A phosphate-solubilizing Aspergillus terreus and its application in drought-resistant probiotics

Abstract

The present invention belongs to the field of microbial technology, and particularly relates to a phosphate-solubilizing Aspergillus terreus and its application in drought-resistant probiotics; the Aspergillus terreus of the present invention is obtained by screening the rhizosphere soil of pepper, and the Aspergillus terreus CY-05 ( Aspergillus terreus var. fluffy ) is a growth-promoting microbial strain with disease resistance, high yield of terreus ketone and phosphate solubilization ability, and is an excellent strain with strong survival ability and multiple functions such as improving crop drought tolerance. The present invention also provides a probiotic agent obtained by solid-state fermentation of Aspergillus terreus CY-05. The application of this agent can increase the tolerance of crops to drought, improve the yield and survival ability of crops under drought stress conditions, promote the conversion and utilization of insoluble phosphorus, and prevent and control the occurrence of root soil-borne diseases. Strain CY-05 is an indigenous fungus in the rhizosphere of pepper. It is non-toxic and harmless to humans and animals, does not cause environmental pollution, and helps to solve the problems of water shortage and phosphorus deficiency faced by agricultural production in large semi-arid planting areas. It has important economic significance.

Description

Technical Field

[0001] The invention belongs to the technical field of microorganisms, and particularly relates to a phosphate-solubilizing Aspergillus terreus and application thereof in drought-resistant probiotics. Background Art

[0002] Drought is one of the natural disasters currently facing global agricultural production. It is far from enough to rely solely on the plant's own physiological response to drought to develop crop drought resistance strategies. Paying attention to the colonization of adaptive microorganisms under drought stress and the beneficial assistance of microorganisms to plants has important guiding significance for improving plant growth and enhancing crop drought resistance. Among them, rhizosphere microorganisms that interact closely with plants play an important role in plant health development and stress tolerance and have good application potential. Explore potential microorganisms related to the high drought resistance of plants and give full play to their role, explore microorganisms that have beneficial cooperative relationships with drought-tolerant plants and utilize them, and give full play to the role of rhizosphere microorganisms in enhancing crop drought resistance by regulating the plant rhizosphere microbiome, providing new solutions for the application of drought-resistant agriculture in the context of global climate warming.

[0003] Growth-promoting rhizosphere fungi (PGPF) are non-pathogenic filamentous fungi associated with plants in rhizosphere soil that can promote plant growth. Compared with PGPB, PGPF has received less attention. According to current research, PGPF and PGPF have the same plant growth-promoting effect and similar mechanism of action. In the face of drought stress, PGPF mainly regulates plant drought resistance by secreting plant hormones such as gibberellins and IAA, changing the distribution of nutrients in the plant body, synthesizing iron carriers, increasing antioxidant enzyme activity, reducing lipid peroxidation, and accumulating soluble sugars and proline and other osmolytes. Among them, many studies have confirmed that the common Aspergillus genus ( Aspergillus ), Penicillium ( Penicillium ), Trichoderma ( Trichoderma ), Phytophthora spp. Phoma ) and other fungi and AMF play a key role in regulating plant response to drought. Chinese invention patent CN202210880877.9 discloses that seed soaking with terreusin can promote plant root growth and seedling height under water-deficient conditions, significantly increasing crop yields. This is obviously one of the mechanisms by which terreusin-producing strains regulate crop drought resistance. However, terreusin is expensive, which greatly limits its application in agricultural production. Therefore, exploring the resources of microbial strains that produce terreusin and secrete metabolites that are beneficial to plants, developing live bacterial preparations containing a variety of probiotic functional metabolites, and applying them to improve crop drought resistance will have great application potential.

[0004] At the same time, 74% of my country's arable land is phosphorus-deficient, and more than 95% of the phosphorus in the soil is in an ineffective form, which is difficult for plants to directly absorb and utilize. The utilization rate of applied phosphorus fertilizer in the current season is 5%-25%, and most of the phosphorus is absorbed by the soil Ca 2+ 、Fe 3+ 、Fe 2+ 、Al 3+ Combined to form insoluble phosphates. Phosphorus deficiency will lead to the inhibition of various metabolic processes of crops, slow plant growth, smaller leaves, dark green or light green leaves, lack of luster, short plants, and a serious decline in the commercial value of fruit development. There are a large number of microorganisms in the soil that can convert phosphorus and potassium that are difficult for plants to absorb and utilize into absorbable forms, thereby enhancing the plant's uptake of phosphorus and potassium in the soil. At present, the development of phosphorus and potassium-solubilizing microorganisms is mostly based on bacteria, such as Bacillus megaterium. Although there are not many types of phosphate-solubilizing fungi, mainly Penicillium, Aspergillus and Rhizopus, the phosphate-solubilizing ability of phosphate-solubilizing fungi is stronger than that of phosphate-solubilizing bacteria and the genetic traits are stable. Chinese Invention Patent 202010112793.1 Buried Aspergillus ( Aspergillus sepultus MN114011 has a significant phosphate solubilizing effect on insoluble phosphorus sources with a concentration of up to 20%, which can effectively increase the content of available phosphorus, enhance the utilization rate of soil phosphorus, and promote crop yield. The root system of corn crops treated with buried Aspergillus is significantly enhanced, which has a significant effect on promoting crop growth. It can be used to prepare phosphate solubilizing agents and growth promoters. Chinese invention patent 202210452947.0 discloses a strain of Aspergillus japonicus with high efficiency in phosphate and potassium solubilization ( Aspergillus japonicus ), the strain has a strong solubility effect on the insoluble phosphates tricalcium phosphate, magnesium phosphate and aluminum phosphate under liquid shake flask culture. Chinese invention patent 201210235182.1 discloses a rhizosphere phosphate-solubilizing fungus Aspergillus awamori ( Aspergillus awamori ) JP-NJ1 fungicide can significantly promote the growth of Masson pine seedlings.

