Method for detecting nucleic acid

Abstract

Methods, kits, and materials are provided for amplifying, enriching, or detecting, inter alia, small amounts of target nucleic acids in a sample by digesting or degrading non-target nucleic acids in the sample and optionally detecting the target nucleic acids prior to or during amplification. Interference on non-target nucleic acid before nucleic acid amplification or detection or in the process is reduced to the minimum, and the sensitivity, accuracy and efficiency of amplification or detection are greatly improved.

Description

Technical Field

[0001] The present disclosure relates to methods for performing nucleic acid detection. Background Art

[0002] Sensitive, accurate, and efficient detection of nucleic acid sequence variation is essential for precision medicine, which provides personalized treatment based on the unique genetic profile of each patient. However, analyzing rare DNA or RNA variations with low allele frequencies in cancer samples has long been a challenge for existing molecular diagnostic technologies. (Khodakov D, et al. Adv Drug Deliv Rev 105, 3-19 (2016). [PubMed: 27089811]). The first generation sequencing (FGS) method is not sensitive enough to detect mutation rates below 10%. The next generation sequencing (NGS) method is time-consuming and uneconomical. Allele-specific PCR is prone to artificial mutations, while the specificity of qPCR-based methods is overly dependent on primers and probes. The detection sensitivity of PCR-based methods can enrich the target sequence by enzyme digestion of the wild-type (WT) sequence in the sample, but the operation process is complicated. (Zhao AH, et al. J Hematol Oncol 4, 40 (2011). [PubMed: 21985400]).

[0003] CRISPR-based gene editing systems have shown great potential for rapid and sensitive nucleic acid detection, including systems based on Cas9, Cas12, and Cas13. Recently, Cas12- or Cas13-based detection methods combined with isothermal amplification technology have been applied to SARS-CoV-2 diagnosis and have been shown to be very effective due to the fact that there are almost no contaminants of host nucleic acids in the samples. However, in sharp contrast, when detecting rare genetic variants and mutations, most of the DNA or RNA is WT sequence, which seriously hinders the analysis.

[0004] Wang et al. coupled a dual methylation-sensitive restriction endonuclease (BstUI / HhaI) with an RPA-assisted CRISPR / Cas13a system for site-specific methylation detection of the SEPT9 gene (Wangle XF, et al. ACS Sens. 2021, 6, 2419-2428). However, this study only detected the SEPT9 gene, and it is impossible to determine whether this method is suitable for detecting any methylation in any target sequence. In addition, the BstUI / HhaI used in this study is only sensitive to DNA CpG methylation in mammalian genomes, but not to Dam methylation or Dcm methylation. Only the Cas13a detection system was used in the study. This study did not disclose a method for sensitive, specific and simple detection of deletions, insertions and / or substitution mutations in target nucleic acids, and this problem remains unsolved. Summary of the invention

[0005] In general, methods, kits, and materials are provided for detecting, particularly in small amounts, target nucleic acids by digesting or degrading non-target nucleic acids in a sample prior to or during amplification.

[0006] In certain aspects, the present disclosure provides a method for amplifying or enriching a target nucleic acid at a specific location in a sample, comprising digesting or degrading the non-target nucleic acid by exposing the non-target nucleic acid to a protein having an activity of cleaving nucleic acid that specifically recognizes a base at a specific location.

[0007] In other aspects, the present disclosure provides a method for detecting a target nucleic acid at a specific location in a sample, comprising detecting a target nucleic acid at a specific location in the sample by exposing a non-target nucleic acid to a nucleic acid protein having activity that specifically recognizes the nucleic acid at a specific location before or during amplification, or detecting the amplified target nucleic acid.

[0008] In one or more embodiments, the protein having nucleic acid cleavage activity is selected from the following group: restriction endonucleases, Cas enzymes, ZFN enzymes, TALEN enzymes and functional complexes thereof, such as Cas enzyme / s / sgRNA complexes, Ago / gDNA complexes or Cas12a / crRNA complexes. Preferably, the Cas enzyme / sgRNA complex is a Cas9 / sgRNA complex, more preferably a spCas9 / sgRNA complex. Preferably, the Ago / gDNA complex is a pfAgo / gDNA complex. Preferably, the Cas12a / crRNA complex is a LbCas12a / crRNA complex.

[0009] In one or more embodiments, the protein having nucleic acid cleavage activity is a restriction endonuclease, and the non-target nucleic acid comprises a recognition site for the restriction endonuclease at a designated site.

[0010] In one or more embodiments, the restriction endonuclease is selected from BclI, BsaBI, AclWI, Bst4CI, XmiI, BlsI, PspFI, CviKI-1, CviJI, MscI, EcoP15I, BspACI, BseLI, BstKTI, PspN4I, BspLI, NlaIV, BmiI, MaiI, RsnAI, BspEI, HpaII, MroI, Kpn2I, BcoDI, BstDEI, Bpu10I, BtsIMutI, BasBI, BtsCI, NspI, FaiI, EcoRV and BtsaI.

[0011] In one or more embodiments, the Ago enzyme is selected from pfAgo, cbAgo, LrAgo, pfAgo-mut, ApoI, pfAgo, TtAgo and MjAgo.

[0012] In one or more embodiments, the protein having nucleic acid cleavage activity is a Cas enzyme, and a gRNA having a targeting region that binds to a non-target nucleic acid sequence at a specified position is used to guide Cas enzyme cleavage of the nucleic acid sequence.

[0013] In one or more embodiments, the Cas enzyme is selected from Cas 9, Cas 12, Cas 13 and Cas 14, in particular SpCas9, SaCas9, HypaCas9, St1Cas9, spCas9-NG, LbCas12a, spCas9-mut and ScCas9.

[0014] In one or more embodiments, exposing the non-target nucleic acid to one or more proteins having nucleic acid cleaving activity is performed by adding the proteins to an amplification mixture to amplify the target nucleic acid.

[0015] In one or more embodiments, amplification includes the following groups: helicase-dependent amplification (HAD), polymerase chain reaction (PCR), DNA ligase chain reaction (LCR), isothermal DNA amplification, QBeta RNA replicase, RNA transcription amplification reaction, loop-mediated isothermal amplification (LAMP), RT-LAMP, recombinase polymerase amplification (RPA), reverse transcription-recombinase polymerase amplification (RT-RPA), helicase-dependent amplification (HDA), strand displacement amplification (SDA), nucleic acid sequence-based amplification (NASBA), transcription-mediated amplification (TMA), nickase amplification reaction (NEAR), rolling cycle amplification (RCA), multiple displacement amplification (MDA), separation (RAM), cyclic helicase-dependent amplification (cHDA), single primer isothermal amplification (SPIA), signal-mediated RNA amplification (SMART), self-sustained sequence replication (3SR), genomic exponential amplification reaction (GEAR) and isothermal multiple displacement amplification (IMDA).

