A donkey-derived Escherichia coli phage depolymerase Dp14 and its application

Abstract

The present invention belongs to the field of bioengineering technology, and specifically relates to a depolymerase Dp14 of donkey-derived Escherichia coli phage and its application. The gene sequence of the depolymerase Dp14 provided by the present invention is shown in SEQ ID NO.1. The present invention successfully expresses and purifies the phage depolymerase Dp14, and has strong specificity; the higher the concentration, the longer the action time, and the larger the halo; the depolymerase Dp14 has poor tolerance to high temperature, and the temperature of 50°C and above will lose the antibacterial effect; the biofilm test shows that the depolymerase Dp14 has the ability to inhibit the formation of biofilm by Escherichia coli, and its antibacterial effect is more significant when used in combination with healthy donkey serum than when used alone. There is a synergistic effect between the depolymerase provided by the present invention and the serum, which can enhance the bactericidal effect. This combined use method provides a new idea for the treatment of Escherichia coli resistant strain infection.

Description

Technical Field

[0001] The invention belongs to the technical field of bioengineering, and in particular relates to a depolymerase Dp14 of donkey-derived Escherichia coli phage and an application thereof. Background Art

[0002] As a common conditional pathogen, Escherichia coli can cause local and systemic infections in humans and a variety of animals. With the rapid development of the donkey industry in recent years, diarrhea caused by E. coli has become an important pathogenic factor affecting the survival rate of donkey foals. Donkey foal diarrhea is mainly concentrated from birth to 2 months of age, and is mainly manifested by the discharge of watery or pasty feces containing blood and curds. When the disease worsens, recumbency, coma and death may occur. The economic losses caused by donkey foal diarrhea seriously affect the development of the donkey industry, so it is very important to solve the problem of donkey foal diarrhea caused by E. coli.

[0003] Antibiotics are the first choice for treating bacterial infections. Due to the irrational use of antibiotics, drug-resistant strains of Escherichia coli are prevalent. The formation of biofilms is an important cause of Escherichia coli resistance. As a protective barrier for Escherichia coli, biofilms not only help bacteria survive under adverse environmental conditions (such as nutrient deficiency, dryness, etc.), but also significantly enhance tolerance to antibiotics and other antimicrobial drugs, and can resist attacks by immune cells, which greatly increases the difficulty and cost of treatment. In view of the current situation that the clinical use of antibiotics to treat Escherichia coli infections is not effective, there is an urgent need to develop new antibacterial preparations.

[0004] Phages have a good killing effect on bacteria, but phages are also prone to produce tolerant bacteria, while bacteria are not easy to develop tolerance to phage lytic enzymes and depolymerases. Phage depolymerase is an extracellular matrix encoded and synthesized by the phage genome after the phage infects the host bacteria. It is mainly involved in the synthesis of structural proteins such as certain tail fibers, tail spines or tail tube proteins of the phage. These depolymerases have the ability to diffuse in agar, and are faster than the diffusion rate of the phage, by degrading the extracellular polysaccharides produced by bacteria to form a translucent halo. Extracellular polysaccharides are the main matrix for the formation of bacterial biofilms, and phage depolymerases eliminate or weaken the protection of bacteria by degrading extracellular polysaccharides, so depolymerases have important application potential in inhibiting the formation of bacterial biofilms, improving the effect of antibiotics, and enhancing the body's immune system to phagocytize bacteria. In the prior art, there are few reports on the relevant depolymerases of donkey-derived Escherichia coli phages. Summary of the invention

[0005] In view of the problems of diseases caused by Escherichia coli and drug resistance in the prior art, the present invention provides a depolymerase Dp14 of donkey-derived Escherichia coli phage.

[0006] The present invention further provides the application of the above-mentioned donkey-derived Escherichia coli phage depolymerase Dp14.

[0007] The technical solution adopted by the present invention to achieve the above-mentioned purpose is:

[0008] The invention provides a depolymerase Dp14 of donkey-derived Escherichia coli phage, and the gene sequence of the depolymerase Dp14 is shown in SEQ ID NO.1.

