A primer and method for detecting HPA genotyping
By designing specific primers and a third-generation sequencing platform, high-throughput, automated genotyping detection of the HPA gene was achieved, solving the problems of low throughput and ambiguous results in existing technologies, and improving the utilization and safety of blood resources.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- XIAN HAORUI GENE TECH LTD
- Filing Date
- 2024-08-16
- Publication Date
- 2026-05-19
AI Technical Summary
Existing HPA genotyping technology suffers from low throughput, complex operation, ambiguous results, and inaccurate genotyping, leading to platelet transfusion mismatch and affecting the utilization and safety of blood resources.
Specific primers were designed for full-length amplification and sequencing of the HPA gene. Combined with a third-generation sequencing platform, high-throughput and automated HPA genotyping detection was achieved through single-tube multiplex PCR amplification and library construction.
It enables accurate typing of HPA 1-35 sites, improves the utilization value and safety of blood resources, reduces manual operation, and improves detection efficiency and accuracy.
Smart Images

Figure CN119040444B_ABST
Abstract
Description
Technical Field
[0001] This application relates to the field of genotyping detection technology, and in particular to primers and methods for HPA genotyping detection. Background Technology
[0002] Effective platelet transfusion can increase a patient's platelet count, improve hemostasis, and reduce the risk of bleeding. Platelet transfusion is an important means of preventing and treating bleeding disorders caused by thrombocytopenia or thrombocytopenic purpura (PTR) due to various reasons. According to data from the 2018 National Blood Safety Report, a total of 1.78 million units of apheresis platelets were supplied throughout the year. With a PTR rate of 30%, approximately 534,000 units of apheresis platelets are wasted annually nationwide, further exacerbating the already strained platelet resource supply. For patients, PTR not only results in financial loss but also poses a serious risk of delayed treatment and even life-threatening complications.
[0003] PTR (Prophylactic Transmission Reduction) is typically caused by non-immune factors and immune factors, and can be caused by a single factor or a combination of both. Transfusion of matched, compatible platelets is an effective method for resolving PTR caused by immune factors. Most immune-related PTRs can be safely and effectively addressed by selecting compatible platelets through platelet matching, reducing the immune stimulation of the antigen, and avoiding the presence of HPA antibodies in the patient's body.
[0004] Allogeneic antigens (HPAs) are expressed on the platelet membrane. To date, 35 platelet-specific antigen systems (HPA1–35) have been formally named, encoding genes including ITGA2, GP1BA, GP1BB, ITGA2B, ITGB3, CD109, and GP9. The distribution of HPA antigen systems in the Chinese population exhibits genetic polymorphism, with differences in HPA genotypes among individuals. Therefore, rapid and accurate identification of an individual's HPA genotype and selection of platelet donors with matching HPA genotypes can effectively avoid platelet transfusion ineffectiveness due to immune factors, contributing to improved blood safety.
[0005] Traditional serological testing methods are limited by the lack of high-quality, high-specificity antisera, hindering in-depth HPA genotyping. With in-depth research on the HPA gene, gene testing technology has been reported for HPA genotyping studies in recent years, both domestically and internationally. Currently, at least six HPA genotyping methods have been reported; however, domestic HPA genotyping is limited by methodological constraints, opting to omit lower-frequency loci and only performing low-resolution genotyping and database entry for HPA loci 1-6, 15, and 21, failing to achieve complete matching of donor and recipient HPA information. Currently, the main HPA gene testing methods in China include:
[0006] (1) PCR sequence-specific primer technology (PCR-SSP).
[0007] (2) PCR-restriction fragment length polymorphism analysis (PCR-RFLP).
[0008] (3) PCR-specific oligonucleotide probe hybridization analysis (PCR-SSOP).
[0009] (4)TaqMan method.
[0010] (5) Nucleic acid sequencing technology (Sequencing-Based Typing; SBT).
[0011] (6) NGS (Next-generation sequencing).
[0012] PCR sequence-specific primers (PCR-SSP) is a simple, rapid, and low-error-rate method, but it only targets high-frequency mutation sites, requiring significant manpower and resources for high-throughput processing. PCR-restriction fragment length polymorphism (PCR-RFLP) adds an endonuclease hydrolysis step compared to PCR-SSP; incomplete digestion can lead to erroneous results. Furthermore, not every HPA allele has a suitable restriction enzyme site. PCR-specific oligonucleotide probe hybridization (PCR-SSOP) is highly dependent on probe sequence and experimental conditions, requiring strict control of hybridization temperature and time, and is prone to false negatives or false positives. TaqMan analysis offers high sensitivity and automated result recording, but requires a specialized real-time PCR instrument and certain fluorescently labeled primers, resulting in higher costs. Nucleic acid sequencing technology (Sequencing-Based Typing; SBT) offers high accuracy and can directly determine the base sequence of DNA or genes. However, the sequencing process is relatively complex and costly, and for large batches of samples, the workload is significant and the processing time is long. Next-generation sequencing (NGS) offers advantages such as high throughput, high sensitivity, and multi-target detection in HPA testing. However, it also suffers from drawbacks such as complex operation (multi-tube amplification), high cost, and difficulty in interpreting results. Furthermore, current marketed testing products primarily target high-mutation-frequency sites.