[0016] In one or more embodiments, the amplification mixture is an isothermal nucleic acid amplification mixture.

[0017] In one or more embodiments, the amplification is RPA.

[0018] In one or more embodiments, the alternation includes deletion, substitution, and insertion of one or more bases at a specified site compared to a non-target nucleic acid.

[0019] In one or more embodiments, the alternation is an alternation of two or more consecutive bases compared to a non-target nucleic acid.

[0020] In one or more embodiments, detection of the amplified target nucleic acid indicates the presence of alternation in the subject.

[0021] In one or more embodiments, the target nucleic acid is detected by DNA staining, nucleic acid amplification, spectrophotometry, sequencing, fluorescent probe hybridization, fluorescence resonance energy transfer, optical microscopy, electron microscopy, CRISPR-based detection, visual detection, sensor-based detection, color detection, gold nanoparticle-based detection, electrochemical detection, semiconductor-based sensing, or a combination thereof.

[0022] In one or more embodiments, the amplified target nucleic acid is detected using one or more proteins capable of recognizing a specific nucleic acid sequence or a functional complex thereof.

[0023] In one or more embodiments, proteins capable of recognizing specific nucleic acid sequences include Cas enzymes, Ago enzymes, ZFN enzymes, TALEN enzymes, and functional complexes thereof.

[0024] In one or more embodiments, the Cas enzyme is selected from Cas 9, Cas 12, Cas 13 and Cas 14, in particular, including but not limited to SpCas9, SaCas9, HypaCas9, St1Cas9, spCas9-NG, LbCas12a, spCas9-mut and ScCas9.

[0025] In one or more embodiments, the Ago enzyme is selected from pfAgo, cbAgo, LrAgo, pfAgo-mut, ApoI, ppAgo, TtAgo and MjAgo.

[0026] In one or more embodiments, the functional complex is selected from the group consisting of a Cas enzyme / sgRNA complex, an Ago / gDNA complex, and a Cas12a / crRNA complex; more preferably, the Cas enzyme / sgRNA complex is a Cas9 / sgRNA complex, more preferably, a spCas9 / sgRNA complex; the Ago / gDNA complex is a pfAgo / gDNA complex; and the Cas12a / crRNA complex is a LbCas12a / crRNA complex.

[0027] In one or more embodiments, a protein capable of recognizing a specific nucleic acid sequence is selected from LbCas12a, FnCas12a, Lb5Cas12a, HkCas12a, TsCas12a, BbCas12a, BoCas12a, Lb4Cas12a, LbuCas13a, LwaCas13a, LbaCas13a, PprCas13a, HheCas13a, EreCas13a, AsCas12a, TsCas12a, BbCas12a, BoCas12a, Lb4Cas12a, spCas9, pfAgo, cbAgo, LrAgo, Cas12b, Cas12a-mut, Cas12b-mut, AapCas12b, BrCas12b, CcaCas13b, PsmCas13b and AacCas12b or a functional complex thereof.

[0028] In one or more embodiments, digestion or degradation and detection are performed sequentially or simultaneously.

[0029] In one or more embodiments, digestion or degradation and detection are performed in the same reaction system.

[0030] On the other hand, the present disclosure provides a kit for alternately amplifying or enriching and selectively detecting target nucleic acids at specific locations of a sample, comprising reagents for alternately amplifying target nucleic acids at specific locations of the sample, and reagents for alternately digesting non-target nucleic acids at specified locations of the sample.

[0031] In one or more embodiments, the alteration comprises a deletion, substitution and / or insertion of one or more bases at a specified position compared to a non-target nucleic acid.

[0032] In one or more embodiments, the alternation is an alternation of two or more consecutive bases compared to a non-target nucleic acid.

[0033] In one or more embodiments, the reagent for digesting non-target nucleic acids includes a protein having nucleic acid cleaving activity.

[0034] In one or more embodiments, the protein having nucleic acid cleavage activity is selected from: restriction endonucleases, Ago enzymes, ZFN enzymes, TALEN enzymes and functional complexes thereof, such as Cas enzyme / sgRNA complexes, Ago / gDNA complexes or Cas12a / crRNA complexes. Preferably, the Cas enzyme / sgRNA complex is a Cas9 / sgRNA complex, more preferably, a spCas9 / sgRNA complex. Preferably, the Ago / gDNA complex is a pfAgo / gDNA complex. Preferably, the Cas12a / crRNA complex is a LbCas12a / crRNA complex.

[0035] In one or more embodiments, the protein having nucleic acid cleavage activity is a restriction endonuclease, preferably from BclI, BsaBI, AclWI, Bst4CI, XmiI, BlsI, PspFI, CviKI-1, CviJI, MscI, EcoP15I, BspACI, BseLI, BstKTI, PspN4I, BspLI, NlaIV, BmiI, MaiI, RsnAI, BspEI, HpaII, MroI, Kpn2I, BcoDI, BstDEI, Bpu10I, BtsIMutI, BasBI, BtsCI, NspI, FaiI, EcoRV and BtsaI.

[0036] In one or more embodiments, the protein having nucleic acid cleavage activity is an Ago enzyme, preferably selected from pfAgo, cbAgo, LrAgo, pfAgo-mut, ApoI, pfAgo, TtAgo and MjAgo.

[0037] In one or more embodiments, the protein having nucleic acid cleavage activity is a Cas enzyme, preferably selected from Cas 9, Cas12, Cas 13 and Cas 14, in particular SpCas9, SaCas9, HypaCas9, St1Cas9, spCas9-NG, LbCas12a, spCas9-mut and ScCas9.

[0038] In one or more embodiments, the reagents for digesting non-target nucleic acids include a restriction endonuclease, or a Cas enzyme and a guide RNA having a targeting region that binds to the non-target nucleic acid.

[0039] In one or more embodiments, reagents for amplifying a target nucleic acid that varies at a specified position in a sample include reagents for performing helicase-dependent amplification (HAD), polymerase chain reaction (PCR), DNA ligase chain reaction (LCR), isothermal DNA amplification, QBeta RNA replicase, RNA transcription amplification reaction, loop-mediated isothermal amplification (LAMP), RT-LAMP, recombinase polymerase amplification (RPA), reverse transcription-recombinase polymerase amplification (RT-RPA), helicase-dependent amplification (HDA), strand displacement amplification (SDA), nucleic acid sequence amplification (NASBA), transcription-mediated amplification (TMA), nickase amplification reaction (NEAR), rolling circle amplification (RCA), multiple displacement amplification (MDA), separation (RAM), ring helicase-dependent amplification (cHDA), single primer isothermal amplification (SPIA), signal-mediated RNA amplification technology (SMART), self-sustained sequence replication (3SR), genomic exponential amplification reaction (GEAR) and isothermal multiple displacement amplification (IMDA).

[0040] In one or more embodiments, the reagents for amplification include reagents for PCR or isothermal amplification reactions. More preferably, the amplification reagents include reagents for RPA.

