 × 10 6 293T cells were used for transfection 48 hours later.

[0107] Note: To achieve high titers, the health of 293T cells and the density of passages are very important factors. Cells should be passaged when they reach 50% confluency. Cryopreservation should be performed when cells are at low passages and healthy. Avoid cell clumping when passaged and plated for transfection. Cells may be grown to a higher confluency before transfection with AAV plasmids.

[0108] 2.3.2 Transfection of 293T cells

[0109] 1. Check the host cells passaged two days ago before transfection. They should reach 70-80% confluence.

[0110] 2. Take out the required plasmids and reagents from the refrigerator and cool to room temperature;

[0111] 3. Calculate the required transfection system and plasmid dosage according to the number of packaging plates, dilute the plasmid according to the kit requirements, add the transfection reagent, mix gently, and let stand for 20 minutes;

[0112] 4. Aspirate and discard the culture medium of the cells to be transfected, replace with DMEM containing 5% FBS, add the DNA transfection reagent mixed solution to the cells, and gently shake the cell culture plate;

[0113] 5. Return the cell culture dish to the 37°C incubator for 12 h;

[0114] 6. After 12 h, replace with fresh 5% FBS DMEM and culture for another 60 h.

[0115] 2.3.3 Collection of AAV virus

[0116] 1. Prepare a dry ice ethanol bath (pour ethanol into a foam box filled with dry ice, or use liquid nitrogen instead of a dry ice ethanol bath) and a 37°C water bath;

[0117] 2. Collect the toxin-producing cells together with the culture medium into a centrifuge cup. When collecting cells, tilt the culture plate at a certain angle to scrape the cells into the culture medium;

[0118] 3. Centrifuge at 200g for 3 minutes to separate cells and supernatant. Store the supernatant separately and resuspend the cells in 1 ml PBS.

[0119] 4. Transfer the cell suspension repeatedly between a dry ice ethanol bath and a 37°C water bath, freeze-thaw four times, and shake slightly after each thawing.

[0120] Note: Each freezing and thawing process takes approximately ten minutes.

[0121] 5. Centrifuge at 10,000 x g to remove cell debris and transfer the supernatant to a new centrifuge tube.

[0122] 2.3.4 AAV virus concentration

[0123] 1. Add 40% PEG8000 to the supernatant until the final concentration is 8%. Place on ice for 2 hours (mix every 15 minutes), and centrifuge at 2,500 xg for 30 minutes. Remove the supernatant, resuspend the precipitate with PBS, and combine it with the cell lysis supernatant;

[0124] 2. Centrifuge at 3,000 x g for 30 minutes and transfer the supernatant to another clean tube. There should be no visible cell debris in the supernatant at this point. If there is still some debris, centrifuge again;

[0125] 3. Add Benzonase nuclease to digest and remove residual plasmid DNA (final concentration is 50 U / ml). Close the tube cap and invert several times to mix thoroughly. Incubate at 37°C for 30 minutes;

[0126] 4. Filter with a 0.45 μm filter head and take the filtrate.

[0127] 2.3.5 Purification of AAV virus

[0128] 1. Prepare iodixanol at concentrations of 15%, 25%, 40%, and 60% (w / v) with sterile water, and filter through a 0.2 μm filter membrane into a sterilized bottle.

[0129] 2. Take an ultracentrifuge tube (both the ultracentrifuge tube and the lid must be sterilized before use) and add different concentrations of iodixanol layer by layer. First add 4.2 ml of the 60% layer, then add 5 ml of the 40% layer, then add 6 ml of the 25% layer, and finally add 9 ml of the 15% layer.

[0130] 3. Add the processed crude virus solution to the upper layer. Be careful and add it slowly at the beginning. Do not push the virus into the tube suddenly, and cover the tube tightly.

[0131] 4. Ultracentrifugation: Before centrifugation, the relative ultracentrifuge tubes should be balanced and the error should be controlled within 0.02 g. Select the VTi50 rotor and centrifuge at 48,000 rpm and 4°C for 2.5 h.

[0132] 2.3.6 Ultrafiltration desalination of AAV virus

[0133] 1. Add the virus solution obtained by density gradient centrifugation to an ultrafiltration tube, add PBS to a total volume of 10 ml, and centrifuge at 1,500 x g for 5 minutes;

[0134] 2. Repeat step 3.3.6 4 times, for a total of 5 ultrafiltrations;

[0135] 3. Add AAV virus storage solution to the required volume.

[0136] 2.3.7 qPCR titer determination of AAV virus

[0137] qPCR used FWD ITR and REV ITR primers to specifically detect the ITR sequence of AAV vector.