[0013] This study used a third-generation sequencing platform to perform high-resolution typing of all antigens in the HPA 1-35 system. The detection of 35 sites was performed in a single reaction tube, outputting information for all 35 sites and flanking sequences in one go. Furthermore, due to the long sequencing length, the flanking sequence information could be used to determine whether the test results were truly homozygous or truly heterozygous. The detection method provided in this study is convenient, rapid, and can be automated with high throughput, saving significant manpower and resources. It can also accurately analyze donor-recipient HPA information and can further investigate previously unnoticed pathogenic mechanisms or neoantigens from unknown point mutations or structural variations. Summary of the Invention
[0014] This invention provides primers and a method for HPA genotyping detection that overcomes the shortcomings of existing genotyping technologies, such as low throughput, complicated operation, unclear and difficult-to-distinguish results, and inability to provide accurate genotyping.
[0015] This application is achieved through the following technical solution: a detection primer for HPA genotyping, comprising: specific amplification primer sequences for amplifying fragments of the HPA gene as follows:
[0016] The upstream primer of the CD109-F primer pair is: / 5Phos / GCTGCAATGAACGGTGGCATACAAG;
[0017] The downstream primer for the CD109-R primer pair is: / 5Phos / GCTGCAATGAACGGTGGCATACAAG;
[0018] The upstream primer of the GP9-F primer pair is: / 5Phos / CCTGATGGAATGACCCAGTGAAGGAG;
[0019] The downstream primer of the GP9-R primer pair is: / 5Phos / ACAGCTCCCTCCTTACAGTCTTCC;
[0020] The upstream primer of the ITGA2-2F primer pair is: / 5Phos / CTGTGCTCTCTGTCTTCATGTTCCAAGC;
[0021] The downstream primer of the ITGA2-2R primer pair is: / 5Phos / GGGACTCAAATGTCTCAGAGCAAGTG;
[0022] The upstream primer of the ITGA2-3F primer pair is: / 5Phos / TGACCAACCTCATTCAGACCCAAACC;
[0023] The downstream primer for the ITGA2-3R primer pair is: / 5Phos / GCTGGGCATGGAAATCCCACTGTATC;
[0024] The upstream primer of the ITGA2B-F primer pair is: / 5Phos / GTACAGGGCACAGGGAACAATCGG;
[0025] The downstream primer of the ITGA2B-R primer pair is: / 5Phos / ACGGGCTTGCTCACATAGTCCCAGA;
[0026] The upstream primer for the ITGB3-1F pair is: / 5Phos / GCAAGGCAATGAACCTTAACCTGTGG;
[0027] The downstream primer for the ITGB3-1R pair is: / 5Phos / CAAGCACCTCAGGCAATTCTCAACAC;
[0028] The upstream primer of the ITGB3-2F primer pair is: / 5Phos / GGTGGCGTGGTCCCCTTCAA;
[0029] The upstream primer of the ITGB3-2R primer pair is: / 5Phos / CCTGGAGTGGCCTTCTTGTTGG;
[0030] The upstream primer of the ITGB3-3F primer pair is: / 5Phos / GTGTGGGAACTGAAGTAGATCCTGAGC;
[0031] The downstream primer for the ITGB3-3R primer pair is: / 5Phos / CTAACCTCACCCCAGCCCTACTTCTG;
[0032] The upstream primer of the GP1BB-F primer pair is: / 5Phos / GGATGAGGACTTCAAGCAGCAGGAC;
[0033] The downstream primer of the GP1BB-R primer pair is: / 5Phos / CAGGTGGGGTGGGTCTGAGAGATTG;
[0034] The upstream primer of the GP1BA-F primer pair is: / 5Phos / CAAGAAGGGGAATCTATGAAGGAGACTGA;
[0035] The downstream primer for the GP1BA-R primer pair is: / 5Phos / CCAGGTAGGTCCCAGCAGTTGTCAT.