[0005] Drylands in my country account for 52.5% of the country's total land area, primarily distributed in Northeast, North, and Northwest my country. Semi-arid areas, with unstable agricultural production conditions, account for 21.7% of the country's land area. With annual rainfall ranging from 300-550 mm, these areas play a crucial role in my country's agricultural production and hold the greatest hope for addressing China's future food security. However, research on the efficient phosphate-solubilizing Aspergillus terreus and its drought tolerance has yet to be reported in China.

[0006] Therefore, the drought-tolerant and efficient phosphate-solubilizing fungi selected from the drought-deficient rhizosphere soil are not only of great significance for regulating the contradiction between soil phosphorus supply and demand, improving soil fertility in cold and arid areas, and promoting crop growth, but also do not pose any biosafety risks. Summary of the Invention

[0007] In response to the drought and phosphorus deficiency problems faced by vast arable land in my country and to supplement the deficiencies of the existing technology, the present invention provides a phosphate-solubilizing Aspergillus terreus and its application in drought-resistant probiotics. Furthermore, the present invention provides an Aspergillus terreus fungal agent that can solubilize phosphate, prevent diseases, improve crop drought resistance, and promote crop growth, and its application.

[0008] In order to achieve the above-mentioned object, the first aspect of the present invention discloses a strain of Aspergillus terreus that is high in yield of terreus ketone, phosphate solubilizing and resistant to soil-borne Fusarium spp., Aspergillus terreus CY-05 ( Aspergillus terreus CY-05), was deposited in the China Center for Type Culture Collection on September 11, 2023, with the deposit registration number CCTCC NO M 20231662. The deposit address is: Wuhan University, Wuhan, China.

[0009] The Aspergillus terreus of the present invention is obtained by screening from the soil of continuously planted peppers in the semi-arid area of western Liaoning Province and is numbered CY-05. The strain CY-05 is inoculated into a PDA-containing culture medium and cultured and stored at a constant temperature of 28-30°C.

[0010] Aspergillus terreus CY-05 against pepper root rot pathogens ( Fusarium solani ), pepper sclerotinia pathogen ( Sclerotinia sclerotium ), and Rhizoctonia solani ( Rhizoctonia solaini ) and other pepper soil-borne pathogens, with an inhibition rate of 21.57%-50.59%; the chitinase activity and β-1,3 glucanase activity were 2.116U / ml and 0.354U / ml respectively, and it has antibacterial ability against pathogenic fungi.

[0011] Aspergillus terreus CY-05 has a highly efficient phosphate-solubilizing ability, and its ability to degrade inorganic phosphorus can reach 66.392 mg / L, thereby activating the inorganic phosphorus element in the rhizosphere soil and promoting crop growth.

[0012] Aspergillus terreus CY-05 has a high terreus ketone production capacity, and the terreus ketone production can reach 2227.963 pg / g.

[0013] The second aspect of the present invention discloses a bacterial agent, which contains the Aspergillus terreus according to claim 1 and / or a metabolite of the Aspergillus terreus.

[0014] The bacterial agent is obtained through solid fermentation.

[0015] After activation, the strain was cultured on a PDA flask slant for 5 days, spores were eluted with sterile saline, and the spore concentration in the suspension was adjusted to 1.0×10 7 -1.0×10 8 cfu / mL, as the seed liquid; the spore suspension was inoculated into the solid culture medium and fermented twice to obtain the bacterial agent.

[0016] The above-mentioned microbial agent, in addition to the active ingredient, further contains a carrier. The carrier can be a biologically inert carrier commonly used in the pesticide field. The carrier can be a solid carrier or a liquid carrier; the solid carrier can be a mineral material, a plant material, or a polymer compound; the plant material can be at least one of corn flour, soybean flour, and starch.

[0017] In the above-mentioned bacterial agent, the dosage form of the bacterial agent can be powder or granule.

[0018] As needed, surfactants (such as Tween 20, Tween 80, etc.), binders, stabilizers (such as antioxidants), pH regulators, etc. may be added to the bacterial agent.

[0019] The fourth aspect of the present invention discloses a method for preparing the above-mentioned bacterial agent, wherein the activated strain is cultured on a slant surface of an eggplant bottle for 5 days, and the spore concentration in the suspension is adjusted to 1.0×10 7 -1.0×10 8 cfu / mL, as the seed liquid. The seed liquid is inoculated into a solid culture medium and fermented twice to obtain a bacterial agent; wherein the solid culture medium is composed of materials and water, with a material-water mass ratio of 1:0.5; wherein, the materials are calculated by weight and each component includes 5 parts of rice husk powder, 35 parts of rice husks, 35 parts of bran, 15 parts of corn flour, 10 parts of soybean meal powder, and inorganic salts (ammonium sulfate and potassium dihydrogen phosphate).

[0020] Preferably, the specific process of the preparation method is as follows: 1) activating the strain: inoculating Aspergillus terreus into a PDA plate, and culturing the plate in an incubator at a constant temperature of 28-30° C. for 5-7 days;

[0021] 2) Preparation of seed solution: Inoculate the Aspergillus terreus colony prepared in step 1) into the PDA eggplant flask slant medium, culture at 28-30°C for 4-5 hours, rinse with sterile saline and adjust the spore concentration to 1.0×10 7 -1.0×10 8 cfu / mL, that is, seed solution;

[0022] 3) Preparation of a microbial agent by solid fermentation: The seed liquid prepared in step 2) is inoculated into a solid culture medium at a volume mass ratio of 5-10% of the seed liquid to the solid culture medium. The culture is incubated at 28-30°C for 5-6 days until the microorganisms have completely covered the fermentation medium. The culture is then placed at 20-28°C (room temperature) for a secondary fermentation (spore-forming fermentation) for 3-5 days. The culture is then dried in the shade to obtain a microbial agent rich in spores suitable for long-term storage.