[0009] The present invention also provides a method for preparing the above-mentioned depolymerase Dp14, comprising the following steps:

[0010] The gene fragment of the depolymerase Dp14 is obtained by PCR, restriction digestion and linker molecule cloning, and the gene fragment of Dp14 is connected to a plasmid vector to obtain a recombinant plasmid;

[0011] Transforming the recombinant plasmid into competent cells, and screening to obtain recombinant host cells containing the recombinant plasmid;

[0012] Cultivating the recombinant host cell to obtain a culture fluid;

[0013] After the culture fluid is separated, the liquid is collected to obtain the depolymerase Dp14.

[0014] Preferably, in the process of obtaining the gene fragment of the depolymerase Dp14, the primers used for amplification are:

[0015] Upstream primer PL-F (SEQ ID NO.2): ctcggtaccctcgag ggatcc ATGACCTTAGTTAAAAATATTGAAGTGACC;

[0016] Downstream primer PL-R (SEQ ID NO.3):

[0017] agcagagattaccta tctaga CTAACGCAGTGCTTTACGGTTG.

[0018] Preferably, the plasmid vector is a pCold TF vector; and the competent cell is BL21 (DE3).

[0019] Preferably, the culture is as follows: pick a single colony of the recombinant host cell and place it in 5 mL of Amp broth, and culture it at 37°C with shaking overnight; then add the bacterial solution to LB broth containing Amp at a ratio of 1:100, and culture it at 37°C until OD 600 After the pH value was 0.6-0.8, IPTG was added to a concentration of 0.3 mM and the expression was carried out at 16°C for 16 h.

[0020] The present invention also provides the use of the depolymerase Dp14 in degrading bacterial polysaccharides.

[0021] Preferably, the present invention also provides the use of the above-mentioned depolymerase Dp14 in the preparation of a drug for preventing and / or treating infectious diseases in animals and / or humans caused by donkey-derived Escherichia coli.

[0022] Preferably, the present invention also provides a drug for preventing and / or treating infectious diseases in animals and / or humans caused by donkey-derived Escherichia coli, comprising the above-mentioned depolymerase Dp14, including a pharmaceutically acceptable carrier.

[0023] The beneficial effects of the present invention are:

[0024] (1) The method provided by the present invention expresses and purifies the phage depolymerase Dp14, and studies its inhibitory effect on Escherichia coli. In the detection of 15 strains of Escherichia coli from different sources, the results showed that the depolymerase Dp14 only had an antibacterial effect on donkey-derived Escherichia coli EH-1, with strong specificity; it was dependent on concentration and time, and the higher the concentration, the longer the action time, and the larger the halo; the biofilm test showed that the depolymerase Dp14 had the ability to inhibit the biofilm formed by Escherichia coli, and its antibacterial effect was more significant when used in combination with healthy donkey serum than when used alone.

[0025] (2) There is a significant synergistic effect between the depolymerase Dp14 provided by the present invention and donkey serum, which can enhance the bactericidal effect. This combined use method provides a new idea for the treatment of Escherichia coli resistant strains and is expected to become a new type of antibacterial drug with great application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 For the amplification of the depolymerase Dp14 gene;

[0027] Figure 2 Double enzyme digestion identification of recombinant plasmid;

[0028] Figure 3 The figure is the SDS-PAGE electrophoresis diagram of the purified depolymerase Dp14; wherein, M: Protein Marker 10-180KD; 1: supernatant after ultrasonic disruption; 2: flow-through after the supernatant passes through the nickel column; 3: PBS; 4: 10mmol / L imidazole; 5: 20mmol / L imidazole; 6: 50mmol / L imidazole; 7: 100mmol / L imidazole; 8: 200mmol / L imidazole; 9: 300mmol / L imidazole; 10: 500mmol / L imidazole;

[0029] Figure 4 The results of the antibacterial activity assay of the depolymerase Dp14;