[0036] A method for HPA genotyping detection includes:
[0037] PCR amplification of the HPA gene;
[0038] The target PCR products were used to construct a third-generation sequencing library;
[0039] The established library was purified using magnetic beads;
[0040] The purified library is then mixed with other libraries.
[0041] Take the mixed library and sequence it.
[0042] Preferred methods for amplifying the HPA gene using PCR include:
[0043] Design specific primers for amplifying the HPA gene. The primer sequences are as follows:
[0044] The upstream primer of the CD109-F primer pair is: / 5Phos / GCTGCAATGAACGGTGGCATACAAG;
[0045] The downstream primer for the CD109-R primer pair is: / 5Phos / GCTGCAATGAACGGTGGCATACAAG;
[0046] The upstream primer of the GP9-F primer pair is: / 5Phos / CCTGATGGAATGACCCAGTGAAGGAG;
[0047] The downstream primer of the GP9-R primer pair is: / 5Phos / ACAGCTCCCTCCTTACAGTCTTCC;
[0048] The upstream primer of the ITGA2-2F primer pair is: / 5Phos / CTGTGCTCTCTGTCTTCATGTTCCAAGC;
[0049] The downstream primer of the ITGA2-2R primer pair is: / 5Phos / GGGACTCAAATGTCTCAGAGCAAGTG;
[0050] The upstream primer of the ITGA2-3F primer pair is: / 5Phos / TGACCAACCTCATTCAGACCCAAACC;
[0051] The downstream primer for the ITGA2-3R primer pair is: / 5Phos / GCTGGGCATGGAAATCCCACTGTATC;
[0052] The upstream primer of the ITGA2B-F primer pair is: / 5Phos / GTACAGGGCACAGGGAACAATCGG;
[0053] The downstream primer of the ITGA2B-R primer pair is: / 5Phos / ACGGGCTTGCTCACATAGTCCCAGA;
[0054] The upstream primer for the ITGB3-1F pair is: / 5Phos / GCAAGGCAATGAACCTTAACCTGTGG;
[0055] The downstream primer for the ITGB3-1R pair is: / 5Phos / CAAGCACCTCAGGCAATTCTCAACAC;
[0056] The upstream primer of the ITGB3-2F primer pair is: / 5Phos / GGTGGCGTGGTCCCCTTCAA;
[0057] The upstream primer of the ITGB3-2R primer pair is: / 5Phos / CCTGGAGTGGCCTTCTTGTTGG;
[0058] The upstream primer of the ITGB3-3F primer pair is: / 5Phos / GTGTGGGAACTGAAGTAGATCCTGAGC;
[0059] The downstream primer for the ITGB3-3R primer pair is: / 5Phos / CTAACCTCACCCCAGCCCTACTTCTG;
[0060] The upstream primer of the GP1BB-F primer pair is: / 5Phos / GGATGAGGACTTCAAGCAGCAGGAC;
[0061] The downstream primer of the GP1BB-R primer pair is: / 5Phos / CAGGTGGGGTGGGTCTGAGAGATTG;
[0062] The upstream primer of the GP1BA-F primer pair is: / 5Phos / CAAGAAGGGGAATCTATGAAGGAGACTGA;
[0063] The downstream primer for the GP1BA-R primer pair is: / 5Phos / CCAGGTAGGTCCCAGCAGTTGTCAT;
[0064] Primers were synthesized, and phosphorylation modification with 5′ bases was performed during synthesis;
[0065] The synthesized primers were mixed to obtain a primer mixture;
[0066] PCR amplification was performed by adding PCR amplification system reagents to the primer mixture.
[0067] Preferred methods for constructing a library include:
[0068] Barcode adapter dilution: Dilute the dry Barcode adapter powder to a concentration of 100 μM using TE buffer.
[0069] Barcode annealing converts a single-chain barcode adapter into a double-chain one.
[0070] The connector connection reacts to create a unique barcode adapter for each sample;
[0071] Exonuclease digestion removes products from failed adapter ligation, yielding a high-quality library.
[0072] Preferably, the methods for purifying the established library include:
[0073] The exonuclease digestion product was purified using 0.45* magnetic beads to remove reagents from the library construction process and small sequence fragments, resulting in a high-quality library.
[0074] Qubit was used to quantify a single-sample library.