[0023] Through the above preparation method, the effective viable bacteria count of the microbial agent of the present invention reached 43.16×10 9 CFU / g.

[0024] The fifth aspect of the present invention discloses a culture of the above-mentioned Aspergillus terreus, specifically including substances obtained by culturing the above-mentioned Aspergillus terreus in a culture medium, including metabolites, such as organic acids or other ionic compounds.

[0025] The term "culture" refers collectively to any liquid or solid product (all materials within a culture container) containing a microbial population after artificial inoculation and cultivation. This refers to a product obtained by growing and / or amplifying microorganisms. It can be a biologically pure culture of the microorganism or contain a certain amount of culture medium, metabolites, or other components produced during the culture process. The term "culture" also includes subcultures obtained by subculturing microorganisms, which can be cultures of a single generation or a mixture of several generations.

[0026] The term "metabolite" refers to the primary and / or secondary metabolites produced during microbial metabolism. Primary metabolism refers to the process by which microorganisms absorb various nutrients from the outside world and, through catabolism and anabolism, generate substances and energy to sustain life activities. The products of primary metabolism are primary metabolites, such as monomers such as monosaccharides or monosaccharide derivatives, nucleotides, vitamins, amino acids, fatty acids, and various macromolecular polymers composed of them, such as proteins, nucleic acids, polysaccharides, and lipids. Secondary metabolism refers to the process by which microorganisms, during a certain growth period, use primary metabolites as precursors to synthesize substances with no clear function in the microorganism's life activities. The products of secondary metabolism are secondary metabolites, which are mostly compounds with relatively complex molecular structures. Based on their functions, they can be divided into types such as antibiotics, hormones, alkaloids, and toxins.

[0027] The sixth aspect of the present invention discloses the use of the above-mentioned Aspergillus terreus CY-05, Aspergillus terreus inoculant or Aspergillus terreus culture in at least one of the following:

[0028] 1) Phosphate dissolution;

[0029] 2) Inhibit pathogens of soil-borne pepper diseases;

[0030] 3) production of terrein;

[0031] 4) Improve plant drought resistance;

[0032] 5) Promote plant growth.

[0033] The method of inhibiting the soil-borne pathogens of peppers is to use the soil-borne pathogens to prevent and control vegetable diseases; the soil-borne pathogens of peppers include pepper root rot pathogens, pepper sclerotinia pathogens and Rhizoctonia solani;

[0034] Phosphate dissolution refers to the decomposition of inorganic phosphorus that is difficult to utilize to activate soil fertility and promote plant growth;

[0035] Among them, the production of terreusin can help crops tolerate drought;

[0036] Among them, promoting plant growth is reflected in all or part of the following:

[0037] 1) Promote plant yield increase under drought stress;

[0038] 2) Promote the increase of plant aboveground biomass under drought stress.

[0039] The seventh aspect of the present invention discloses a method for improving plant drought resistance or promoting plant growth, characterized in that it comprises the following steps: under drought stress conditions, applying the Aspergillus terreus described in claim 1 or the bacterial agent described in claim 2 or the culture described in claim 3 to the test plant, thereby improving the plant drought resistance or promoting plant growth; the plants include but are not limited to crops such as peppers and corn.

[0040] In the potted test application, the fungicide was applied under the pepper seedlings before colonization, with a dosage of 1.0-5.0g per plant. After that, the colonization and cultivation were managed according to routine operations, and the yield and aboveground biomass were counted after the growing season.

[0041] The present invention has the following significant advantages and effects compared to the prior art:

[0042] The Aspergillus terreus strain of the present invention was screened from the rhizosphere soil of peppers, eliminating concerns about biosafety. Aspergillus terreus CY-05 is a growth-promoting microbial strain with disease resistance, high terrein production, and phosphate solubilization capabilities. It also possesses multiple functions, including improving crop drought tolerance, resulting in a superior strain with exceptional viability. Application of an Aspergillus terreus agent can increase crop tolerance to drought, promote crop growth and development under drought stress conditions, increase yield, and enhance survival, promote the conversion and utilization of poorly soluble phosphorus, and prevent the occurrence of soil-borne root diseases. Strain CY-05, derived from pepper rhizosphere soil, is non-toxic and harmless to humans and animals, and does not cause environmental pollution. The fermented culture of this strain has beneficial effects and helps crops resist drought, helping to address the water shortage problem facing agricultural production in vast semi-arid cropping areas (such as Xinjiang, Shaanxi, and Inner Mongolia), thus possessing significant economic significance. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] In order to more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the specific embodiments or the description of the prior art. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0044] Figure 1This is the culture morphology of Aspergillus terreus CY-05 on PDA plate.

[0045] Figure 2 This is the microscopic morphology of Aspergillus terreus CY-05.

[0046] Figure 3 This is the multi-gene combined phylogenetic tree of Aspergillus terreus CY-05.

[0047] Figure 4 This is the antibacterial graph of Aspergillus terreus CY-05 after 14 days of confrontation culture with pepper root rot pathogens, Rhizoctonia solani and Sclerotinia solani.

[0048] Figure 5 This is the growth of Aspergillus terreus CY-05 on phosphate-dissolving medium.

[0049] Figure 6 This is the fitting curve for ELISA detection of terreusin content in Aspergillus terreus CY-05.

[0050] Figure 7 It is a solid bacterial agent of Aspergillus terreus CY-05.

[0051] Figure 8 Analysis of drought resistance indicators MDA content, SOD, POD, and CAT activity in peppers treated with Aspergillus terreus in a potted experiment. A is MDA content; B is SOD activity; C is POD activity; and D is CAT activity.

[0052] Figure 9 This is a potted experiment in which the pepper plants and roots were treated with solid Aspergillus terreus inoculant. DETAILED DESCRIPTION

[0053] The present invention is further illustrated by way of examples below, but the invention is not limited to the scope of the examples. Experimental methods in the following examples where specific conditions are not specified were performed according to conventional methods and conditions, or selected according to the product specifications. The raw materials and equipment used in the examples are well known to those skilled in the art and are all commercially available, easily obtained, or prepared.