[0041] In one or more embodiments, the kit further comprises reagents for detecting target nucleic acids, such as reagents for DNA staining, nucleic acid amplification, spectrophotometry, sequencing, fluorescent probe hybridization, fluorescence resonance energy transfer, optical microscopy, electron microscopy, CRISPR-based detection, visual-based detection, sensor-based detection, color detection, color detection, gold nanoparticle-based detection, electrochemical detection, semiconductor-based sensing, or a combination thereof.

[0042] In one or more embodiments, the reagent for detecting the target nucleic acid includes one or more proteins, or a functional complex thereof, capable of recognizing a specific nucleic acid sequence.

[0043] In one or more embodiments, the protein(s) capable of recognizing a specific nucleic acid sequence includes Cas enzymes, Ago enzymes, ZFN enzymes, TALEN enzymes, and functional complexes thereof.

[0044] In one or more embodiments, the Cas enzyme is selected from the group consisting of Cas 9, Cas 12, Cas 13 and Cas 14, particularly including but not limited to SpCas9, SaCas9, HypaCas9, St1Cas9, spCas9-NG, LbCas12a, spCas9-mut and ScCas9.

[0045] In one or more embodiments, the Ago enzyme is selected from pfAgo, cbAgo, LrAgo, pfAgo-mut, ApoI, ppAgo, TtAgo and MjAgo.

[0046] In one or more embodiments, the functional complex is selected from the group consisting of a Cas enzyme / sgRNA complex, an Ago / gDNA complex, and a Cas12a / crRNA complex; more preferably, the Cas enzyme / sgRNA complex is a Cas9 / sgRNA complex, more preferably, a spCas9 / sgRNA complex; the Ago / gDNA complex is a pfAgo / gDNA complex; and the Cas12a / crRNA complex is a LbCas12a / crRNA complex.

[0047] In one or more embodiments, a protein capable of recognizing a specific nucleic acid sequence is selected from LbCas12a, FnCas12a, Lb5Cas12a, HkCas12a, TsCas12a, BbCas12a, BoCas12a, Lb4Cas12a, LbuCas13a, LwaCas13a, LbaCas13a, PprCas13a, HheCas13a, EreCas13a, AsCas12a, TsCas12a, BbCas12a, BoCas12a, Lb4Cas12a, spCas9, pfAgo, cbAgo, LrAgo, Cas12b, Cas12a-mut, Cas12b-mut, AapCas12b, BrCas12b, CcaCas13b, PsmCas13b and AacCas12b or a functional complex thereof.

[0048] In one or more preferred embodiments, the kit comprises a mixture comprising a reagent for RPA and a reagent for digesting nucleic acid that does not contain the alteration. In certain embodiments, the mixture also comprises a reagent for detecting the target nucleic acid.

[0049] In one or more embodiments, the kit includes the kit includes a protein for cleavage listed in any one ID No. in Table A and reagents for the amplification method listed in Table A, and optionally includes a detection protein listed in the same ID No. for detection. BRIEF DESCRIPTION OF THE DRAWINGS

[0050] Figure 1 The development of a sensitive mutation detection method in this article is illustrated. a. The detection scheme compared with the CRISPR detection method in this article. b. The FLT3-D835 mutation site and the proportion of different FLT3-D835 mutation types in AML patients in the cBioportal database. c. EcoRV activity and specificity test in its specific buffer. d. EcoRV digestion activity and specificity test in primer-free RPA mixture. e. Fluorescence intensity after 30 minutes of Cas12a reaction (d).

[0051] Figure 2The results of the enhanced method after optimizing crRNA and primers are shown. A. D835Y-crRNAs sequences, and FLT3-WT and D835Y gene regions. The base G in D835Y mutated to T. b. Different D835Y-crRNA-guided Cas12a reactions detected 1e10 copies of PCR fragments, and had different D835Y mutation rates, and fluorescence heat maps in 10, 20, and 30 minutes of Cas12a reactions. c. Comparison of detection results of D835Y-crRNA for 100% D835Y and WT samples. The selected crRNA should have high D835Y DNA-induced fluorescence intensity and low WT DNA-induced fluorescence intensity. d. Specific detection of D835Y-crRNA2, D835H-crRNA, D835V-crRNA, and D835F-crRNA. Dynamic changes in fluorescence intensity after 60 minutes of Cas12a reaction. E. Schematic diagram of the reaction of MMT-crRNAs-guided Cas12a to recognize D835Y / H / V / F mutations from a WT background. f. Relative position of RPA primers to the D835 site. g. Screening of RPA primer pairs for efficient amplification of the D835 region. The test sample was a 100% D835Y plasmid template of 1e2 copies. The reaction conditions were a standard RPA reaction for 20 minutes (without EcoRV digestion) and a MMT-crRNA-guided Cas12a reaction for 20 minutes, both at 37°C. h. Using gradient copies of D835Y plasmid templates as test samples, the sensitivity of F2R1-mediated RPA combined with MMT-crRNA-guided Cas12a reactions was evaluated. The fluorescence intensity after 20 minutes of Cas12a reaction is shown. i. Time course analysis of F2R1-mediated RPA combined with MMT-crRNA-guided Cas12a reactions to detect 1e1 D835Y plasmid templates.

[0052] like Figure 3 As shown, the sensitivity of a method used in this paper for detecting the D835Y mutation is 0.001%. ab. Comparison of the sensitivity of CRISPR detection and detection of the D835Y mutation rate gradient plasmid template in this paper. cd. Detection of the same amplification product in (a) using WT-crRNA-induced Cas12a reaction. ef. FGS results of the amplification products in CRISPR detection and the method used in this paper. The D835Y mutation rate was quantified using the online tool EditR (https: / / moriaritylab.shinyapps.io / edit). g. Design and amplification diagram of qPCR detection of 1e6 plasmid templates with a D835Y mutation rate gradient using D835Y-probe 1. h. Comparison of Ct values ​​of different samples.

[0053] Figure 4 It is shown that a method used in this paper can accurately detect FLT3-D835Y / V / H / F mutations in clinical samples. a. Schematic diagram of a method used in this paper to detect cell mutations in AML patients. 100μl of nucleic acid release solution was reacted at 95℃ for 3min, and then 2μl of the product was taken for detection by this method, including EcoRV integrated RPA reaction at 37℃ for 20 minutes and MMT-crRNA-guided Cas12a reaction at the same temperature for 20 minutes. A positive result with a green fluorescent signal indicates that the sample has a D835 mutation. b. NGS results of FLT3-D835 mutation types of 32 AML samples and their AML classification information. c. Detection results and FGS results of FLT3-D835Y / V / H / F mutations in 32 AML samples. Red IDs and red boxes mark patients with mutations, and red triangles indicate mutant bases.