[0030] Figure 5 The results of the temperature stability test of the depolymerase Dp14 are shown;

[0031] Figure 6 The results of the inhibition of biofilm by the depolymerase Dp14;

[0032] Figure 7 The depolymerase Dp14 cooperates with donkey serum to kill bacteria;

[0033] Figure 8 Staining for Escherichia coli EH-1 capsular polysaccharide (100×). DETAILED DESCRIPTION

[0034] In order to make the purpose, technical solution and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0035] Example 1

[0036] 1 Method

[0037] 1.1 Preparation of Escherichia coli phage proliferation fluid

[0038] Take the host bacteria frozen stock from -80°C and draw three lines on nutrient agar medium (NA), and culture at 37°C for 24h. Pick a single colony and inoculate it into 5mL of LB broth, culture it on a shaker at 37°C for 8h to obtain the host bacteria growth liquid. Take 10 μL of phage liquid and 100 μL of the proliferated bacterial liquid and add them to 5 mL of LB broth, culture it on a shaker at 37°C until the culture medium is clear and transparent, take it out and filter it with a 0.45μm filter to obtain the phage growth liquid.

[0039] 1.2 Amplification and recovery of target genes

[0040] 1.2.1 Primer design

[0041] After RAST and BLAST comparison analysis, the sequence of bacteriophage DE18 depolymerase Dp14 (1581 bp) was obtained (SEQ ID NO. 1). Primers were designed based on the sequence, and restriction sites BamH Ι and Xba Ι and 15-20 bp homology arms were inserted into the upstream and downstream of the primers respectively.

[0042] Upstream primer PL-F: ctcggtaccctcgag ggatcc ATGACCTTAGTTAAAAATATTGAAGTGACC (underlined is the restriction site B H )

[0043] Downstream primer PL-R:

[0044] agcagagattaccta tctaga CTAACGCAGTGCTTTACGGTTG (underlined is the restriction site XbaI )

[0045] 1.2.2 PCR amplification

[0046] The depolymerase fragment was amplified by PCR and a 25 μL PCR reaction system was established (see Table 1). Reaction conditions: 94°C for 3 min, 94°C for 10 s, 56.7°C for 30 s, 72°C for 1 min, and 30 cycles: 72°C for 5 min.

[0047] Table 1 PCR reaction system

[0048]

[0049] 1.2.3 PCR product recovery and purification

[0050] The PCR product was recovered and purified according to the FastPure Gel DNA Extraction MiniKit instructions. The specific steps are as follows:

[0051] (1) Quickly cut the gel containing the target fragment under UV light and place it in a 2 ml centrifuge tube. Add an equal volume of Buffer GDP and incubate in a 65°C water bath until the gel is completely melted. Transfer the liquid in the tube to the adsorption column and centrifuge at 12,000 rpm for 60 seconds.

[0052] (2) Discard the filtrate, add 700 mL of Buffer GW, and centrifuge at 12,000 r / min for 60 seconds. Repeat the wash step once and centrifuge for 2 minutes.

[0053] (3) Place the adsorption column in a new 1.5 ml centrifuge tube, add 20 ml Elution Buffer to the center of the adsorption column, place for 2 min, and centrifuge at 12,000 r / min for 1 min. The recovered product is in the centrifuge tube, and the DNA concentration is measured. The recovered PCR product is tested by gel electrophoresis and stored at -20°C.

[0054] 1.3 Recombinant plasmid construction

[0055] 1.3.1 Plasmid digestion

[0056] The pCold TF vector was digested with BamHΙ and XbaΙ to establish a 20µL digestion system (see Table 2). The digestion was carried out at 37℃ for 6h, and the digestion products were identified by 1% agarose gel electrophoresis. The products were recovered using a PCR product gel recovery kit.