[0054] Example 1 Isolation, screening and classification identification of strain CY-05:

[0055] 1. Isolation and screening of strains:

[0056] The pepper plot of Mayouying, Beipiao, Chaoyang, Liaoning Province was selected, and the pepper plants were pulled out and rhizosphere soil samples were collected by shaking the roots. When separating, 1g of soil sample was placed in 99mL of sterile saline and shaken for 30min. -2 , 10 -3 , 10 -4100 μL of the soil suspension was spread on a Martin solid plate containing 50 μg / ml streptomycin and cultured at 28°C for 5 days. A single colony was selected for purification and the purified strain was inoculated into a PDA slant medium for storage.

[0057] The isolated strains were inoculated on one side of the PDA culture medium, and at the same time, the pepper root rot pathogen, Rhizoctonia solani and pepper sclerotinia pathogen were inoculated for confrontation culture. After 3 days of culture, continuous observation was carried out, and strains with biocontrol activity were selected and preserved. From them, a fungal strain with obvious control effect on pepper root rot was screened and numbered CY-05.

[0058] 2. Morphological characteristics of the strain:

[0059] The strain to be tested was inoculated in the center of the PDA plate culture medium and cultured at a constant temperature of 25°C for 5 days. The color, morphology, size, conidia attachment status and size of the colony were observed, and the biocontrol fungi were morphologically identified with reference to the "Handbook of Fungal Identification" and "Chinese Mycota".

[0060] The morphological characteristics of the Aspergillus terreus CY-05 provided by the present invention are that after being cultured on a PDA plate at 28°C for 5 days, dense white and slightly yellowish hairy mycelium is formed, which is round or nearly round, with irregular edges and a slightly raised center. Figure 1 The conidiophores are straight columnar, with the top swelled to form a spherical apical capsule. The conidiophores are double-layered, with the peduncles densely attached to the upper half of the apical capsule. The peduncles are 8.0-9.5μm×2.5-3μm, and the phialides are 7-8μm×1.3-1.5μm. Conidia are single-celled, spherical or nearly spherical, 2.5μm ( Figure 2 ).

[0061] Based on the above culture characteristics and microscopic morphological characteristics, according to the Manual of Fungal Identification and the Morphology and Classification of Fungi, it can be known that the fungal strain CY-05 is similar to Aspergillus terreus ( Aspergillus terreus ) are most similar.

[0062] 3. Molecular biological identification of strains:

[0063] 4. The genomic DNA of the CY-05 strain was extracted using a kit. PCR amplification of the test strain was performed using universal fungal primers ITS (ITS1; ITS4), β-tubulin gene (Bt2a; Bt2b), and calmodulin gene (CMD5; CMD6). Sequencing analysis was performed by Shanghai Sangon Biotechnology Co., Ltd. The sizes of the three gene fragments were 584bp, 590bp, and 596bp, respectively. The sequences are shown below.

[0064] 5. ITS sequence of strain CY-05

[0065] >CY-05_ITS1 584bp

[0066] TTGATATGCTTAAGTTCAGCGGGTATCCCTACCTGATCCGAGGTCAACCTGGAAAAAAACAAGTTGCAAATAAATGCGTCGGCGGGCGCCGGCCGGGCCTACGGAGCGGAAGACGAAGCCCCATACGCTCGAGGACCGGACGCGGTGCCGCCGCTGCCTTTCGGGCCCGTCCCCCGGGAGCCGGGGGACGAGGGCCCAACACACAAGCCGGGCTTGAGGGCAGCAATGACGCTCGGACAGGCATGCCCCCCGGAATACCAGGGGGCGCAATGTGCGTTCAAAGACTCGATGATTCACTGAATTCTGCAATTCACATTAGTTATCGCATTTCGCTGCGTTCTTCATCGATGCCGGAACCAAGAGATCCATTGTTGAAAGTTTTAACTGATTGCAAAGAATCACACTCAGACTGCAAGCTTTCAGAACAGGGTTCATGTTGGGGTCTCCGGCGGGCACGGGCCCGGGGGCGAGTCGCCCCCCGGCGGCCAGCAACGCTGGCGGGCCCGCCGAAGCAACAAGGTACAATAGTCACGGGTGGGAGGTTGGGCCATAAAGACCCGCACTCGGTAATGATCCTTCCGCAG

[0067] β-tubulin gene sequence of strain CY-05

[0068] >CY-05_BT2 590bp

[0069] CCGAACCACTTGGTAACCCAAAACGGTGCTGCTTTCTGGTASGTCTGGWATCAACCTGGGGAATGCTGGCTCTCGTGGGATGCAGAGTCTTACGGACATGCGTCCTCGGGCTAAAAAGGGTTCTGTGGTGGCATGATGCTGACAACTGTACAGGCAAACCATCTCTGGCGAGCACGGCCTTGATGGCTCCGGTGTGTAAGTGTCACCGACGCCCGCTCAATGGGCTCCCATAATGGAGGTTTACACGACGATGGACGATTCTGATGTGGAAACAGCTTCAATGGCTCCTCCGACCTCCAGCTCGAGCGCATGAACGTCTACTTCAACGAGGTACGTCCCTTCCACACCATCCTGGGACAGATTCTCCACGCTCCAAAGACCTCGACACTAATTTCGATCCCCTTTAGGCCAGCGGAAACAAGTATGTTCCTCGTGCCGTCCTCGTTGACCTTGAGCCCGGTACCATGGACGCCGTCCGTGCCGGTCCCTTCGGTCAGCTCTTCCGTCCCGACAACTTCGTCTTCGGCCAGTCTGGTGCCGKTAMCWMCTGGGCCAAGGGTCACTACACTTGAGGGTAACCAGCCCCCCCG