[0138] 2.4 Detection of LRP3 protein levels in tissues of research subjects

[0139] The extracted tissue was ground and lysed in a lysis buffer containing protease inhibitors, centrifuged at 4°C, 14,000 g for 10 min, and the supernatant was aspirated into another pre-cooled clean centrifuge tube. The protein concentration was then determined using a BCA kit. 5×SDS Loading Buffer was added at a ratio of 1 / 4 protein volume, and the protein was denatured by boiling at 100°C for 5 min. 1.5 mm SDS-polyacrylamide separation gel and stacking gel (5% stacking gel and 15% separation gel) were prepared, and the protein sample was added for electrophoresis. The PVDF membrane was activated by soaking it in methanol for a while, 4 filter papers and 2 sponges were soaked in transfer buffer, and the sponge-filter paper-gel-PVDF membrane-filter paper-sponge were stacked in order. After the assembly was completed, it was placed in the transfer tank, and the sample was transferred to the PVDF membrane by constant current ice bath electrotransfer at 200 mA for 2 h. 5% skim milk was used for blocking for 1 h. The membrane was incubated with primary antibody overnight at 4°C, washed three times with PBST buffer, and incubated with goat anti-rabbit secondary antibody for 1 h at room temperature. The membrane was developed using an ECL ultrasensitive chemiluminescence kit.

[0140] 2.5 Masson staining and TTC staining

[0141] After the experimental animals were killed, heart tissue and plasma were obtained. ① After collecting plasma, the levels of myocardial injury markers in the blood were detected by LDH and CK kits. ② Heart MASSON staining, Sirius red staining, and TTC staining: Prepare paraffin sections, dewax in xylene for 5 min, then switch to fresh xylene for dewaxing, and dewax in xylene for 3 times. Absolute ethanol for 5 min, twice. 90% ethanol for 5 min, twice, 70% ethanol for 5 min, once. Distilled water for 5 min, twice. Place the sections in 10 mMTris, pH 10.0 antigen repair solution for repair, heat at 95℃ for 12 min, slowly cool to room temperature in about 30 min, and stain with the corresponding dye.

[0142] 2.6 Angiogenesis-related experiments

[0143] 1) Human cardiac microvascular endothelial cell line was purchased from Shanghai Zhongqiao Xinzhou Company. When the cell density reached 70%-80%, LRP3-siRNA was transfected and cultured for 24 hours to observe the expression of the target gene. The migration function of endothelial cells was evaluated by scratch test.

[0144] The LRP3-siRNA sequence is shown below:

[0145] hLRP3-s:UGACGACUACGUGCAGGUAUA(dT)(dT); and

[0146] hLRP3-a:UAUACCUGCACGUAGUCGUCA(dT)(dT).

[0147] 2) Endothelial cell tube formation experiment: Use a pre-cooled pipette tip to draw about 50 μl of matrix gel into a 96-well plate. This can be done on ice. Do not heat the matrix gel to avoid the formation of bubbles. Place the 96-well plate in an incubator to gel for 30 minutes. While waiting for the gel to form, digest the cells to prepare a cell suspension: Start adding cell suspension to the 96-well plate, 50 μl of cell suspension per well. Take photos after culturing for a period of time (12 hours after inoculation). Use ImageJ software to analyze the results.

[0148] 3) After the experimental animals were killed, the heart tissue was obtained for immunofluorescence staining: After the frozen sections were dried, they were fixed with 4% paraformaldehyde for 10 minutes. They were washed with PBST three times, treated with TritonX-100 for 10 minutes, and blocked with 5% goat serum at room temperature for 30 minutes. The LRP3 primary antibody was diluted with PBST buffer and incubated in a 4°C wet box overnight. The primary antibody was washed off the next day, and after rinsing with PBST, the fluorescent secondary antibody diluted with PBST buffer was added, and incubated at room temperature at 37°C for 1 hour in the dark. After washing with PBST three times, the nuclear dye DAPI was added to the slide, and the slide was sealed with a sealing agent. The experimental results were observed under a fluorescence microscope and photographed to collect photos.

[0149] 4) Establishment of lower limb ischemia model: adult mice were weighed and anesthetized with 2% tribromoethanol intraperitoneally; the mice were placed in a supine position with the soles of their hind limbs attached to double-sided black cardboard tape to secure them; the skin of the gastrocnemius muscle of the hind limb was cut open, the muscles were bluntly separated, the femoral vein and nerve were separated, the femoral artery was freed, and preoperative blood flow information was collected; the femoral artery of the left lower limb of the mouse was isolated and ligated from the distal end of the bifurcation of the femoral artery to the saphenous artery; the right hind limb was used as a control, and the changes in blood flow after ligation were measured using a laser Doppler blood flow detector; blood flow was detected at different time points after surgery (1 day, 7 days, and 14 days after surgery).