[0057] Table 2 Enzyme digestion system

[0058]

[0059] 1.3.2 Construction of recombinant plasmid

[0060] The phage depolymerase Dp14 fragment was connected to the linearized pCold TF vector using the homologous recombination kit ClonExpress II One Step cloning Kit, and the reaction was carried out at 50℃ for 15min. After the reaction, the temperature was lowered to 4℃. The competent cells DH5α were thawed on ice, 5μL of the recombinant product was added to 100μL of the competent cells, and the mixture was flicked to mix. After a 30min ice bath, the cells were heat-shocked at 42℃ in a water bath for 60s, and then immediately placed on ice for 2 min. 400μL of resistance-free LB medium was added to the centrifuge tube, and the cells were cultured on a shaking table at 37℃ for 1h. The cells were centrifuged at 6000r / min for 5min, and 400μL of the supernatant was discarded. The precipitate was resuspended with the remaining medium, and it was spread on a NA plate containing Amp, and cultured at 37℃ overnight.

[0061] 1.3.3 Identification of recombinant plasmids

[0062] A single colony was randomly picked from the NA plate containing Amp, placed in Amp broth medium, and cultured at 37°C for 12 hours. The bacterial solution was used as a template for PCR identification. The plasmid was extracted from the bacterial solution with bands using the FastPurePlasmid Mini Kit. B H and Xgf Perform double enzyme digestion identification, the system method is the same as 1.3.1. Send the extracted plasmid to a sequencing company for sequencing, and compare the sequencing results with the original sequence.

[0063] 1.4 Expression and verification of recombinant plasmids

[0064] The correctly identified recombinant plasmid was transformed into competent cells BL21 (DE3). After cultivation, a single colony was randomly picked and placed in 5 mL of Amp broth, and cultured at 37°C overnight with shaking. Then, the bacterial solution was added to LB broth containing Amp at a ratio of 1:100 and cultured at 37°C until OD 600 After the pH value was 0.6-0.8, IPTG was added to a concentration of 0.3 mM and the expression was induced at 16°C for 16 h.

[0065] After induction, centrifuge at 10000r / min and 4℃ for 5 minutes to collect the bacteria, wash twice with sterile PBS buffer, and finally resuspend with sterile PBS buffer. Take 20μL of the resuspended bacterial solution and add 4×SDS loading buffer, heat and boil for 10min, centrifuge at 12000r / min for 2min, take the supernatant for SDS-PAGE electrophoresis to observe whether the protein is expressed, and use the pColdTF empty vector plasmid induced by expression as a control. The target band was sent to Shanghai Baipu Biotechnology Co., Ltd. for mass spectrometry sequencing identification.

[0066] 1.5 Large-scale protein expression and purification

[0067] 1.5.1 Large-scale protein expression

[0068] The correct protein was identified by sequencing and expressed in large quantities. The bacterial solution was added to 1L LB broth containing Amp at a ratio of 1:100 and cultured at 37°C until OD 600 After the concentration of 0.6-0.8, IPTG was added to a concentration of 0.3mM and induced expression at 16℃ for 16h. After induction, the cells were collected by centrifugation at 10000r / min and 4℃ for 5 minutes, washed twice with sterile PBS buffer, and finally all the centrifuge tube sediments were resuspended in 1 centrifuge tube with PBS, and the volume was fixed to 20ml. Ultrasonic disruption was performed on ice (ultrasonication for 6s, intermittent for 6s) until the bacterial solution was transparent, centrifuged at 12000r / min and 4℃ for 10min, and the supernatant was filtered with a 0.22μm filter.

[0069] Take 30 μL of supernatant and precipitate resuspension, add 6 μL of 5× SDS loading buffer, mix well and boil for 10 min, and verify whether the protein is expressed by SDS-PAGE electrophoresis.

[0070] 1.5.2 Protein purification

[0071] Protein purification using His tag protein purification kit:

[0072] (1) Load the filler into the column, let it stand for 10 minutes to separate the layers, and open the liquid outlet to allow ethanol to flow out.

[0073] (2) Add 4 column volumes of PBS to the column to wash the ethanol three times, and then equilibrate the column three times with 4 column volumes of Binding Buffer.