[0070] Calmodulin gene sequence of strain CY-05

[0071] >CY-05_CMD 596bp

[0072] AAGGGGGCAACGTTCCGAGTACAAAGAAGCCTTCTCCCTCTTYGKATGTCTTGACTTACCCTCTTCCATCTCTCCGTGTTCCAGGCTCGTTTTCCGAAACACAAGCTAACTGGGATTCTCCTCTGTTTTAGGACAAGGATGGTGATGG TTAGTGCAATTTCCCGCTCCGATTGCCTCATGCGACCGATCGATTGCATCGTTCTATGTCGAATCTCGAGTCTTGACTTTATCTTCTGTTATGGTCGATCATTTAACACCATGTAGGCCAGATCACCACCAAGGAGCTGGGAACCGTCA TGCGCTCGCTGGGCCAGAAACCCTCCGAGTCGGAGCTCCAGGACATGATCAACGAGGTTGATGCTGACAACAACGGCACCATTGACTTTCCTGGTACGTTCCGTTCTACACGAGTCGCTGGAACCAGTTGTTGACATTTCCTTGAACAG AGTTCCTCACGATGATGGCCCGCAAGATGAAAGACACCGACTCCGAGGAGGAAATCCGGGAAGCTTTCAAGGTCTTTGACCGCGATAACAACGGTCWTCATCKCCGCCGCCGAGCTGCGCCACGTCATACCCTTCCATCGGAACCCCTC

[0073] The homology comparison between the gene sequences of known model strains in Gen Bank was performed using Blastn on NCBI. The strain CY-05 was similar to Aspergillus terreus subvillous variant ( A. terreus var. subfloccosus CBS 117.37) and Aspergillus terreus ( Aspergillus terreus The homology of the model strain of NRRL 255 was 99.20%-100%. The BenA, CAM and ITS-r DNA gene sequences of the closely related model strains were downloaded and sequence alignment (MAFFT), concatenation (Concatenate), partitioning (Partition Finder2), and Bayesian tree analysis was performed. A. flavipes ) for the outgroup phylogenetic tree shows that ( Figure 3 ), strain CY-05 and A. terreus var. subfloccosus(NR149331, FJ531223 and FJ491704) formed a phylogenetic cluster. Combined with the above morphological characteristics and multi-gene phylogenetic analysis, the strain CY-05 was identified as Aspergillus terreus subvillous variant ( A. terreus var. subfloccosus ), the strain was deposited in the China Center for Type Culture Collection on September 11, 2023, with the deposit number CCTCC M 20231162.

[0074] Example 2 Functional properties of Aspergillus terreus CY-05:

[0075] (1) This strain has antagonistic effects on a variety of soil-borne pathogens:

[0076] The root rot pathogen ( Fusarium solani ), pepper sclerotinia pathogen ( Sclerotinia sclerotium ) and Rhizoctonia solani ( Rhizoctonia solani ) Three pathogens were spot-inoculated on one side of the culture dish, 25 mm from the center. Well-grown Aspergillus terreus was spot-inoculated on the other side. The pathogens were cultured alone in the control group. Each experiment was repeated three times. After 7 days of constant incubation at 28°C, the in vitro inhibition rate of strain CY-05 against pepper pathogenic fungi was determined. The culture was continued for another 7 days to observe the strain's ability to weaken the parasitic fungi.

[0077] Inhibition rate = (D control − D treatment) / D control × 100%

[0078] The results showed that the inhibition rate was between 21.57% and 50.59%, with significant inhibition against pepper root rot pathogens and Rhizoctonia solani (Table 1). After 14 days of confrontation culture, it was found that the Aspergillus terreus strain gradually grew and covered the pathogens, with the most obvious effect against Sclerotinia solani and Rhizoctonia solani. The bacteria could be seen growing on the pathogens and multiplying and producing spores ( Figure 4 ), the heavy parasitic effect is significant.

[0079] Table 1 Antibacterial effect and inhibition rate of Aspergillus terreus on soil-borne pathogenic fungi

[0080] pathogens Fusarium solani Rhizoctonia solani Pepper Sclerotium Antibacterial rate 46.38% 50.59% 21.57%

[0081] (2) The invented strain has the ability to produce chitinase and β-1,3 glucanase

[0082] Activated CY-05 was inoculated into potato dextrose liquid medium and cultured at 28°C for 96 hours. The fermentation broth was harvested and centrifuged at 2000-3000 rpm for approximately 20 minutes at 2-8°C. The supernatant was collected and assayed for enzyme activity using chitinase and β-1,3 glucanase assay kits (Solarbio). One unit of chitinase activity is defined as the amount of enzyme required to decompose chitin to produce 1 mg of N-acetylglucosamine per milliliter of culture medium per hour at 37°C. One unit of β-1,3 glucanase activity is defined as the amount of enzyme required to catalyze the production of 1 mg of glucose from laminarin per milliliter of crude enzyme solution in 1 minute.

[0083] The enzyme activities of the fermentation broth were calculated according to the standard curve. The chitinase activity and β-1,3 glucanase activity were as high as 2.116 U / ml and 0.354 U / ml, respectively. It can be seen that Aspergillus terreus CY-05 can decompose and utilize the cell wall components of pathogenic fungi and has antagonistic ability against pathogens through heavy parasitism.

[0084] (3) The invented strain has a highly efficient phosphate solubilization capability:

[0085] Activated CY-05 was inoculated into phosphate solid medium and cultured at 28°C for 60 h. The ability of the strain to solubilize inorganic phosphate was determined by measuring the ratio of the phosphate-dissolving zone diameter (HD) to the colony diameter (CD) (HD / CD). Simultaneously, the test strain was inoculated into phosphate liquid medium (PKO) with no inoculation as a blank control. The culture was shaken at 28°C and 170 rpm for 7 days. After shaking and centrifugation, the supernatant was collected, the pH was measured, and the available phosphate concentration was quantitatively determined using the molybdenum antimony colorimetric method. The detailed procedure was referred to the method of Sun Yaqin et al.

