A SNP molecular marker related to growth traits of Hu sheep and its application

Abstract

The present invention relates to a SNP molecular marker related to the growth traits of Hu sheep and its application. The SNP molecular marker related to the growth traits of Hu sheep proposed in the present invention is located at the 14439228 bp in the PDLIM3 gene on chromosome 26 of the Hu sheep genome, the SNP mutation site is rs161525671, the base mutation is T or C, and the genome version number is ARS‑UI_Ramb_v2.0; during breeding, the growth performance of the offspring Hu sheep is improved by retaining the individuals with the genotype of the SNP molecular marker TT and eliminating the individuals with the genotype of TC or CC. The molecular marker provided by the present invention can be used for the breeding of new varieties of high-quality meat sheep, provides an effective genetic technology means for the genetic improvement of the growth traits of Hu sheep, and has important application value in the Hu sheep breeding industry.

Description

Technical Field

[0001] The present invention relates to the fields of molecular biology and genetic breeding, and in particular to a SNP molecular marker associated with the growth traits of Hu sheep and an application thereof. Background Art

[0002] PDLIM3 (PDZ and LIM domain protein 3), also known as ALP (actin-associated LIM protein), is a protein encoded by the PDLIM3 gene. PDLIM3 is a member of the PDZ-LIM domain family, mainly composed of the N-terminal PDZ domain and the C-terminal LIM domain. It is mainly expressed in skeletal muscle, cardiac muscle and smooth muscle, and is co-localized with α-actinin at the Z line of mature muscle fibers. Studies have found that different subtypes of the PDLIM3 gene play different regulatory roles in myotonic dystrophy in mice. This gene is highly expressed in pig and chicken muscle tissue, and has important functions such as maintaining muscle cell development, differentiation and proliferation, and may be a key candidate gene affecting meat quality. Transcriptome and proteomic sequencing analysis in sheep populations revealed that the PDLIM3 gene can regulate muscle growth and development, and interact with some signal pathways with muscle growth and development functions, making it an important candidate gene for sheep growth traits.

[0003] Hu sheep is an excellent local breed of sheep in my country. It is widely popular for its excellent characteristics such as fast growth rate, early sexual maturity, year-round estrus, high fertility, and suitability for confinement feeding. It has become the main breed for meat sheep farming. However, in recent years, due to the limitations of traditional breeding techniques, the genetic potential of Hu sheep has not been fully explored, mainly in economic traits such as growth traits and meat quality traits. With the development of modern molecular biology technology, molecular markers have become a commonly used genetic tool in the field of animal breeding, used to detect and analyze specific locations or sequences in the animal genome. Molecular markers are usually specific fragments of DNA sequences or mutations of genes, which can be used to distinguish between individuals with different phenotypes. However, there are still few molecular markers related to the growth performance of Hu sheep.

[0004] Chinese invention patent 202311709297.4 discloses a molecular marker related to the growth traits of Hu sheep and its application. It was found that the rs413863467 G>A mutation site at the base of 15117681bp on chromosome 8 is significantly correlated with the growth traits of Hu sheep, including weight and body size traits. Chinese invention patent 202210670353.7 discloses a molecular marker related to the growth traits of Hu sheep, its detection method and application. It was found that there is a T / C mutation site at the 234th base of the AHSG gene on chromosome 1, which is significantly correlated with the average daily weight gain and feed conversion rate of Hu sheep. Chinese invention patent 202411036584.8 discloses a SNP molecular marker related to the growth and lamb number traits of Hu sheep and its application. It was found that the C / G mutation site at the 36766802 site of chromosome 6 of Hu sheep is related to the growth and lamb number traits of Hu sheep.

[0005] So far, there is no report on the discovery of molecular markers related to Hu sheep growth traits in the PDLIM3 gene of Hu sheep. Summary of the invention

[0006] In order to solve the above problems, the present invention proposes a SNP molecular marker related to the growth traits of Hu sheep and its application.