[0075] The beneficial effects of this application are:
[0076] By designing primers specific to the HPA gene, full-length exons are amplified and sequenced, enabling precise genotyping of samples. The reagents and methods provided in this invention serve as an independent and widely applicable identification method, leveraging the high-throughput sequencing platform of PacBio (a third-generation sequencing platform) for accurate results. This allows for rapid and accurate HPA genotyping of sites 1-35, playing a significant practical role in clinical transfusion research and genetics. Clearly defining the HPA genotype in the transfusion population helps prevent adverse transfusion reactions caused by HPA genotype mismatch, thereby improving blood safety and utilization value. Attached Figure Description
[0077] To more clearly illustrate the technical solutions in the embodiments of this application or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of this application. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0078] Figure 1 This is a diagram of the product of PCR amplification of the HPA gene in the embodiments of this application;
[0079] Figure 2 This is a graph showing the detection of library fragment size in an embodiment of this application;
[0080] Figure 3 This is a diagram illustrating the detection site of the amplified GP1BA gene in an embodiment of this application;
[0081] Figure 4 This is a diagram illustrating the detection sites of the amplified GP9 gene in the embodiments of this application;
[0082] Figure 5 This is a diagram illustrating the detection site of the amplified GP1BB gene in an embodiment of this application;
[0083] Figure 6 This is a diagram illustrating the detection sites of the amplified ITGB3 gene in the embodiments of this application;
[0084] Figure 7 This is a diagram illustrating the detection site of the amplified ITGA2B gene in an embodiment of this application.
[0085] Figure 8 This is a diagram illustrating the detection sites of the amplified ITGA2 gene in an embodiment of this application;
[0086] Figure 9 This is a diagram illustrating the detection sites of the amplified CD109 gene in an embodiment of this application. Detailed Implementation
[0087] Exemplary embodiments will now be described more fully with reference to the accompanying drawings. However, these exemplary embodiments can be implemented in many forms and should not be construed as limited to the examples set forth herein; rather, these embodiments are provided to make this application more comprehensive and complete, and to fully convey the concept of the exemplary embodiments to those skilled in the art.
[0088] This embodiment designs specific primers for sites 1-35 of HPA, containing a total of 10 amplification fragments, enabling multiplex PCR amplification in a single tube. The obtained PCR products are directly used to construct a third-generation library, with each sample ligated with a unique specific barcode to distinguish different samples, achieving high-throughput detection. The obtained library is sequenced using a PacBio Sequel II high-throughput gene sequencer. Finally, the instrument converts the optical signal into a base sequence, and bioinformatics data analysis is used to identify the HPA genotype. The detected genes and corresponding genotypes are shown in the table below.
[0089] The following is a detailed table of the genes and gene fragments to be amplified.
[0090]
[0091] After obtaining the gene fragment, the obtained gene fragment is amplified. The specific amplification method is as follows:
[0092] Primer sequences: Specific primers targeting HPA1-35 sites were designed. Primer synthesis utilized 5' phosphorylation. The primer sequences are as follows:
[0093] primer sequence CD109-F / 5Phos / GCTGCAATGAACGGTGGCATACAAG CD109-R / 5Phos / GCCAGAGTATCACCAACACCTAGGAGC GP9-F / 5Phos / CCTGATGGAATGACCCAGTGAAGGAG GP9-R / 5Phos / ACAGCTCCCTCCTTACAGTCTTCC ITGA2-2F / 5Phos / CTGTGCTCTCTGTCTTCATGTTCCAAGC ITGA2-2R / 5Phos / GGGACTCAAATGTCTCAGAGCAAGTG ITGA2-3F / 5Phos / TGACCAACCTCATTCAGACCCAAACC ITGA2-3R / 5Phos / GCTGGGCATGGAAATCCACTGTATC ITGA2B-F / 5Phos / GTACAGGGCACAGGGAACAATCGG ITGA2B-R / 5Phos / ACGGGCTTGCTCACATAGTCCCAGA ITGB3-1F / 5Phos / GCAAGGCAATGAACCTTAACCTGTGG ITGB3-1R / 5Phos / CAAGCACCTCAGGCAATTCTCAACAC ITGB3-2F / 5Phos / GGTGGCGTGGTCCCCTTCAA ITGB3-2R / 5Phos / CCTGGAGTGGCCTTCTTGTTGG ITGB3-3F / 5Phos / GTGTGGGAACTGAAGTAGATCCTGAGC ITGB3-3R / 5Phos / CTAACCTCACCCCAGCCCTACTTCTG GP1BB-F / 5Phos / GGATGAGGACTTCAAGCAGCAGGAC GP1BB-R / 5 Pho s / CAGGTGGGGTGGGTCTGAGAGATTG GP1BA-F / 5Phos / CAAGAAGGGGAATCTATGAAGGAGACTGA GP1BA-R / 5Phos / CCAGGTAGGTCCCAGCAGTTGTCAT
[0094] Note: The 5′ base is phosphorylated during the synthesis of the / 5Phos / indicator.