[0054] Figure 5 It shows that a method in this article can complete the clinical diagnosis of FLT3-D835 mutation within one hour. a. Schematic diagram of the entire mutation diagnosis. The process from blood drawing to report submission can be completed within 1 hour. b. Equipment required for the method in this article. This article uses FGS and NGS methods to detect the results of drug-resistant FLT3-D835Y / V / H / F mutations in 80 AML patients. For FGS results, the mutant bases are marked with red triangle underlines. For NGS results, WT and mutant bases are represented by green and red, respectively, and the numbers represent their ratios. d. Statistical table comparing the sensitivity and specificity of this study's method with NGS and FGS.

[0055] Figure 6 The wide application of a method in this paper in cancer mutation diagnosis is shown. a. Comparison of the sensitivity of this method with CRISPR for detecting IDH2-R172K, EGFR-e19del and L858R, NRAS-G12D mutations. The genomic locations of these mutations are shown in the figure, where exons and mutation sites are indicated in blue and red, respectively. The test samples were 1e5 copies of plasmid templates, and the mutation rates were 1% and 0.1%, respectively. Each amplification product was detected by WT-crRNA and mutant-crRNA-induced Cas12a reactions. Fluorescence intensity and naked eye observation results were recorded at the same time. b. Statistical analysis of MT / WT fluorescence ratios in a method used in this paper and CRISPR detection. The results of 1% and 0.1% mutant samples were counted together. ce. qPCR detection method for EGFR-e19del, L858R and NRAS-G12D. qPCR detected mutation ratios of 10%, 1% and 0.1%. A 100% WT template and ddH2O (NC) were used as controls.

[0056] Figure 7 The specific detection target PCR fragments for FLT3-D835Y-crRNA1-4 guiding Cas12, the mutation rates of D835Y (GAT>TAT) were 100%, 50%, 10%, and 0% (WT), respectively. Cr, crRNA; NC, negative control.

[0057] Figure 8 The dynamic process analysis of the specific reaction of FLT3-D835Y-crRNA2-induced Cas12 with the target FLT3-D835Y, WT and negative control fragments is shown.

[0058] Fig. 9 Optimization of FLT3-D835H-crRNA by introduced mismatches is shown. a. Sequences (brown) and targets (purple) of FLT3-D835H-crRNA1 and crRNA2. Mutated bases (GAT>CAT) and introduced mismatches (U>C) are indicated in red and orange, respectively. b. Dynamic process analysis of FLT3-D835H-crRNA1 and crRNA2 to detect mutations between mutant (MTD835H) and WT alleles. c. Comparison of fluorescence intensity after 60 min of reaction.

[0059] Fig.10 The optimization of FLT3-D835V-crRNA by introduced mismatches is shown. a. Sequences of FLT3-D835V-crRNA1~3 (brown) and target sequences (purple). The mutant base (GAT>GTT) and the introduced mismatches are represented in red and orange, respectively. b. Time course analysis of FLT3-D835V-crRNA1~3, detecting mutations between mutant (MTD835V) and WT alleles. c. Comparison of fluorescence intensity after 60 min of reaction.

[0060] Fig.11 Specific detection of FLT3-D835F-crRNA. a. Sequence of FLT3-D835F-crRNA (brown) and target sequence (purple). Mutated bases (GAT>TTT) and introduced mismatches are indicated in red and orange, respectively. b. Time course analysis of FLT3-D835F-crRNA, detecting mutations between mutant (MTD835F) and WT alleles.

[0061] Fig.12The optimization of FLT3-D835-WT-crRNA is shown. a. Sequences (brown) and targets (purple) of FLT3-D835-WT-crRNA1~4. The mutant bases of D835Y, D835H, D835V and D835F are red, and the introduced mismatches are orange. b. Comparison of fluorescence intensity after mixing d835Y&H&V&F mutations after 60 minutes of reaction. c. Time course analysis of FLT3-D835-WTcrRNA1~4 to detect mutations between WT and mutant alleles.

[0062] Fig.13 The sequences and positions of the mutation detection target and internal control (IC) target on exon 20 of FLT3, as well as the sequence of IC-crRNA are shown.

[0063] Fig.14 The specific detection results of MMT-crRNA. a. The specific detection results of MMT-crRNAs for 1e10 copies of D835Y / H / V / F and WT. The photo was taken after 60 minutes of Cas12a reaction under blue light. The fluorescence intensity statistics are shown in b.

[0064] Fig.15 RPA primer sequences and locations for amplification of the FLT3-D835 region.

[0065] Fig.16 Kinetic analysis of RPA primer screening for FLT3-D835 region amplification.

[0066] Fig.17 This is a sensitivity analysis of a detection system in this study. a. Dynamic process analysis of MMT-crRNAs induction detection using 1E7 to 1E1 copies of D835Y plasmid. NC is a negative control. b. Dynamic analysis record.

[0067] Fig.18 The RPA using 1E6-1E1 templates inhibited the Cas12a reaction induced by EcoRV and WT-crRNA. a. Fluorescence intensity statistics and naked eye observation results. b. Dynamic analysis record.

[0068] Fig.19 The results of D835Y and WT using RPA with or without EcoRV and MMT-crRNA-induced Cas12a reactions to detect 1 E6-1E1 copy are shown. The histogram shows the final fluorescence intensity.

[0069] Fig. 20 TaqMan qPCR design for FLT3-D835Y detection. The forward primer, reverse primer, and TaqMan probe are indicated in orange, purple, and green, respectively.

[0070] Fig.21 Amplification plot of 1e5 copies of the D835Y mutation rate gradient detected by qPCR involving D835Y probe 1.

[0071] Fig. 22 Amplification plot of 1e5 copies of the D835Y mutation rate gradient detected by qPCR involving D835Y probe 2.

[0072] Fig.23 (a) and next-generation sequencing (NGS) results (b) of 32 AML patient cell samples. In the NGS results, only three bases at the D835 site are shown, with wild-type bases and mutant bases indicated in green and red, respectively.

[0073] Fig.24 This study explored the blood processing time before the detection method described in this article. Briefly, peripheral blood from patients with D835Y mutations was divided equally into 300 μl / sample and then mixed with 1200 μl of red blood cell (RBC) lysis buffer. Different lysis times (0-10 min) were used to screen the optimal conditions. Then, white blood cells (WBC) were collected by centrifugation for 1 min, treated with nucleic acid release solution, and detected using the method of this study.

[0074] Fig.25 Results from 80 AML patient samples read by eye under 485 nm blue light are shown.

[0075] Fig.26 The FGS results and CRISPR detection results of the amplified products in this study. The test sample is a plasmid template with 1e5 copies, and the mutation rate is 1%. The mutated bases are represented by green and gray triangles, and the percentage represents the mutation rate. DETAILED DESCRIPTION

[0076] I. Definitions

[0077] Unless otherwise indicated, the following terms have the following meanings.

[0078] The term "endonuclease activity" refers to an enzyme activity that cleaves a polynucleotide chain by cleaving nucleotides other than the two terminal nucleotides.