[0086] Phosphate-lysate broth (PKO): Prepare 10 g of glucose, 5 g of calcium phosphate, 0.3 g of sodium chloride, and 0.5 g of ammonium sulfate. Add water to a volume of 1 L and adjust the pH to 7.0. Fill a 250 mL Erlenmeyer flask with 50 mL of phosphate-lysate broth. The composition of the phosphate-lysate solid medium is the same as that of the liquid medium, with the addition of 18 g of agar powder.

[0087] Depend on Figure 4 As shown in Table 2, Aspergillus terreus CY-05 has the ability to solubilize phosphate while simultaneously lowering the pH of the fermentation broth. Acid production is one of the primary pathways for phosphate-solubilizing bacteria. Numerous studies have confirmed that the phosphate-solubilizing capacity of phosphate-solubilizing bacteria is negatively correlated with pH. The organic acids produced chelate with metal cations such as calcium, aluminum, iron, and magnesium, converting insoluble phosphate into soluble phosphate. Quantitative determination results showed that strain CY-05 solubilized 66.392 mg / L of phosphate.

[0088] Table 2 pH value and qualitative and quantitative phosphate solubilization ability of the fermentation broth of strain CY-05

[0089] Phosphate decomposition qualitative analysis (HD / CD) Phosphorus quantification (mg / L) pH 1.627 65.319 5.82 1.662 70.436 5.68 1.571 63.422 5.85 1.620 66.390 5.78

[0090] (4) Resistance of Aspergillus terreus CY-05 to acid, alkali and temperature

[0091] Prepare seed plates for strain CY-05 and select colonies of uniform size to inoculate onto liquid PDA medium at different initial pH values (3, 4, 5, 6, 7, 8, 9, and 10). Incubate at 30°C for 3-4 days. Simultaneously, inoculate strain CY-05 onto liquid PDA medium and incubate at different temperatures (10°C, 20°C, 30°C, 40°C, 45°C, and 50°C) for 3-4 days to observe bacterial growth.

[0092] Results showed that strain CY-05 can grow normally at pH values between 3 and 10, with an optimal pH of 5-8. The pH measured at the end of fermentation was 5-6, indicating that strain CY-05 produces acid during fermentation, which facilitates the hydrolysis and release of minerals and trace elements in the soil. Strain CY-05 also grows well at temperatures between 20 and 45°C, with an optimal culture temperature of 25-35°C, demonstrating its high acid and alkali tolerance and wide temperature adaptability.

[0093] (5) Ability to produce terrene

[0094] The activated CY-05 was inoculated into a potato dextrose liquid medium and cultured at 28°C for 96 h. The fermentation broth was collected and centrifuged at 2-8°C for about 20 minutes (2000-3000 rpm). The supernatant was collected and the Aspergillus terreus content was detected using the terreus ketone detection kit. At the same time, the standard solution provided in the kit was used to determine the standard curve. The standard curve was drawn using ELISACalc, see Figure 5 , according to the curve shape, logistic curve fitting (four parameters) was performed to obtain the standard curve equation Y=(2.97931-0.13161) / [1+(X / 15.42685) 2.11883 ]+0.13161(R 2 =0.99907), and the terrein content in the fermentation broth was calculated to be 220.812 pg / mL based on the standard curve.

[0095] Weigh 1g of the fermented solid inoculum and add 9g of PBS buffer (pH 7.2-7.4). Manually mix thoroughly. Centrifuge at 2000-3000 rpm at 2-8°C for approximately 20 minutes and carefully collect the supernatant. Aliquot a portion for testing and freeze the remainder for future use. If precipitation forms during storage, re-centrifuge. Prepare 0.01mol / L PBS buffer: 0.27g of potassium dihydrogen phosphate (KH2PO4), 1.42g of disodium hydrogen phosphate (Na2HPO4), 8g of sodium chloride (NaCl), and 0.2g of potassium chloride (KCl). Add approximately 800mL of deionized water and stir thoroughly to dissolve. Adjust the pH to 7.2-7.4 with concentrated hydrochloric acid and bring the volume to 1L. Calculate the supernatant concentration using the standard curve and convert it to 2227.963pg / g terreusin.

[0096] Example 3 Preparation of Aspergillus terreus solid inoculant

[0097] (1) Strain activation and preparation of bacterial suspension: Aspergillus terreus CY-05 was inoculated on PDA slant and cultured at 28°C for 7 days to obtain a strain with good activity. The slant strain was transferred to the slant of PDA eggplant bottle and cultured at 28°C for 7 days. An appropriate amount of sterile saline was added to the slant. The spores were evenly dispersed in the sterile saline to prepare a spore suspension. The spores were counted on a hemocytometer. The concentration of the Aspergillus terreus spore suspension was adjusted to 10 7 -10 8 CFU / mL is the seed solution.

[0098] (2) Preparation of solid culture medium for Aspergillus terreus: Weigh 5 parts of rice husk powder, 35 parts of bran, 35 parts of rice husk, 15 parts of corn flour, and 10 parts of soybean meal powder in parts by weight, and mix the above materials thoroughly. In order to make the distribution of ammonium sulfate and potassium dihydrogen phosphate more uniform, dissolve them in water in advance. Stir the above mixed materials with water at a material-water mass ratio of 1:0.5, and then put them into polypropylene edible fungus culture bags, about 500g per bag. Sterilize them at 121℃ and 1.2kg / cm2 pressure for 50 minutes to obtain solid culture medium. Repeat the test 3 times.