[0095] Primer mixing system
[0096] Before use, the synthesized primer powder is centrifuged at high speed and diluted to the working solution concentration using EB buffer. The diluted primers are then used to prepare primer MIX according to the system in the table below.
[0097]
[0098]
[0099] After preparing the primer mix, add the reagents listed in the PCR amplification system table below to the reaction tubes in sequence, cap the tubes, mix well, and centrifuge.
[0100] Reagent Name Volume added to a single sample (uL) 2×PCR Buffer for KOD FX Neo 12.5 dNTPs (2mM) 5 Primer Mix 0.97 KOD Neo FX 0.5 DNase / RNase-Free Deionized Water 6.03-X gDNA X(50ng) Total 25
[0101] Set the PCR instrument program according to the parameters in the table below for amplification: hot cap: 105℃, heating / cooling rate: 6.0℃ / s.
[0102]
[0103]
[0104] PCR product analysis: The PCR products were analyzed using 1% agarose gel electrophoresis to determine whether the target gene was amplified. Voltage: 150V Time: 50min Figure 1 The results shown are from an example amplification. (5 μL of amplification product + 5 μL of 6× loading buffer were used for gel electrophoresis).
[0105] Third-generation sequencing libraries were constructed using the obtained target PCR products;
[0106] 1. Barcode Preparation
[0107] 1) Barcode adapter dilution
[0108] Centrifuge the new barcode adapter dry powder tubes at 10,000 rpm for 5 minutes. Add a certain volume of TE buffer to dilute the dry barcode powder to a concentration of 100 μM, vortex to mix, and then briefly centrifuge. A total of 96 barcode adapters were obtained, and the sequence types are shown in the table below as examples:
[0109]
[0110] Note:
[0111] a. The barcode adapter sequence information is provided by PacBio; / 5Phos / indicates that the 5′ base is phosphorylated during barcode synthesis.
[0112] b. The red-marked items above are barcode sequences.
[0113] 2) Barcode annealing
[0114] Prepare 10× annealing buffer according to the table below, and dilute the 100uM barcode adapter solution 5 times with 10× annealing buffer and RNAase-free water. Vortex to mix and then centrifuge briefly. Then place the mixture on a PCR instrument and anneal the single-stranded barcode adapter to double strands according to the following annealing program. After the annealing program is completed, immediately place the product on ice for 5 minutes, and then store it at -20℃.
[0115] a. The table below shows the composition of the 10× annealing buffer.
[0116] Tris-HCl, pH 7.5 100mM NaCl 1M RNAase-Free Water Supplementary system
[0117] b. The following table shows the annealing system.
[0118]
[0119] c. Annealing procedure
[0120] The table below shows the annealing temperature decreasing in increments of 5℃.
[0121] 80℃ 2min 80℃ Decrease of 0.1℃ / s 2min 75℃ Decrease of 0.1℃ / s 2min 70℃ Decrease of 0.1℃ / s 2min 65℃ Decrease of 0.1℃ / s 2min ... Decrease of 0.1℃ / s 2min 30℃ Decrease of 0.1℃ / s 2min 25℃ Decrease of 0.1℃ / s 2min 4℃ 2min
[0122] 2. Connector connection reaction
[0123] 1) Configure the connectors on the ice to connect the reaction MIX according to the table below:
[0124]
[0125] 2) The following table shows the connection system: Add the listed materials in order, close the tube cap, mix well and centrifuge.
[0126] Amplification products 8.95 vL (200~300 ng) Barcode connector 2.5μL Ligase Mix 3.55μL Total 1 5μL
[0127] 3) The table below shows the connection reaction procedure. After setting the parameters in advance, proceed with the connection reaction. Hot cap: 75℃, heating / cooling rate: 6℃ / s
[0128] temperature time Cycle number 37℃ 25min 1× 25℃ 20min 1× 65℃ 10min 1× 4℃ ∞
[0129] 3. Exonuclease digestion reaction
[0130] 1) Exonuclease system: Incorrect ligation may occur during the ligation process, so the incorrect ligation products are digested with exonuclease. Prepare the exonuclease MIX on ice according to the table below. After the ligation reaction is complete, place the tube on ice, add 2 μL of exonuclease MIX to each tube, cap the tube, mix well, and centrifuge.
[0131] Reagent Name Volume added to a single sample (uL) Exonuclease 1 1.5μL Exonuclease III 0.5μL Total 2μL
[0132] 2) External digestion procedure: The table below shows the digestion reaction parameters. These should be set in advance for the digestion reaction. Heating cap: 45℃, heating / cooling rate: 6℃ / s.