[0074] (3) Mix the protein supernatant with the filler and let it stand at 4°C for 1 hour to allow them to combine. Repeat the column loading process 5 times and collect the flow-through.

[0075] (4) Wash five times with 4 column volumes of PBS and control the flow rate to 1 mL / min.

[0076] (5) Wash three times with 4 column volumes of Binding Buffer.

[0077] (6) Wash five times with 4 column volumes of Elution Buffer (20 mM / mL imidazole).

[0078] (7) Repeat the column loading three times with an equal volume of Elution Buffer (50 mM / mL imidazole).

[0079] (8) Repeat the column loading three times with an equal volume of Elution Buffer (100 mM / mL imidazole).

[0080] (9) Repeat the column loading three times with an equal volume of Elution Buffer (200 mM / mL imidazole).

[0081] (10) Repeat the column loading three times with an equal volume of Elution Buffer (300 mM / mL imidazole).

[0082] (11) Repeat the column loading three times with an equal volume of Elution Buffer (500 mM / mL imidazole).

[0083] (12) Wash five times with 4 column volumes of PBS.

[0084] (13) Store in 3 column volumes of 30% ethanol.

[0085] 1.5.3 Protein dialysis and ultrafiltration concentration

[0086] Cut the dialysis bag into small pieces of appropriate length, boil the dialysis bag with 1L 2% (W / V) sodium bicarbonate and 1mmol / L EDTA (pH 8.0) for 10 minutes, wash the dialysis bag thoroughly with distilled water, and finally boil the dialysis bag with 1mmol / L EDTA (pH 8.0) for 10 minutes for standby use. Add the purified protein eluate to the treated dialysis bag, seal it, and soak it in pre-cooled PBS buffer at 40℃ for 72 hours, changing PBS every 6 hours.

[0087] Take 3 mL of dialyzed protein and add it to a 30K Amicon Ultra-15 ultrafiltration tube. Centrifuge at 5000 r / min until about 1 mL of liquid remains in the tube.

[0088] 1.6 Study on the biological characteristics of depolymerase Dp14

[0089] 1.6.1 Determination of the host spectrum of the depolymerase Dp14

[0090] The dot spot test was used to determine the lysis of 15 donkey E. coli strains by the depolymerase Dp14. 100 μL of the E. coli suspension was mixed with the LB semi-solid medium and spread on the prepared NA plate. After solidification, 2 μL of the depolymerase Dp14 with a concentration of 1 mg / mL was dripped into the middle of the medium. After drying, inverted culture was carried out at 37°C for 12 hours.

[0091] 1.6.2 Determination of concentration stability of depolymerase Dp14

[0092] Mix 100 μL of E. coli suspension with LB semi-solid medium and spread on the prepared NA plate. Dilute the depolymerase Dp14 to 1000, 100, 10, and 1 μg / mL in sequence, take 2 μL of each gradient and drop it into the middle of the medium, set up 2 parallel groups for each group, and use the Pcold empty vector as the negative control, and invert and culture at 37°C for 12 hours.

[0093] 1.6.3 Determination of the temporal stability of the depolymerase Dp14

[0094] Mix 100 μL of E. coli suspension with LB semi-solid medium and spread it on the prepared NA plate. After solidification, take 2 μL of 1 mg / mL depolymerase Dp14 and drop it into the middle of the medium to observe the halo changes at 12h, 24h, 36h, and 48h.

[0095] 1.6.4 Determination of the temperature stability of the depolymerase Dp14

[0096] Mix 100 μL of E. coli suspension with LB semi-solid medium and spread it on the prepared NA plate. Place the depolymerase Dp14 at 20℃-60℃ for 1 hour, take 2 μL of the depolymerase Dp14 placed at different temperatures and drop it into the middle of the medium, invert and culture at 37℃ for 12 hours, and observe the changes in the halo.