[0150] 3. Experimental results

[0151] 3.1 Results of qPCR titration of AAV virus

[0152] The results of AAV virus titer detection are shown in Table 1.

[0153] Table 1

[0154]

[0155] 3.2 AAV virus purity determination results

[0156] Test conclusion: VP1 / VP2 / VP3 bands are clear and in normal proportion; no visible mixed bands; purity is usually above 99%. Figure 1 shown.

[0157] 3.3 In humans, it has been confirmed that LRP3 is involved in the development of ischemic heart disease

[0158] After conducting plasma whole exome sequencing on a total of 865 patients in the myocardial infarction cohort, the research team found that the single nucleotide polymorphism of LRP3 had a significant impact on the ten-year survival rate of patients with myocardial infarction. After the SNP of LRP3 mutated to RS17848213_T2, the all-cause mortality rate of patients with myocardial infarction decreased significantly ( Figure 2 , 1 is the group with sudden myocardial infarction, 2 is the group with non-sudden myocardial infarction), and the decrease in cardiac mortality was more obvious ( Figure 3 , ibid.), which suggests that LRP3 is likely to play an important role in ischemic heart disease. Then, through bioinformatics transcriptome analysis in the GEO public database (GSE123342), it was found that LRP3 continued to decrease in peripheral blood mononuclear cells of patients in the acute phase of myocardial infarction and one month and one year after myocardial infarction ( Figure 4 ); ELISA detected plasma LRP3 in healthy people and myocardial infarction patients and found that plasma LRP3 decreased ( Figure 4 ); after hypoxia stimulation of human umbilical vein endothelial cells (HUVEC) (control group: normal oxygen concentration cell culture incubator, 37℃, 5% CO 2 , 95%O 2 ; Hypoxia stimulation group: placed in a cell culture incubator, 37°C, 5% CO 2 、95%N 2 ), LRP3 protein expression decreased ( Figure 5 ); In summary, LRP3 plays an important role in ischemic heart disease.

[0159] 3.4 At the animal level, it was confirmed that the expression of cardiac LRP3 in mice was also reduced after myocardial infarction.

[0160] The 8-week-old male C57BL / 6J mice used in this study were purchased from the Animal Center of Peking University Health Science Center. During the study, they were fed with maintenance feed to ensure adequate diet and drinking water. The breeding location was the SPF-level laboratory of the Experimental Animal Department of Peking University Health Science Center. The indoor temperature was maintained at 18-22℃; the relative humidity was maintained at 50-60%, and the alternating cycle of 12 h light and 12 h dark was maintained. Wild-type mice and LRP3- / - mice were randomly divided into two groups (n=6 in each group), namely the sham operation group and the myocardial infarction group. The myocardial infarction group used 7-0 silk thread to pass through the left anterior descending coronary artery and ligated for 28 days to establish a myocardial infarction model. The sham operation group did not tie the 7-0 silk thread after passing through the left anterior descending coronary artery.

[0161] During the modeling process, the physiological indicators of mice such as heart rate, blood pressure, and body weight were regularly detected and recorded. After weighing the body weight 1 day, 3 days, 7 days, and 28 days after surgery, the mice were killed after anesthesia with 4% chloral hydrate (0.1 mL / 10 g body weight). The heart was then separated and the morphology and texture were roughly observed. An appropriate amount of mouse heart tissue was placed in a grinding tube containing 3-5 grinding beads, and an appropriate volume of tissue protein lysis solution (containing protease inhibitors) was added. It was placed in a grinder, started, and ground once every 60 s, and repeated twice. The cells or tissue protein lysate were thoroughly mixed on a spiral oscillator, and ultrasonically broken on ice 3 times, each time for 3 s, and then centrifuged at 4°C and 12000 rpm for 10 min, and the supernatant was aspirated, which was the total tissue protein. Changes in the level of cardiac LRP3 were detected by Western blot. After ligating the left anterior descending branch of the mouse heart, cardiac tissue protein was extracted, and it was found that the LRP3 protein level decreased; after extracting cardiac tissue RNA, it was found that the RNA level of LRP3 also decreased. The results are as follows Figure 6 shown.

[0162] 3.5 At the animal level, it was confirmed that LRP3 knockout aggravated myocardial infarction

[0163] 1) Construction of transgenic and knockout mice: LRP3- / - mice were donated by the Department of Physiology and Pathophysiology, School of Basic Medical Sciences, Peking University, and were kept for 8 weeks. Each animal was randomly divided into 2 groups, namely, sham operation group and myocardial infarction group.