[0007] The present invention proposes a SNP molecular marker related to the growth traits of Hu sheep, the nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.1, the 151st base mutates to T or C, the molecular marker is located at the 14439228 bp in the PDLIM3 gene on chromosome 26 of the Hu sheep genome, the SNP mutation site is rs161525671, the base mutation is T or C, and the genome version number is ARS-UI_Ramb_v2.0; during breeding, the growth performance of the offspring Hu sheep is improved by retaining individuals with the SNP molecular marker genotype of TT and eliminating individuals with the genotype of TC or CC.

[0008] The present invention also provides a primer combination for detecting the SNP molecular marker, comprising an upstream primer F with a nucleotide sequence as shown in SEQ ID NO.2, a downstream primer R as shown in SEQ ID NO.3, and an extension primer C as shown in SEQ ID NO.4.

[0009] Upstream primer F: ACGTTGGATGCCATTTCCTCTTTCTGAGTC;

[0010] Downstream primer R: ACGTTGGATGTTCCATGTGCAGACCTTTCC;

[0011] Extension primer C: CCTTTCCATGAGCTAGA.

[0012] Furthermore, the present invention provides a kit for assisting in identifying the growth traits of Hu sheep, comprising the above primer combination.

[0013] Furthermore, the present invention provides the molecular marker, or the primer combination, or the kit for use in detecting the growth and breeding traits of Hu sheep.

[0014] Furthermore, the present invention provides the molecular marker, or the primer combination, or the kit for use in Hu sheep breeding.

[0015] Furthermore, the breeding of lake sheep is the breeding of large-sized lake sheep.

[0016] The present invention provides a method for detecting the growth traits of Hu sheep, comprising:

[0017] The molecular markers of the Hu sheep to be tested are tested; and the growth performance of the Hu sheep to be tested is determined according to the test results.

[0018] Furthermore, the detection includes: using one or more of direct sequencing, PCR amplification, probe method, gene chip method or high-resolution melting curve method.

[0019] Further, the method comprises:

[0020] Genomic DNA is extracted from Hu sheep blood as a sample, and PCR amplification and extension are performed using a primer combination described in nucleotide sequences such as SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.4 to detect the genotype of the Hu sheep to be tested at the molecular markers, and the growth traits of the Hu sheep to be tested are determined based on the genotype detection results.

[0021] In the method for breeding growth traits of Hu sheep provided by the present invention, individuals with genotype TT are retained, and individuals with genotype TC or CC are eliminated, so as to improve the growth performance of the offspring Hu sheep.

[0022] Furthermore, the present invention provides a method for improving the growth traits of Hu sheep, wherein genomic DNA is extracted from Hu sheep blood as a sample, and PCR amplification is performed using a primer combination such as nucleotide sequences shown in SEQ ID NO.2, SEQ ID NO.3 and SEQ ID NO.4 to obtain the genotype of the above-mentioned molecular marker rs161525671, retaining Hu sheep individuals with a genotype of TT, and eliminating Hu sheep individuals with a genotype of TC or CC for Hu sheep breeding and selection.

[0023] The present invention has the following beneficial effects:

[0024] The present invention analyzes the PDLIM3 gene and finds a SNP site related to the growth traits of Hu sheep, that is, a point mutation occurs at 14439228bp on chromosome 26 of the genome, and the SNP mutation site rs161525671T>C. The identification of the growth traits of Hu sheep can be achieved by detecting the genotype of the molecular marker, providing an effective detection method for the selection and breeding of fast-growing Hu sheep. Hu sheep breeding is carried out by retaining Hu sheep individuals with a genotype of TT and eliminating Hu sheep individuals with a genotype of TC or CC. The molecular marker provided by the present invention can be used for the cultivation of new varieties of high-quality meat sheep, providing an effective genetic technology method for the genetic improvement of the growth traits of Hu sheep, and has important application value in the Hu sheep breeding industry. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 It is a schematic diagram of the MassArray SNP typing results of the rs161525671T>C mutation site of the PDLIM3 gene of Hu sheep in the present invention. DETAILED DESCRIPTION

[0026] The present invention will be further described below with reference to the embodiments.