[0079] "Proteins with nucleic acid cleavage activity" target nucleic acids, digest nucleic acids by recognizing specific locations in nucleic acids (i.e., certain short sequences), and then cleave nucleic acids. The recognition site and the cleavage site in the nucleic acid can be the same or different. Proteins with nucleic acid cleavage activity include, but are not limited to, restriction endonucleases, Cas enzymes, Ago enzymes, ZFN enzymes, TALEN enzymes, and their functional complexes.

[0080] The "functional complex" of a protein, such as an endonuclease, can include the endonuclease itself and a molecule (s) that can assist the endonuclease in functioning. For example, sgRNA or crRNA may be necessary for the Cas enzyme to act as an endonuclease. This is well known in the art. Therefore, for example, the functional complex used herein includes but is not limited to a Cas enzyme / sgRNA complex, an Ago / gDNA complex or a Cas12a / crRNA complex. Preferably, the Cas enzyme / sgRNA complex is a Cas9 / sgRNA complex, more preferably, a spCas9 / sgRNA complex. Preferably, the Ago / gDNA complex is a pfAgo / gDNA complex. Preferably, the Cas12a / crRNA complex is a LbCas12a / crRNA complex. When referring to the nucleic acids herein, "site", "site" or "position" can be used interchangeably.

[0081] The term "polymerase" refers to an enzyme that uses DNA or RNA as a template to add nucleotide units to a nucleotide chain, thereby performing template-directed polynucleotide synthesis. This term includes a full-length polypeptide and a domain having polymerase activity. DNA polymerases are well known to those skilled in the art, including but not limited to DNA polymerases isolated or derived from Pyrococcus furiosus, Thermococcus litoralis, and Thermotoga maritime, Bacteriophage T4 or their modified versions.

[0082] As used herein, "thermostable polymerase" refers to any enzyme that catalyzes polynucleotide synthesis by thermal cycling. As used herein, isothermal polymerase refers to any enzyme that catalyzes polynucleotide synthesis at a constant temperature (e.g., 37-42°C) without the need for thermal cycling, such as the DNA recombinase polymerase from bacteriophage T4.

[0083] The term "nucleic acid amplification" or "amplification reaction" refers to any in vitro method that multiplies copies of a nucleic acid target sequence. Such methods include, but are not limited to, polymerase chain reaction (PCR), DNA ligase chain reaction (LCR), isothermal DNA amplification, QBetaRNA replicase and RNA transcription-based amplification reactions and other methods known to those skilled in the art. In particular, these means include, but are not limited to: loop-mediated isothermal amplification (LAMP), recombinase polymerase amplification (RPA), helicase-dependent amplification (HDA), strand displacement amplification (SDA), nucleic acid sequence amplification (NASBA), transcription-mediated amplification (TMA), nickase amplification reaction (NEAR), rolling circle amplification (RCA), multiple displacement amplification (MDA), branching (RAM), circular helicase-dependent amplification (cHDA), single primer isothermal amplification (SPIA), signal-mediated RNA amplification (SMART), self-sustained sequence replication (3SR), genomic exponential amplification reaction (GEAR) or isothermal multiple displacement amplification (IMDA).

[0084] "Amplification" refers to a step in which a solution is placed under conditions sufficient to amplify a polynucleotide. The components of the amplification reaction include, for example, primers, polynucleotide templates, polymerases, nucleotides, and the like. The term amplification generally refers to an "exponential" increase in the target nucleic acid. However, amplification as used herein may also refer to a linear increase in the number of nucleic acids of a selective target sequence, such as that obtained by cycle sequencing. In isothermal DNA amplification, the reaction further comprises a single-stranded DNA binding protein (SSB). In one or more embodiments of the present disclosure, the reaction further comprises a protein having nucleic acid cleavage activity (such as a restriction endonuclease, a Cas enzyme, an Ago enzyme, a ZFN enzyme, a TALEN enzyme, and a functional complex thereof).

[0085] "Isothermal DNA amplification" can be performed at a constant temperature without the need for thermal cycling, and includes, but is not limited to: nucleic acid sequence based amplification (NASBA), strand displacement amplification (SDA), rolling circle amplification (RCA), loop-mediated isothermal amplification (LAMP), helicase-dependent amplification (HDA), and recombinase polymerase amplification (RPA) or enzyme recombinase amplification (ERA).

[0086] "Recombinase polymerase amplification" or "RPA" is a highly sensitive and selective isothermal amplification technique that operates at 37-42°C. It has been used to amplify different targets, including RNA, miRNA, ssDNA, and dsDNA from a variety of organisms and samples. "Enzymatic recombinase amplification" or "ERA" is another version of RPA with a different thermostable polymerase.

[0087] The RPA (recombinase polymerase amplification) process begins with the binding of the recombinase protein of T4-like bacteriophage (e.g., uvsX) to the primer in the presence of ATP and a crowding agent (high molecular weight polyethylene glycol) to form a recombinase-primer complex. The complex then searches for homologous sequences in the double-stranded DNA and promotes strand invasion of the primer at the homologous site. To prevent the expulsion of the inserted primer by branch migration, the single-strand binding protein (SSB) stabilizes the displaced DNA strand. Finally, the recombinase dissociates and a strand-displacing DNA polymerase (e.g., the large fragment of Bacillus subtilis Pol 1, Bsu) binds to the 3' end of the primer and extends the primer in the presence of dNTPs. Cyclic repetition of this process results in exponential amplification ( Figure 1 ).

[0088] "Oligonucleotide primer" or "primer" refers to an oligonucleotide sequence that has a homologous sequence on a target nucleic acid and serves as a starting point for nucleic acid synthesis. The length of a primer can vary, and its length is usually less than 50 nucleotides, for example, 12-30 nucleotides in length. The length and sequence of primers used for nucleic acid amplification (such as PCR or RPA) can be designed according to principles known to those skilled in the art.

[0089] The terms "nucleic acid" and "polynucleotide" are used interchangeably herein to refer to deoxyribonucleotides or ribonucleotides and polymers thereof in single- or double-stranded form. The term includes nucleic acids containing known nucleotide analogs or modified backbone residues or linkages that are synthetic, naturally occurring, and non-naturally occurring, that have similar binding properties as the reference nucleic acid, and that are metabolized in a manner similar to the reference nucleotide. Examples of such analogs include, but are not limited to, phosphorothioates, phosphoramidates, methylphosphonates, chiral methylphosphonates, 2-O-methyl ribonucleotides, and peptide nucleic acids (PNAs).