[0164] 2) After the modeling was completed, an echocardiogram was performed. The mice were anesthetized by inhalation of 4% isoflurane, and the hair on the chest and armpits of the mice was removed with a depilatory cream. The mice were placed in a supine position on the small animal ultrasound platform. The probe was used to collect images of the mouse heart in the long and short axis directions. According to the collected results, the following indicators were statistically analyzed: Left ventricular posterior wall thickness at end-diastole (LVPWd), Left ventricular anterior wall thickness at end-diastole (LVAWd), Left ventricular internal dimension at end-diastole (LVIDd), Left ventricular internal dimension at end-systole (LVIDs), Left ventricular end-diastolic volume (LVEDV), Left ventricular end-systolic volume (LVESV), early diastolic blood flow velocity at the mitral valve tip / early diastolic myocardial velocity at the mitral valve ring (E / E'), and ejection fraction (EF). Ultrasound results showed that after modeling, compared with WT, the ejection fraction and shortening fraction of the WT+MI group were significantly reduced, while the reduction in LRP3+MI was more significant, indicating that knocking out LRP3 aggravated cardiac function damage. Figure 7 , Figure 8 shown.

[0165] 3.6 Masson staining and TTC staining

[0166] Masson staining and TTC staining results showed that ligation caused myocardial ischemic necrosis, while LRP3 knockout led to the expansion of ischemic necrosis and more severe fibrosis; compared with WT+MI, CK and LDH in the LRP3+MI group increased significantly, indicating a higher degree of myocardial damage. Fig. 9 , Fig.10 shown.

[0167] 3.7 Confirmation that the role of LRP3 in ischemic heart disease is related to its effect on angiogenesis

[0168] The results showed that knocking down LRP3 could inhibit the migration and angiogenesis ability of endothelial cells. Fig.11 , Fig.12 As shown. CD31 is a marker of vascular endothelial cells, and CD31 positive staining in LRP3 knockout animals is significantly reduced. Fig.13 To further explore the role of LRP3 in ischemic heart disease, we also constructed a myocardial infarction model. Fluorescence staining of cardiac tissue showed that the number of new blood vessels in LRP3- / -+MI was significantly reduced compared with WT+MI. The results are shown in Fig.14 As shown in the results of the lower limb ischemia experiment, after knocking out LRP3, the blood flow recovery rate at 7d and 14d was significantly reduced. These prove that knocking down LRP3 will aggravate myocardial ischemia damage by inhibiting angiogenesis. Fig.15 shown.

[0169] 3.8 Confirmation that injection of AAV9-LRP3 can improve cardiac function after ischemia

[0170] AAV intervention plan: The mouse LRP3 gene NM_001024707 transcript was selected to construct an overexpression AAV vector: AAV9-CMV-Lrp3-3xFlag. Twenty-four 8-week-old C57 mice were selected and divided into a sham operation group and a myocardial infarction group. Each group was further divided into an Ad-LRP3 injection group (once a week, each dose of 25 mg / kg) and an inactivated Ad-LRP3 injection group (same dose and frequency).

[0171] The results showed that overexpression of endothelial-specific LRP3 could significantly improve ischemia-induced cardiac function decline and myocardial damage, including reducing infarct area and fibrosis area. Fig.16 , Fig.17 , Fig.18 Therefore, overexpression of LRP3 may be a new potential therapeutic approach for the treatment of myocardial infarction.

[0172] The description of the above embodiments is only used to understand the method and core idea of ​​the present invention. It should be pointed out that, for those skilled in the art, several improvements and modifications can be made to the present invention without departing from the principle of the present invention, and these improvements and modifications will also fall within the scope of protection of the claims of the present invention.

Claims

1. Use of an LRP3 promoter in the preparation of a pharmaceutical composition for the treatment of myocardial infarction, wherein the promoter is an LRP3 overexpression vector or an LRP3 protein, and the overexpression vector includes a plasmid, a lentiviral vector, an adenoviral vector, and an adeno-associated viral vector.

2. The use according to claim 1, wherein the promoter promotes the level of LRP3.

3. The use according to claim 2, wherein the level of LRP3 includes the mRNA level of LRP3 and the protein level of LRP3.

4. The use according to claim 1, wherein the LRP3 is used to treat myocardial infarction by improving the decline in cardiac function, significant reduction in the number of new blood vessels, myocardial damage, infarct area, and fibrosis area caused by ischemia.

Images