[0027] Embodiment 1:

[0028] By testing the genomic DNA of the representative Hu sheep breed, the present invention found that there is a T / C polymorphic site at the base of the 14439228 bp site (chromosome 26) in the PDLIM3 gene of Hu sheep (the genome version number is ARS-UI_Ramb_v2.0), and this site is closely related to the growth traits of Hu sheep.

[0029] This example provides a method for amplifying and typing the rs161525671 T>C mutation site of the PDLIM3 gene, which specifically includes the following process:

[0030] 1. Primer design: A MassArray primer combination was designed for the 151st T / C polymorphic site shown in SEQ ID NO.1. The nucleotide sequence of the designed MassArray primer combination is as follows:

[0031] Upstream primer (SEQ ID NO. 2): 5′-ACGTTGGATGAACATACTTTCTTCCTGAG-3′;

[0032] Downstream primer (SEQ ID NO. 3): 5′-ACGTTGGATGGCTGTTGCTCGTACCTTTTC-3′;

[0033] Extended primer (SEQ ID NO. 4): 5'-CGGTAATGTGAAGCAGA-3'.

[0034] 2. DNA quality control: Extract genomic DNA from the whole blood of Hu sheep using a DNA extraction kit. Use NanoDrop2000 instrument to detect OD value and 1.25% agarose gel electrophoresis to check whether all DNA samples meet the quality requirements of Massarray SNP typing DNA:

[0035] (1) The DNA electrophoresis results show a single band, and the gDNA is intact without serious degradation;

[0036] (2) The OD260 / 280 value is between 1.8 and 2.0, and the OD260 / 230 value is between 1.8 and 2.0.

[0037] 3. Genotyping test: First, prepare 4 μL PCR master mix and place it in a 1.5 mL EP tube, including 1.850 μL pure water, 0.625 μL PCR buffer, 0.325 μL MgCl2, 0.100 μL dNTP Mix, 1.000 μL Primer Mix, and 0.100 μL HotStar Taq. Add 4 μL PCR master mix to each well of a 384-well plate, then add 1 μL template DNA, press and mix with a 384-well sealing film, and centrifuge at 1 000 rpm for 1 min.

[0038] Place the above reaction plate on a PCR instrument and perform the reaction according to the following PCR amplification reaction program:

[0039] Pre-denaturation at 94°C for 5 minutes;

[0040] 94°C, 20 s (denaturation), 56°C, 30 s (annealing), 72°C, 1 min (extension), for a total of 45 cycles;

[0041] 72°C, 3 min (extension), 4°C, ∞.

[0042] After the PCR reaction is completed, the PCR product is subjected to shrimp alkaline phosphatase (SAP) reaction to remove free dNTPs in the system. Prepare the alkaline phosphatase treatment reaction solution in a new 1.5 mL EP tube, including: 1.53μL pure water, 0.17μL SAP buffer, and 0.30μL SAP Enzyme. Add SAP mix to a 384-well PCR reaction plate, with 5μL of PCR product and 2μL of SAP mix in each well, seal the plate and centrifuge. Set the SAP reaction program: 37℃ 20min; 85℃ 5min; 4℃ ∞.

[0043] Then, a single-base extension reaction was carried out in the ddNTP system to form a single-base extension product complementary to the SNP genotype to be detected. After resin purification and sample loading, the product was analyzed using a MALDI-TOF mass spectrometer. The test results were obtained using TYPER4.0 software to obtain the original data and genotyping diagram. The triangle close to the vertical axis represents the CC genotype, the square in the middle represents the TC genotype, and the triangle close to the horizontal axis represents the TT genotype. Figure 1 .