[0090] The terms "about" and "approximately equal to" are used herein to modify a numerical value and indicate a defined range around that value. If "X" is the value, then "about X" or "approximately equal to X" generally means a value from 0.90X to 1.10X. Any reference to "about X" means at least X, 0.90X, 0.91X, 0.91X, 0.92X, 0.93X, 0.94X, 0.94X, 0.95X, 0.96X, 0.96X, 0.97X, 0.98X, 1.09X, 0.99X, 1.02X, 0.03X, 1.04X, 1.04X, 1.05X, 1.06X, 1.07X, 1.08X, 1.09X, and 1.10X. Thus, "about X" is intended to disclose, for example, "0.98X". Thus, "from about 6 to 8.5" is equivalent to "from about 6 to about 8.5". When "about" is applied to the first value of a set of values, it applies to all values ​​in the set. Thus, "about 7, 9, or 11%" is equivalent to "about 7%, about 9%, or about 11%".

[0091] II. Introduction

[0092] The disclosed methods, compositions and kits are used to sensitively, accurately and efficiently amplify, enrich and / or detect target nucleic acids in samples, especially small amounts of target nucleic acids (e.g., less than 20%, 10%, 5%, 3%, 1%, 0.5% or 0.1% of the total nucleic acid in the sample), by digesting or degrading non-target nucleic acids in the sample before or during amplification, and optionally detecting the amplified target nucleic acids. Specifically, non-target nucleic acids in the sample are usually background nucleic acid molecules or wild-type nucleic acid molecules without target mutations at designated sites, which are recognized and cut by one or more proteins having nucleic acid cleavage activity at designated sites before or during amplification. As a result, only target nucleic acids with interesting mutations / mutations are amplified, while no or substantially no non-target nucleic acids are amplified. During the detection process, the interference of non-target nucleic acids will be minimized, and the sensitivity, accuracy and efficiency of the detection will be greatly improved. These methods, materials and kits are particularly suitable for convenient, sensitive and specific detection of rare targets (such as gene variations and mutations, cancer-related mutations, etc.) for early cancer diagnosis and precision medicine.

[0093] III. Methods

[0094] Provided is a method for alternately amplifying or enriching a target nucleic acid at a specific position in a sample before or during amplification, comprising digesting or degrading the non-target nucleic acid at a specified position in the sample by exposing the non-target nucleic acid to one or more proteins having a nucleic acid cleavage activity that specifically recognizes bases at the specific position.

[0095] Also provided is a method for detecting a target nucleic acid having a change at a specific position in a sample, comprising exposing a non-target nucleic acid to a nucleic acid having one or more nucleic acid activities that specifically recognize the specific position at the specific position in the sample, and detecting the amplified target nucleic acid.

[0096] In one or more embodiments, the target nucleic acid is amplified by adding protein(s) to the amplification mixture, exposing the nucleic acid to one or more proteins having nucleic acid cleavage activity. In certain embodiments, the amplification mixture is an isothermal nucleic acid amplification mixture.

[0097] In this article, "alternation" and "mutation" refer to different bases (s) at a specific site of the target nucleic acid and different bases of the non-target nucleic acid sequence, including deletion, substitution and insertion of one or more bases at a specific site (s). Therefore, the "non-target nucleic acid" in this article refers to any nucleic acid that does not require alternating digestion in order to improve the amplification efficiency of the target nucleic acid. In general, a non-target nucleic acid is a background nucleic acid molecule or a wild-type nucleic acid molecule without a target mutation at a specific site. Alternation may include the alternation of two or more consecutive bases compared to a non-target nucleic acid. In certain embodiments, alternation is a mutation of the target nucleic acid relative to the WT sequence. .Such alternative therapies may include alternative therapies known in the art, which can lead to diseases such as drug-induced deafness and congenital deafness, thereby leading to the severity of the disease or drug resistance, etc. , including HBV resistance mutations, tumor mutations, tumor or resistance mutations, tuberculosis resistance mutations, SARS-COV-2 mutations, FLT3-D835 mutations, etc. Examples of changes or mutations include those summarized in Table 1.

[0098] In the present disclosure, a protein having nucleic acid activity that specifically cleaves nucleic acid by recognizing a specified site non-alternatively digests a nucleic acid sequence at the specified site and leaves behind a variant (i.e., having a change of interest), thereby enriching the target nucleotide sequence with an alternate nucleotide sequence for further detection.

[0099] Examples of proteins having nucleic acid cleavage activity include restriction endonucleases, Cas enzymes, Ago enzymes, ZFN enzymes, TALEN enzymes, and functional complexes thereof.

[0100] The restriction endonuclease used in the present invention can be any restriction endonuclease known to technicians, including but not limited to BclI, BsaBI, AclWI, Bst4CI, XmiI, BlsI, PspFI, CviKI-1, CviJI, MscI, EcoP15I, BspACI, BseLI, BstKTI, PspN4I, BspLI, NlaIV, BmiI, MaiI, RsnAI, BspEI, HpaII, MroI, Kpn2I, BcoDI, BstDEI, Bpu10I, BtsIMutI, BasBI, BtsCI, NspI, FaiI, EcoRV and BtsaI.

[0101] As used herein, Ago enzymes include, but are not limited to, pfAgo, cbAgo, LrAgo, pfAgo-mut, ApoI, pfAgo, TtAgo, and MjAgo.

[0102] As used herein, Cas enzymes include, but are not limited to, Cas 9, Cas 12, Cas 13, and Cas 14, and particularly include, but are not limited to, SpCas9, SaCas9, HypaCas9, St1Cas9, spCas9-NG, LbCas12a, spCas9-mut, and ScCas9.

[0103] Functional complexes formed by Cas or Ago with their respective partners, such as Cas enzyme / sgRNA complexes, Ago / gDNA complexes, and Cas12a / crRNA complexes, can also be used as proteins with nucleic acid cleavage activity. Preferably, the Cas enzyme / sgRNA complex is a Cas9 / sgRNA complex, more preferably, a spCas9 / sgRNA complex. Preferably, the Ago / gDNA complex is a pfAgo / gDNA complex. Preferably, the Cas12a / crRNA complex is a LbCas12a / crRNA complex.

[0104] In the subject application, the terms sgRNA, gDNA and crRNA have generally recognized meanings in the field. In some embodiments, the protein with nucleic acid cleavage activity is a Cas enzyme, and the digestion or degradation step requires the gRNA (guide RNA) of the Cas enzyme / gRNA complex to be formed. In other words, the digestion or degradation step is based on the digestion of CRISPR. In these embodiments, the guide RNA has a targeting region that binds to a non-target sequence to guide the Cas enzyme to cleave the binding sequence. The guide RNA can be designed according to principles known to those skilled in the art. In a preferred embodiment, the guide RNA is designed to recognize the WTFLT3 D835 sequence (-GATATC-) and the Cas enzyme / gRNA complex digests the sequence.

[0105] The protein having the activity of cleaving nucleic acid can cleave nucleic acid at a designated site or other sites depending on the specific protein used. Therefore, in the non-target nucleic acid, the recognition site (i.e., the designated site) and the cleavage site can be the same or different.

[0106] Due to digestion by proteins with nucleolytic activity, non-target sequences are cleaved or degraded and their amplification is stopped prior to the cleavage site.