[0133] temperature time Cycle number 37℃ 60min 1× 4℃ ∞
[0134] Magnetic bead purification should be performed as soon as possible after the digestion reaction is complete.
[0135] Library purification
[0136] 1. Take VAHTS™ DNAClean Beads (hereinafter referred to as magnetic beads) out of the refrigerator half an hour in advance and place them on a vertical mixer to mix slowly at room temperature for 30 minutes;
[0137] 2. Add 1 volume of DNase / RNase-Free Deionized Water to the digested product, then add 15.3 μL of magnetic beads (0.45x), gently tap or shake at low speed to mix, and let stand at room temperature for 10 min, gently tapping to mix 2-3 times during the process.
[0138] 3. Briefly separate the PCR tube and place it on a magnetic rack to adsorb magnetic beads for 10 minutes. During this time, prepare 70% alcohol. The alcohol should be prepared fresh for each use.
[0139] 4. Discard the supernatant, then add 200 μL of 70% alcohol along the opposite side of the tube wall where the magnetic beads are adsorbed. Do not dislodge the magnetic beads.
[0140] 5. Repeat the previous step to perform a second alcohol cleaning;
[0141] 6. Discard the alcohol, centrifuge the PCR tube, then put it back into the magnetic rack and discard the residual liquid;
[0142] 7. After opening the PCR tube, allow it to dry for no more than 30 seconds, then add 12 μL of EB Buffer;
[0143] 8. Gently tap the magnetic beads to mix them, keeping the system in a mixed state. Let it stand at room temperature for 10 minutes, tapping it 2-3 times during this period.
[0144] 9. Briefly separate the PCR tube and place it on a magnetic rack to adsorb magnetic beads for 10 minutes;
[0145] 10. Transfer 10 μL of the supernatant to a new PCR tube;
[0146] 11. Use Qubit to quantify single-sample libraries, and pool 6 ng of the same quality from each single-sample library to form a mixed library.
[0147] Mixed inventory
[0148] 1. Measure an accurate volume of x μL (>400 ng) of the mixed library using a pipette, add x*0.6 μL of magnetic beads (0.6x) to it, and purify it using the same method as the library purification process. Finally, elute the library with 50 μL of EB.
[0149] 2. Take x μL (>200 ng) of the library obtained in the previous process, add x*0.45 μL of magnetic beads (0.45x) to it, and purify it in the same way as the library purification process. Finally, elute the library with 20 μL of EB.
[0150] 3. Quantify the final library using Qubit, requiring three replicates. Take the average value as the final library concentration, which should be higher than 3 ng / μL.
[0151] 4. The 5200 Fragment Analyzer System was used to detect the size of the library fragments. The results are as follows: Figure 2 As shown.
[0152] On-machine sequencing
[0153] The recommended read volume is 150pM, using HiFi reads mode, with an average fragment size of 5000bp. You will need to input information such as the average fragment size and library concentration. The following are the instrument settings for the experimental setup.
[0154] In this embodiment, the following amplified gene fragments were detected using the method described above:
[0155] Because there are many loci and the detection methods are consistent, all producing high-quality long fragment sequences, haplotype 1 and haplotype 2 sequences from the CD109 gene fragment sequence listing are shown here as examples, and the target loci in the above sequence listings are marked with underlines; the specific sequences are as follows:
[0156] >sample-23WB03295_CD 1 09
[0157]
[0158]
[0159]
[0160]
[0161]
[0162] >sample-23WB03295_CD 1 09
[0163]
[0164]
[0165]
[0166]
[0167] The amplified GP1BA gene fragment was detected. Specifically, a total of one amplified fragment was detected at the HPA-2 site. Figure 3 As shown;
[0168] The amplified GP9 gene fragment was then detected. Specifically, one fragment was amplified, and the detection site was HPA-31. Details are as follows: Figure 4 As shown;
[0169] The amplified GP1BB gene fragment was then detected. Specifically, one fragment was amplified, and the detection site was HPA-12. Details are as follows: Figure 5 As shown;
[0170] The amplified ITGB3 gene fragments were then analyzed. Specifically, three fragments were amplified, and the detection sites included HPA-29, HPA-1, HPA-4, HPA-10, HPA-34, HPA-16, HPA-17, HPA-19, HPA-32, HPA-6, HPA-7, HPA-8, HPA-11, HPA-14, HPA-21, HPA-23, HPA-26, HPA-33, and HPA-35. (Details are as follows...) Figure 6 As shown;
[0171] The amplified ITGA2B gene fragment was then analyzed. Specifically, one fragment was amplified, and the detection sites included HPA-3, HPA-9, HPA-20, HPA-22, HPA-24, HPA-27, HPA-28, and HPA-30. Details are as follows: Figure 7 As shown;
[0172] The amplified ITGA2 gene fragments were then analyzed. Specifically, two fragments were amplified, and the detection sites included HPA-5, HPA-13, HPA-18, and HPA-25. Details are as follows... Figure 8 As shown;
[0173] The amplified CD109 gene fragment was then detected. Specifically, one fragment was amplified, and the detection site included HPA-15, as detailed below. Figure 9 shown.