[0099] (3) Fermentation with solid inoculant of Aspergillus terreus:

[0100] Inoculate the Aspergillus terreus seed liquid into the above-mentioned solid culture medium at a volume-to-mass ratio of 5%. In the first stage, incubate at 30°C for 5 days. During this process, observe whether the surface of the culture medium is covered with mycelium. Once the mycelium is fully grown, transfer the solid culture medium from the bag to a koji tray. In the second stage, incubate at 20-25°C for 5 days for sporulation and fermentation. This process produces a large number of spores, and the surface color of the material turns beige-brown. After the solid fermentation is completed, the Aspergillus terreus inoculum is obtained, and the viable cell count in the inoculum is determined.

[0101] (4) Determination of the number of viable bacteria of Aspergillus terreus: The number of viable bacteria of the bacteria was determined by serial dilution plating. PDA medium was used and the dilution gradient was 10 -7 , 10 -8 , 10 -9 The viable bacterial counts in the three validation tests were 46.94×10 9 CFU / g, 32.67×10 9 CFU / g, 49.87×10 9 The CFU / g and error were all within the allowable range, and the contaminant bacteria rate was less than 1%, indicating that the strain formula had stable growth, good reproducibility, and good applicability.

[0102] Example 4 Effects of Aspergillus terreus on the malondialdehyde (MDA) content and antioxidant enzyme (SOD, POD, CAT) activities in pepper leaves under drought stress conditions:

[0103] The microbial agent prepared in Example 3 was used, and the viable bacterial count before the test was 43.16×10 9 CFU / g. In order to ensure the accuracy of the test, the concentration of viable bacteria of the microbial agent was adjusted to 2.0×10 8 CFU / g (standard number of viable bacteria of agricultural microbial agents), select the same period of local pepper cultivation (early May) for planting, apply 5g / plant of base fertilizer before transplanting and planting, and let the healthy pepper seedlings grow indoors for 7 days after transplanting. Then, transfer them to the open air environment for cultivation and start different experimental treatments. Each group of treatments was repeated 5 times, and topdressing was done once in the middle of the growing season (5 months), and the fertilizer amount was still 5g / plant.

[0104] For example, in the arid regions of western Liaoning Province, my country, the average soil moisture content in wet years is 15.7%, indicating optimal soil moisture, allowing normal crop growth and development. In drought years, the average soil moisture content is 12.9%, indicating yellow soil moisture, indicating crop yield reduction due to drought stress. At this time, the soil moisture content is approximately 82% of optimal soil moisture. Given these factors, the pepper pot drought stress experiment was designed to simulate natural drought conditions as follows:

[0105] 1) Normal water supply group (W), i.e. control group: grown under normal irrigation conditions;

[0106] 2) Drought stress group (D): Drought stress was applied at 80% of the normal water supply. The watering frequency was determined based on the local temperature, light intensity, and rainfall conditions. The optimal watering frequency was after all leaves in the drought stress group wilted for one day to avoid excessive drought causing seedling death. The normal watering frequency remained the same as that in the drought stress group.

[0107] 3) Aspergillus terreus inoculant treatment group (D+As): three treatments were set up, namely, 1 g / plant (D+As1), 2 g / plant (D+As2), and 5 g / plant (D+As5) of Aspergillus terreus solid inoculant were added. The water supply and watering frequency were the same as those of the drought group.

[0108] During the peak fruiting period (mid-July), leaves from the middle of pepper plants, showing good growth, were collected for phenotypic observation and then subjected to experimental measurements. Compared to the control group (W) with normal water supply, leaves in the Aspergillus terreus treatment group (D+As) showed slight wilting, while leaves in the drought treatment group (D) showed visible wilting. Leaf color was not significantly different among the treatment groups, ranging from yellowish-green to green.

[0109] Pepper physiological index measurement: Based on literature reports, physiological indicators closely related to pepper drought resistance, such as malondialdehyde (MDA) content and antioxidant enzyme (SOD, POD, CAT) activities, were selected to evaluate the drought resistance of the plants. The veins of fresh leaves were removed, and 0.5 g of leaf samples were placed in a pre-cooled mortar and pestle, and 2 mL of pre-cooled 0.05 mol·L －1 Phosphate buffer (containing 10 g / L PVP, pH 7.0) and a small amount of fine quartz sand were then ground into a homogenous slurry. The mortar was rinsed with 3 mL of the phosphate buffer, and the extracts were combined and centrifuged at 10,000 rpm for 20 min at 4°C. The precipitate was extracted once again using the above method, and the supernatant was combined and the volume was adjusted to 5 mL. The sample was stored at 4°C and used for the determination of MDA content and superoxide dismutase (SOD), peroxidase (POD) and catalase (CAT) activities. Superoxide dismutase (SOD) activity was determined by the nitroblue tetrazolium reduction method, peroxidase (POD) activity by the guaiacol colorimetric method, and catalase (CAT) activity by ultraviolet spectrophotometry. MDA content was determined by the thiobarbituric acid method.

[0110] based on Figure 8 As shown, inoculation with different doses of Aspergillus terreus improved peppers' ability to scavenge malondialdehyde (MDA) under drought stress. MDA content showed no significant difference compared to normal water supply (P < 0.05), reducing water damage to plant cells and thus improving peppers' drought tolerance. Under drought stress, the changes in the activities of the antioxidant enzymes SOD, POD, and CAT were opposite to those of oxidative stress indicators. Inoculation with Aspergillus terreus activated plant reactive oxygen species (ROS) signals, increasing the activity of antioxidant enzymes, including SOD, POD, and CAT, enabling plants to retain water under drought conditions and enhancing peppers' drought tolerance. Compared to normal water supply, antioxidant enzyme activity showed no significant difference (P < 0.05).

[0111] Example 5 The beneficial effects of Aspergillus terreus agents on increasing pepper yield and aboveground biomass under drought stress conditions:

[0112] In Example 4, the potted peppers with different treatments were harvested during the fruiting period and the yield of each plant was counted; after the end of the growing season, the aboveground plants were collected to count the aboveground biomass and the roots were sorted and photographed; and the yield reduction and year-on-year reduction ratio of the aboveground biomass of the peppers under drought stress and the effect of the Aspergillus terreus agent on the yield were analyzed.