[0107] Amplification can adopt conventional amplification methods, including helicase dependent amplification (HAD), polymerase chain reaction (PCR), DNA ligase chain reaction (LCR), isothermal DNA amplification, QBeta RNA replicase, RNA transcription amplification reaction, loop-mediated isothermal amplification (LAMP), RT-LAMP, recombinase polymerase amplification (RPA), reverse transcription-recombinase polymerase amplification (RT-RPA), helicase dependent amplification (HDA), strand displacement amplification (SDA), nucleic acid sequence-based amplification (NASBA), transcription-mediated amplification (TMA), nickase amplification reaction (NEAR), rolling cycle amplification (RCA), multiple displacement amplification (MDA), break-apart (RAM), cyclic helicase dependent amplification (cHDA), single primer isothermal amplification (SPIA), signal-mediated RNA amplification (SMART), self-sustained sequence replication (3SR), genomic exponential amplification reaction (GEAR) and isothermal multiple displacement amplification (IMDA).

[0108] The polymerase used for amplification can be any known polymerase and can be selected according to a dedicated amplification method. Suitable DNA polymerases include, but are not limited to, DNA polymerases isolated or derived from Pyrococcus thermophilus, Pyrococcus hepaticus and Pyrococcus marineus, bacteriophage T4 or modified versions thereof.

[0109] In one or more preferred embodiments, recombinase polymerase amplification (RPA) is used in the methods of the subject applications. Specifically, RPA is performed in the presence of a protein(s) having nucleic acid cleavage activity. Thus, cleavage of non-target sequences and amplification of target sequences are performed sequentially or simultaneously, preferably in the same reaction system. Therefore, in a preferred embodiment, an improved RPA method is provided, which includes a target nucleic acid that is digested or degraded before or during amplification.

[0110] The primers used in amplification can be designed according to the sequence of the target nucleotide molecule or fragment. This is well known in the art. Generally speaking, the two primers of a primer pair are located on both sides (i.e., downstream and upstream) of the cleaved site in the non-target nucleic acid. The cleaved sequence (such as the wild-type sequence) cannot be amplified by the primer pair.

[0111] To detect the target nucleic acid, any suitable detection technique can be used, such as DNA staining, nucleic acid amplification, spectrophotometry, sequencing, fluorescent probe hybridization, fluorescence resonance energy transfer, optical microscopy, electron microscopy, CRISPR-based detection, visual detection, sensor-based detection, color detection, color detection, gold nanoparticle-based detection, electrochemical detection, semiconductor-based sensing, or a combination thereof. The sequencing result can be FGS or NGS. Nucleic acid amplification can be qPCR.

[0112] In one or more embodiments, one or more proteins (s) capable of recognizing a specific nucleic acid sequence or a functional complex thereof are used to detect the target nucleic acid. The specific nucleic acid sequence generally includes a mutation site.

[0113] Protein(s) capable of recognizing a specific nucleic acid sequence, i.e., a protein(s) for detection, includes but is not limited to Cas enzymes, Ago enzymes, ZFN enzymes, TALEN enzymes, and functional complexes thereof. In some embodiments, the detection is based on a CRISPR-based detection of any known Cas protein.

[0114] As used herein, Cas enzymes include, but are not limited to, Cas 9, Cas 12, Cas 13, and Cas 14, and particularly include, but are not limited to, SpCas9, SaCas9, HypaCas9, St1Cas9, spCas9-NG, LbCas12a, spCas9-mut, and ScCas9.

[0115] As used herein, Ago enzymes include, but are not limited to, pfAgo, cbAgo, LrAgo, pfAgo-mut, ApoI, pfAgo, TtAgo, and MjAgo.

[0116] Functional complexes formed by Cas or Ago with their respective partners, such as Cas enzyme / sgRNA complexes, Ago / gDNA complexes, and Cas12a / crRNA complexes, can also be used as protein detection proteins. Preferably, the Cas enzyme / sgRNA complex is a Cas9 / sgRNA complex, more preferably, a spCas9 / sgRNA complex. Preferably, the Ago / gDNA complex is a pfAgo / gDNA complex. Preferably, the Cas12a / crRNA complex is a LbCas12a / crRNA complex.

[0117] In some embodiments, proteins capable of recognizing specific nucleic acid sequences include but are not limited to LbCas12a, FnCas12a, Lb5Cas12a, HkCas12a, TsCas12a, BbCas12a, BoCas12a, Lb4Cas12a, LbuCas13a, LwaCas13a, LbaCas13a, PprCas13a, HheCas13a, EreCas13a, AsCas12a, TsCas12a, BbCas12a, BoCas12a, Lb4Cas12a, spCas9, pfAgo, cbAgo, LrAgo, Cas12b, Cas12a-mut, Cas12b-mut, AapCas12b, BrCas12b, CcaCas13b, PsmCas13b and AacCas12b or a functional complex thereof.

[0118] The cleavage of non-target sequences, the amplification of target sequences and the detection of target sequences can be performed sequentially or simultaneously, preferably in the same reaction system.

[0119] The methods disclosed herein can be used to detect clinically actionable information about a patient or tumor, to detect and characterize mutations and / or alterations in DNA of blood cancer cells that also contain large amounts of "normal," somatic cell DNA in a blood or plasma sample, to monitor cancer remission, to inform treatments, such as dosing regimens or immunotherapy, to detect fetal DNA to detect, for example, characteristic mutations of an inherited genetic disease, to detect and characterize mutations and / or alterations in circulating tumor DNA that also contains large amounts of "normal," somatic cell DNA in a blood or plasma sample. The DNA may include circulating tumor DNA in a patient's blood or plasma, or fetal DNA in a mother's blood or plasma.

[0120] The term "hematological cancer" refers to a group of malignant diseases arising from myeloid cells or lymphoid tissue cells, including but not limited to leukemias, lymphomas and myelomas, such as acute lymphoblastic leukemia (ALL).

[0121] The method disclosed herein may include detecting or separating blood cancer cells from a blood sample. The method disclosed herein may include detecting or separating lymphocytes (e.g., PBMC, WBC) from a blood sample of a subject suffering from blood cancer. For example, in order to separate WBCs, the red blood cells in a peripheral blood or bone marrow blood sample are lysed, and only the unlysed WBCs are separated from the lysed red blood cells by a centrifuge. Genomic DNA can be extracted by a nucleic acid release agent (e.g., GenDx Biotechnology Company, Suzhou, China).

[0122] The methods of the present disclosure may include detecting or isolating circulating tumor cells (CTCc) from a blood sample. The methods of the present invention may employ an enrichment step to optimize the probability of rare cell detection that may be achieved by immunomagnetic separation, centrifugation or filtration.

[0123] The methods disclosed herein can be used to detect target RNA, which may include reverse transcription from RNA to DNA. Such methods also include isolating RNA from a sample (such as a virus). Methods for RNA isolation and / or RNA reverse transcription are well known.