[0174] The method provided in this embodiment can not only detect and accurately classify known or reported HPA antigens, but also study previously unnoticed pathogenic mechanisms or neoantigens from unknown point mutations or structural variations. Traditional detection methods can only infer potential HPA antigens from single-base mutations, lacking precise comparison capabilities. Traditional detection methods are incomplete, primarily targeting HPA 1 / 2 / 3 / 4 / 5 / 15 / 21 sites, while this invention covers all 35 HPA sites, providing comprehensive coverage. These 35 sites allow for amplification and sequencing in a single tube, simplifying experiments. A single microarray can process over 150 samples, automating experimental procedures and data analysis, reducing manual intervention.
[0175] This invention overcomes the shortcomings of existing genotyping technologies, such as low throughput, complex operation, unclear and difficult-to-distinguish results, and inability to provide accurate genotyping. By designing primers specific to the HPA gene, full-length exons are amplified and sequenced, enabling precise genotyping of samples. The reagents and methods provided in this invention serve as an independent and widely applicable identification method, leveraging the high-throughput sequencing platform of PacBio (a third-generation sequencing platform) and its high accuracy. Combined with our independently developed genotyping software, it rapidly and accurately obtains HPA 35-locus genotyping, playing a significant practical role in clinical transfusion research and genetics. Clearly defining the HPA genotype in the transfusion population can prevent adverse transfusion reactions caused by HPA genotype mismatch, thereby improving blood safety and utilization value.
[0176] Other embodiments of this application will readily occur to those skilled in the art upon consideration of the specification and practice of the embodiments disclosed herein. This application is intended to cover any variations, uses, or adaptations of this application that follow the general principles of this application and include common knowledge or customary techniques in the art not disclosed herein.
[0177] It should be understood that this application is not limited to the precise structure described above and shown in the accompanying drawings, and various modifications and changes can be made without departing from its scope. The scope of this application is limited only by the appended claims.
Claims
1. A primer for HPA genotyping detection, characterized in that, include: The specific amplification primer sequences for the HPA gene amplification fragment are as follows: The upstream primer of the CD109-F primer pair is: / 5Phos / GCTGCAATGAACGGTGGCATACAAG; The downstream primer for the CD109-R primer pair is: / 5Phos / GCCAGAGTATCACCAACACCTAGGAGC; The upstream primer of the GP9-F primer pair is: / 5Phos / CCTGATGGAATGACCCAGTGAAGGAG; The downstream primer of the GP9-R primer pair is: / 5Phos / ACAGCTCCCTCCTTACAGTCTTCC; The upstream primer of the ITGA2-2F primer pair is: / 5Phos / CTGTGCTCTCTGTCTTCATGTTCCAAGC; The downstream primer of the ITGA2-2R primer pair is: / 5Phos / GGGACTCAAATGTCTCAGAGCAAGTG; The upstream primer of the ITGA2-3F primer pair is: / 5Phos / TGACCAACCTCATTCAGACCCAAACC; The downstream primer for the ITGA2-3R primer pair is: / 5Phos / GCTGGGCATGGAAATCCCACTGTATC; The upstream primer of the ITGA2B-F primer pair is: / 5Phos / GTACAGGGCACAGGGAACAATCGG; The downstream primer of the ITGA2B-R primer pair is: / 5Phos / ACGGGCTTGCTCACATAGTCCCAGA; The upstream primer for the ITGB3-1F pair is: / 5Phos / GCAAGGCAATGAACCTTAACCTGTGG; The downstream primer for the ITGB3-1R pair is: / 5Phos / CAAGCACCTCAGGCAATTCTCAACAC; The upstream primer of the ITGB3-2F primer pair is: / 5Phos / GGTGGCGTGGTCCCCTTCAA; The upstream primer of the ITGB3-2R primer pair is: / 5Phos / CCTGGAGTGGCCTTCTTGTTGG; The upstream primer of the ITGB3-3F primer pair is: / 5Phos / GTGTGGGAACTGAAGTAGATCCTGAGC; The downstream primer for the ITGB3-3R primer pair is: / 5Phos / CTAACCTCACCCCAGCCCTACTTCTG; The upstream primer of the GP1BB-F primer pair is: / 5Phos / GGATGAGGACTTCAAGCAGCAGGAC; The downstream primer of the GP1BB-R primer pair is: / 5Phos / CAGGTGGGGTGGGTCTGAGAGATTG; The upstream primer of the GP1BA-F primer pair is: / 5Phos / CAAGAAGGGGAATCTATGAAGGAGACTGA; The downstream primer for the GP1BA-R primer pair is: / 5Phos / CCAGGTAGGTCCCAGCAGTTGTCAT.