[0044] Embodiment 2:

[0045] The present invention provides an application of the molecular markers provided in Example 1 in the association analysis of Hu sheep growth traits, which specifically includes the following process:

[0046] The present invention detects the genotype of the rs161525671T>C mutation site of the PDLIM3 gene of 384 Hu sheep (the detection method is the same as in Example 1), and uses the general linear model GLM in SPSS26.0 software for statistical analysis. The model used is: Yijkl=μ+Gi+Dj+Yk+Sl+eijkl, where Yijkl represents the trait measurement value, μ represents the population mean, Gi is the genotype effect, Dj is the age effect, Yk is the birth year effect, Sl is the season effect, and eijkl is the random residual. The results are expressed as the least squares mean ± standard error, and P<0.05 is judged to be significantly different; P<0.01 is judged to be extremely significantly different.

[0047] Genotyping results (eg Figure 1 The results of the association analysis between genotype and growth traits are shown in Tables 1 and 2. For the rs161525671 T>C locus of the PDLIM3 gene, the chest depth, chest depth and chest width at 4 months of age, and the weight, height, body length, chest circumference, chest depth, tube circumference and waist angle width at 6 months of age of the Hu sheep with TT genotype were significantly greater than those of the TC and CC genotypes (P<0.05). It can be seen that the TT genotype is selected for seed preservation during Hu sheep breeding, and the TT genotype is used as a breeding sheep during breeding and hybridized with other sheep. In particular, artificial insemination with semen of TT genotype breeding rams can greatly improve the breeding efficiency and obtain a population of Hu sheep with an advantage in growth rate.

[0048] Table 1 Results of association analysis between PDLIM3 gene polymorphism and body weight and size of Hu sheep from birth to 2 months of age

[0049]

[0050] Table 2 Results of association analysis between PDLIM3 gene polymorphism and body weight and size of Hu sheep aged 3 to 6 months

[0051]

[0052] Note: Different lowercase letters in the same column indicate significant differences ( P <0.05, the same letter or no letter indicates not significant ( P> 0.05).

[0053] It will be apparent to those skilled in the art that the present invention is not limited to the details of the exemplary embodiments described above and that the present invention can be implemented in other specific forms without departing from the spirit or essential features of the present invention. Therefore, the embodiments should be considered exemplary and non-restrictive in all respects, and the scope of the present invention is defined by the appended claims rather than the above description, and it is intended that all changes falling within the meaning and scope of the equivalent elements of the claims be included in the present invention.

[0054] In addition, it should be understood that although the present specification is described according to implementation modes, not every implementation mode contains only one independent technical solution. This description of the specification is only for the sake of clarity. Those skilled in the art should regard the specification as a whole. The technical solutions in each embodiment may also be appropriately combined to form other implementation modes that can be understood by those skilled in the art.

Claims

1. Application of a SNP molecular marker related to Hu sheep growth traits in Hu sheep breeding, characterized in that: The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.1, the molecular marker is located at the 14439228bp in the PDLIM3 gene on chromosome 26 of the Hu sheep genome, the SNP mutation site is rs161525671, the base mutation is T or C, and the genome version number is ARS-UI_Ramb_v2.0; during breeding, the growth performance of offspring Hu sheep is improved by retaining individuals with the SNP molecular marker genotype TT and eliminating individuals with the genotype TC or CC genotype; the growth traits are chest depth, chest depth, chest width at 4 months of age and weight, body height, body oblique length, chest circumference, chest depth, tube circumference, and waist angle width at 6 months of age.

2. The application of the SNP molecular marker related to the growth traits of Hu sheep in Hu sheep breeding according to claim 1, characterized in that: The primer combination for detecting the SNP molecular marker includes an upstream primer F with a nucleotide sequence as shown in SEQ ID NO.2, a downstream primer R as shown in SEQ ID NO.3, and an extension primer C as shown in SEQ ID NO.4.

Images