[0097] 1.6.5 Determination of the inhibitory effect of depolymerase Dp14 on biofilm

[0098] 100 μL of E. coli and 100 μL of depolymerase Dp14 with a final concentration of 1000, 100, and 10 μg / mL were added to a 96-well plate. 100 μL of E. coli and 100 μL of saline were set as the control group. The plates were cultured at 37 °C for 24 h, and the crystal violet staining method was used to determine whether the formation of biofilm was inhibited.

[0099] 1.6.6 Effect of depolymerase Dp14 on Escherichia coli in the presence of serum

[0100] Mix logarithmic phase E. coli, disaggregase Dp14, healthy donkey serum (or sheep serum, mouse serum) and PBS according to the combination shown in Table 3. Incubate at 37℃ for 12h, and measure OD at 0h, 6h and 12h. 600 .

[0101] Table 3 Antibacterial test of different groups of depolymerase Dp14 combined with serum

[0102]

[0103] 1.6.7 Degradation of E. coli capsule by depolymerase Dp14

[0104] The capsule of Escherichia coli not treated with depolymerase Dp14 and Escherichia coli treated with depolymerase Dp14 for 1 hour were stained by Hiss capsule staining method, and the degradation of Escherichia coli capsule by depolymerase Dp14 was observed under a 100× microscope.

[0105] 2 Results

[0106] 2.1 PCR amplification of target gene

[0107] Using phage DNA as template, primers were designed for PCR amplification, and PCR products were identified by 1% agarose gel electrophoresis. A band with the expected size of depolymerase Dp14 was obtained. The results are shown in Figure 1 shown.

[0108] 2.2 Identification results of recombinant plasmid

[0109] The recombinant plasmid transferred into DH5α was identified by double restriction digestion. The plasmid sequencing results were compared with the depolymerase protein gene of bacteriophage SEH-1, and the results showed that the inserted target fragment was exactly the same. Figure 2 shown.

[0110] 2.3 Purification and identification of depolymerase Dp14

[0111] pass Figure 3 It can be seen that the target protein can be completely eluted by Elution Buffer containing 300 mMol / L imidazole. SDS-PAGE analysis showed that the molecular weight of the depolymerase Dp14 protein was 108KDa, which was similar to the predicted size.

[0112] 2.4 Results of host spectrum determination of depolymerase Dp14

[0113] It can be seen from Table 4 that among the 15 strains of Escherichia coli, only 1 strain could be hydrolyzed by the depolymerase Dp14, indicating that the depolymerase Dp14 has a strong specificity.

[0114] Table 4 Results of host spectrum determination of depolymerase Dp14

[0115]

[0116] 2.5 Results of concentration stability test of depolymerase Dp14

[0117] When the depolymerase Dp14 was diluted to 1 μg / mL, the halo disappeared. The higher the concentration of Dp14, the larger the halo, indicating that the activity of depolymerase Dp14 against host bacterial biofilm is concentration-dependent.

[0118] 2.6 Determination of antibacterial activity of depolymerase Dp14

[0119] pass Figure 4 It can be seen that when the same concentration of depolymerase Dp14 acts on the host bacteria, the halo will increase with the extension of culture time, indicating that the activity of Dp14 against host bacteria biofilm is time-dependent.

[0120] 2.7 Results of temperature stability test of depolymerase Dp14

[0121] pass Figure 5 It can be seen that after incubation at 20-40℃ for 1 hour, the diameter of the halo when the depolymerase Dp14 acted on Escherichia coli was 15 cm. After incubation at 50℃ or above for 1 hour, the halo disappeared.

[0122] 2.8 Results of the test on the inhibition of biofilm by depolymerase Dp14

[0123] pass Figure 6 It can be seen that 10μg / mL and 100μg / mL of depolymerase Dp14 had no obvious inhibitory effect on the biofilm of Escherichia coli, while the inhibitory effect of 1000μg / mL of depolymerase Dp14 on the biofilm of Escherichia coli was significantly different from that of the control.