2. A method for HPA genotyping detection, characterized in that, include: PCR amplification of the HPA gene; The obtained target PCR products were used to construct a third-generation sequencing library; The established library was purified using magnetic beads; The purified library is then mixed with other libraries. Take a mixed library and sequence it. Methods for amplifying the HPA gene using PCR include: Design specific primers for amplifying the HPA gene. The primer sequences are as follows: The upstream primer of the CD109-F primer pair is: / 5Phos / GCTGCAATGAACGGTGGCATACAAG; The downstream primer for the CD109-R primer pair is: / 5Phos / GCCAGAGTATCACCAACACCTAGGAGC; The upstream primer of the GP9-F primer pair is: / 5Phos / CCTGATGGAATGACCCAGTGAAGGAG; The downstream primer of the GP9-R primer pair is: / 5Phos / ACAGCTCCCTCCTTACAGTCTTCC; The upstream primer of the ITGA2-2F primer pair is: / 5Phos / CTGTGCTCTCTGTCTTCATGTTCCAAGC; The downstream primer of the ITGA2-2R primer pair is: / 5Phos / GGGACTCAAATGTCTCAGAGCAAGTG; The upstream primer of the ITGA2-3F primer pair is: / 5Phos / TGACCAACCTCATTCAGACCCAAACC; The downstream primer for the ITGA2-3R primer pair is: / 5Phos / GCTGGGCATGGAAATCCCACTGTATC; The upstream primer of the ITGA2B-F primer pair is: / 5Phos / GTACAGGGCACAGGGAACAATCGG; The downstream primer of the ITGA2B-R primer pair is: / 5Phos / ACGGGCTTGCTCACATAGTCCCAGA; The upstream primer for the ITGB3-1F pair is: / 5Phos / GCAAGGCAATGAACCTTAACCTGTGG; The downstream primer for the ITGB3-1R pair is: / 5Phos / CAAGCACCTCAGGCAATTCTCAACAC; The upstream primer of the ITGB3-2F primer pair is: / 5Phos / GGTGGCGTGGTCCCCTTCAA; The upstream primer of the ITGB3-2R primer pair is: / 5Phos / CCTGGAGTGGCCTTCTTGTTGG; The upstream primer of the ITGB3-3F primer pair is: / 5Phos / GTGTGGGAACTGAAGTAGATCCTGAGC; The downstream primer for the ITGB3-3R primer pair is: / 5Phos / CTAACCTCACCCCAGCCCTACTTCTG; The upstream primer of the GP1BB-F primer pair is: / 5Phos / GGATGAGGACTTCAAGCAGCAGGAC; The downstream primer of the GP1BB-R primer pair is: / 5Phos / CAGGTGGGGTGGGTCTGAGAGATTG; The upstream primer of the GP1BA-F primer pair is: / 5Phos / CAAGAAGGGGAATCTATGAAGGAGACTGA; The downstream primer for the GP1BA-R primer pair is: / 5Phos / CCAGGTAGGTCCCAGCAGTTGTCAT; Primers were synthesized, and phosphorylation modification with 5' bases was performed during synthesis; The synthesized primers were mixed to obtain a primer mixture; PCR amplification was performed by adding PCR amplification system reagents to the primer mixture.
3. The method for HPA genotyping detection according to claim 2, characterized in that, Methods for building a library include: Barcode adapter dilution: Dilute the dry powder barcode adapter to a concentration of 100 μM using TE buffer. Barcode annealing converts a single-chain barcode adapter into a double-chain one. The connector connection reacts to create a unique barcode adapter for each sample; Exonuclease digestion removes products from failed adapter ligation, yielding a high-quality library.
4. The method for HPA genotyping detection according to claim 3, characterized in that, Methods for purifying the established library include: The exonuclease digestion product was purified using 0.45* magnetic beads to remove reagents from the library construction process and small sequence fragments, resulting in a high-quality library. Qubit was used to quantify a single-sample library.