[0113] Yield: Peppers were harvested throughout the fruiting period and dried to a constant weight. The dry weight was measured using a 1% electronic balance to calculate the yield per plant and convert it into yield per hectare.

[0114] Aboveground biomass: After the end of the growing season (early October), the aboveground plants and leaves were collected and dried to a constant weight, and the dry weight was measured using a 1% electronic balance.

[0115] Root system: Pull out the roots with the soil as a whole, carefully clean the residual soil attached to the roots, try not to destroy the integrity of the roots, and take photos after sorting.

[0116] Table 3 Effects of applying Aspergillus terreus fungicide on pepper yield and aboveground biomass

[0117] Drought stress treatment Yield (g / plant) Increase in yield of microbial agent / % Drought stress yield reduction / % Aboveground biomass (g / plant) Year-on-year growth / % Drought stress decreased by % year-on-year Drought stress (D) 21.285 34.004 31.291 23.920 1g / plant (D+As1) 32.521 52.783 -0.831 44.751 43.016 -8.806 2g / plant (D+As2) 32.047 50.559 0.638 42.262 35.059 -2.752 5g / strain (D+As5) 27.781 30.514 13.866 38.683 23.627 5.945 Normal water supply (W) 32.252 51.524 41.128 31.441

[0118] The effect of inoculation with Aspergillus terreus on drought resistance of pepper was investigated and analyzed. As shown in Table 4, compared with drought stress, inoculation with Aspergillus terreus could increase yield by 30.514-52.783%, and aboveground biomass increased by 23.627-43.016% year-on-year; compared with normal water supply, drought stress reduced yield by 34%, and aboveground biomass decreased by 23.920% year-on-year; inoculation with Aspergillus terreus reduced yield by (-0.831)-13.866% compared with normal water supply, and aboveground biomass decreased by (-8.806)-5.945% year-on-year. The apparent analysis of the roots under different treatments found that ( Figure 9 ), inoculation with Aspergillus terreus agent promotes root elongation and thickening, especially significantly increases root length and the number of lateral roots.

[0119] A large number of studies have reported that PGPR inoculants promote root development and thus improve the plant's ability to absorb water by affecting the production of endogenous hormones and metabolites and the expression of genes related to the accumulation of antioxidants. It is an effective way to rely on plant rhizosphere growth-promoting bacteria to improve the plant's drought resistance. The patented PGPF Aspergillus terreus may improve plant drought resistance through three mechanisms. On the one hand, it produces the extraspore metabolite terreusone, which acts in the rhizosphere of plants to help plants withstand drought; on the other hand, rhizosphere Aspergillus terreus stimulates the activity of the plant's antioxidant enzyme system, enhances the plant's antioxidant capacity, reduces drought-induced oxidative damage, and thus improves the plant's drought resistance; third, it promotes root extension and lateral root development under drought stress conditions, thereby improving the plant's ability to absorb water.

[0120] The above description is only a preferred specific embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any technician familiar with the technical field, within the technical scope disclosed by the present invention, who makes equivalent replacements or changes based on the technical solution and inventive concept of the present invention, should be covered by the scope of protection of the present invention.

Claims

1. Aspergillus terreus CY-05 ( Aspergillus terreus ), characterized in that, Aspergillus terreus CY-05 was deposited in the China Center for Type Culture Collection on September 11, 2023, with the deposit registration number CCTCC M 20231662.

2. Use of the Aspergillus terreus according to claim 1 in at least one of the following: 1) Phosphate dissolution; 2) Inhibiting pepper soil-borne pathogens, wherein the pepper soil-borne pathogens are pepper root rot pathogens Fusarium solani , pepper sclerotinia pathogen Sclerotinia sclerotium and Rhizoctonia solani; 3) production of terrein; 4) Improve plant drought resistance; 5) Promote plant growth.

3. The use according to claim 2, characterized in that The plant growth promotion is embodied in whole or in part as follows: 1) Promote plant yield increase under drought stress; 2) Promote the increase of plant aboveground biomass under drought stress.

4. A bacterial agent, characterized in that The Aspergillus terreus CY-05 according to claim 1 is obtained by solid fermentation.

5. The method for preparing the microbial agent according to claim 4, wherein: The steps include: 1) Activation of the strain: Inoculate the Aspergillus terreus CY-05 strain stored on a low-temperature slant onto a PDA medium plate and incubate at 30°C ± 2°C for 3-4 days. 2) Preparation of spore suspension: Inoculate Aspergillus terreus CY-05 strain on the slope of a PDA culture flask and incubate at 30±2℃ for 4-5 days. Rinse the CY-05 strain spores with sterile water and dilute with sterile water to a spore concentration of 10 7 -10 8 cfu / mL; 3) Inoculation: The Aspergillus terreus CY-05 spore suspension prepared in step 2) was inoculated into a solid fermentation medium at a mass ratio of 2%-10%, cultured at 30±2°C for 3-5 days, and then incubated at 20-28°C for 4-6 days for sporulation fermentation. Among them, the solid culture medium is material and water, and the material-water mass ratio is 1:0.5; The materials are calculated by weight, and the components include 5 parts of rice husk powder, 35 parts of rice husk, 35 parts of bran, 15 parts of corn flour, 10 parts of soybean meal powder, ammonium sulfate and potassium dihydrogen phosphate; 4) The solid culture obtained in step 3) is naturally air-dried to obtain a microbial agent rich in spores and suitable for long-term storage.

6. A method for improving plant drought resistance or promoting plant growth, characterized in that: The method comprises the following steps: applying the Aspergillus terreus according to claim 1 or the bacterial agent according to claim 4 to a test plant under drought stress conditions, thereby improving the drought resistance of the plant or promoting plant growth.

Images