[0124] 2.9 Effect of depolymerase Dp14 on Escherichia coli in the presence of serum

[0125] The killing effect of depolymerase Dp14 and donkey serum on E. coli EH-1 is shown in Figure 7. Donkey serum and depolymerase Dp14 have certain effects on EH-1 itself. After the joint action of donkey serum and depolymerase Dp14, the effect of EH-1 is more obvious, with a sustained killing effect from 0 to 12 hours. However, the antibacterial effect of sheep serum and mouse serum on depolymerase Dp14 is not obvious.

[0126] 2.10 Degradation of E. coli capsule by depolymerase Dp14

[0127] Through Hiss capsule staining, it can be seen that in the control group without the action of depolymerase Dp14, there is an unstained white capsule around the Escherichia coli, and the bacteria are mostly aggregated ( Figure 8 A); however, the capsule around the E. coli in the group treated with depolymerase Dp14 disappeared, and most of the bacteria were distributed singly ( Figure 8 B) Demonstrates that the depolymerase Dp14 can hydrolyze the capsular polysaccharide of Escherichia coli EH-1.

[0128] 3 Conclusion

[0129] In this experiment, the bacteriophage depolymerase Dp14 was successfully expressed and purified, and its inhibitory effect on Escherichia coli was studied. In the detection of 15 strains of Escherichia coli from different sources, the results showed that the depolymerase Dp14 only had an antibacterial effect on donkey-derived Escherichia coli EH-1, with strong specificity; it was dependent on concentration and time, the higher the concentration, the longer the action time, and the larger the halo; the depolymerase Dp14 had poor tolerance to high temperatures, and the temperature of 50°C and above would lose its antibacterial effect; the biofilm test showed that the depolymerase Dp14 had the ability to inhibit the biofilm formed by Escherichia coli, and its antibacterial effect was more significant when used in combination with healthy donkey serum than when used alone.

[0130] The depolymerase provided by the present invention has a synergistic effect with the serum, and can enhance the bactericidal effect. This combined use method provides a new idea for the treatment of Escherichia coli resistant strain infection.

Claims

1. A depolymerase Dp14 from donkey-derived Escherichia coli phage, characterized in that: The gene sequence of the depolymerase Dp14 is shown in SEQ ID NO.

1.

2. A method for preparing the depolymerase Dp14 according to claim 1, characterized in that: The following steps are involved: The gene fragment of the depolymerase Dp14 is obtained by PCR cloning, and the gene fragment of Dp14 is connected to a plasmid vector to obtain a recombinant plasmid; Transforming the recombinant plasmid into competent cells, and screening to obtain recombinant host cells containing the recombinant plasmid; Cultivating the recombinant host cell to obtain a culture fluid; After the culture fluid is separated, the liquid is collected to obtain the depolymerase Dp14.

3. The preparation method according to claim 2, characterized in that: In the process of obtaining the gene fragment of depolymerase Dp14, the primers used for amplification are: Upstream primer PL-F, as shown in SEQ ID NO.2: ctcggtaccctcgag ggatcc ATGACCTTAGTTAAAAATATTGAAGTGACC; Downstream primer PL-R, as shown in SEQ ID NO.3: agcagagattaccta tctaga CTAAGCAGTGCTTTACGGTTG.

4. The preparation method according to claim 2 or 3, characterized in that: The plasmid vector is pCold TF vector; the competent cell is BL21 (DE3).

5. The preparation method according to claim 2, characterized in that: The culture is as follows: a single colony of the recombinant host cell is picked and placed in 5 mL of Amp broth, and cultured at 37°C overnight with shaking; then the bacterial solution is added to LB broth containing Amp at a ratio of 1:100, and cultured at 37°C until OD 600 After the pH value was 0.6-0.8, IPTG was added to a concentration of 0.3 mM and the expression was carried out at 16°C for 16 h.

6. Use of the depolymerase Dp14 as claimed in claim 1 in degrading bacterial polysaccharides, characterized in that: The bacterial polysaccharide is donkey-derived Escherichia coli EH-1 capsule polysaccharide.

Images