[0124] When a genomic alteration is thus detected, a report can be provided, for example, describing the alteration in a patient.

[0125] Knowledge of the mutational landscape of a tumor can be used to inform treatment decisions, monitor treatment, detect responses, or a combination thereof. For example, if the report includes a description of multiple mutations, the report may also include an estimate of the tumor mutational burden (TMB) of a tumor. It can be found that TMB can predict the success of treating a tumor with immunotherapy, and thus the methods described herein can be used to treat tumors.

[0126] Examples of target nucleic acids and their respective mutations are listed in No. 1-85, as shown in Table 1. For each target nucleic acid, proteins for cutting and detection for amplification or enrichment, and if necessary, proteins for detection are also listed. It should be understood that the cleavage protein, amplification method and detection protein for each target nucleic acid are not the only cleavage protein, amplification method and detection protein. These technicians can easily determine the protein suitable for cutting, the appropriate amplification method and / or the appropriate protein for detecting each target nucleic acid based on the present invention and the prior art.

[0127] Table 1

[0128]

[0129]

[0130]

[0131]

[0132] IV. Kit

[0133] Also provided is a kit for amplifying or enriching and selectively detecting alternate target nucleic acids at a specific location in a sample, comprising reagents for amplifying alternate target nucleic acids at a specified location in a sample, and reagents for digesting non-target nucleic acids at a specified location in a sample.

[0134] The reagent(s) used to alternately amplify the target nucleic acid at a specified location in the sample can be any one or more reagents used in any known amplification method, including but not limited to helicase-dependent amplification (HAD), polymerase chain reaction (PCR), DNA ligase chain reaction (LCR), isothermal DNA amplification, QBeta RNA replicase, RNA transcription amplification reaction, loop-mediated isothermal amplification (LAMP), RT-LAMP, recombinase polymerase amplification (RPA), reverse transcription-recombinase polymerase amplification (RT-RPA), helicase-dependent amplification (HDA), strand displacement amplification (SDA), nucleic acid sequence amplification (NASBA), transcription-mediated amplification (TMA), nickase amplification reaction (NEAR), rolling circle amplification (RCA), multiple displacement amplification (MDA), branching (RAM), circular helicase-dependent amplification (cHDA), single primer isothermal amplification (SPIA), signal-mediated RNA amplification (SMART), self-sustained sequence replication (3SR), genomic exponential amplification reaction (GEAR) and isothermal multiple displacement amplification (IMDA).

[0135] In some preferred embodiments, the reagents for amplification include one or more reagents for PCR or isothermal amplification reactions.

[0136] Examples of reagents (s) for amplification include one or more reaction buffers, polymerases (thermostable polymerases or isothermal polymerases), primers, dNTPs, activators, ddH2O, or single-stranded DNA binding (SSB). The buffer may include one or more buffer components and salts. In some embodiments, the buffer component is Tris-HCl. In some embodiments, the salt is potassium chloride and MgCl2. The isothermal amplification system includes the GenDx ERA kit sold by GenDx Biotechnology, Suzhou, China. As described herein, the two primers of the primer pair are located on each side (i.e., downstream and upstream) of the cleaved site in the non-target nucleic acid. Therefore, the cut sequence (such as the wild-type sequence) cannot be amplified by the primer pair. The polymerase can be any known polymerase and can be selected according to the amplification method specifically used. Suitable DNA polymerases include, but are not limited to, DNA polymerases isolated or derived from Pyrococcus thermophilus, Pyrococcus hepaticus and Pyrococcus marineus, bacteriophage T4 or modified versions thereof.

[0137] In some preferred embodiments, the reagents for amplification include reagents for RPA.

[0138] The reagent(s) for non-alternative digestion of non-target nucleic acids at a specified location in a sample include proteins having nucleic acid cleavage activity as described herein.

[0139] Examples of proteins having nucleic acid cleavage activity include restriction endonucleases, Cas enzymes, Ago enzymes, ZFN enzymes, TALEN enzymes, and functional complexes thereof.

[0140] The restriction endonuclease used in the present invention can be any restriction endonuclease known to the skilled person, including but not limited to BclI, BsaBI, AclWI, Bst4CI, XmiI, BlsI, PspFI, CviKI-1, CviJI, MscI, EcoP15I, BspACI, BseLI, BstKTI, PspN4I, BspLI, NlaIV, BmiI, MaiI, RsnAI, BspEI, HpaII, MroI, Kpn2I, BcoDI, BstDEI, Bpu10I, BtsIMutI, BasBI, BtsCI, NspI, FaiI, EcoRV and BtsaI.

[0141] Ago enzymes include, but are not limited to, pfAgo, cbAgo, LrAgo, pfAgo-mut, ApoI, pfAgo, TtAgo, and MjAgo.

[0142] Cas enzymes include but are not limited to Cas 9, Cas 12, Cas 13 and Cas 14, and particularly include but are not limited to SpCas9, SaCas9, HypaCas9, St1Cas9, spCas9-NG, LbCas12a, spCas9-mut and ScCas9.

[0143] Functional complexes formed by Cas or Ago with their respective partners, such as Cas enzyme / sgRNA complexes, Ago / gDNA complexes, and Cas12a / crRNA complexes, can also be used as proteins with nucleic acid cleavage activity. Preferably, the Cas enzyme / sgRNA complex is a Cas9 / sgRNA complex, more preferably, a spCas9 / sgRNA complex. Preferably, the Ago / gDNA complex is a pfAgo / gDNA complex. Preferably, the Cas12a / crRNA complex is a LbCas12a / crRNA complex.

[0144] The kit may also include reagents for detecting target nucleic acids. The reagents for detecting target nucleic acids include one or more reagents for DNA staining, nucleic acid amplification, spectrophotometry, sequencing, fluorescent probe hybridization, fluorescence resonance energy transfer, optical microscopy, electron microscopy, CRISPR-based detection, or a combination thereof.

[0145] In one or more embodiments, the reagent for detecting the target nucleic acid includes one or more proteins, or a functional complex thereof, capable of recognizing a specific nucleic acid sequence.

[0146] Proteins (s) capable of recognizing specific nucleic acid sequences, i.e., proteins (s) for detection, include but are not limited to Cas enzymes, Ago enzymes, ZFN enzymes, TALEN enzymes and functional complexes thereof. In some embodiments, the detection is based on CRISPR-based detection of any known Cas protein.

[0147] Cas enzymes include but are not limited to Cas 9, Cas 12, Cas 13 and Cas 14, and particularly include but are not limited to SpCas9, SaCas9, HypaCas9, St1Cas9, spCas9-NG, LbCas12a, spCas9-mut and ScCas9.

[0148] Ago enzymes include, but are not limited to, pfAgo, cbAgo, LrAgo, pfAgo-mut, ApoI, pfAgo, TtAgo, and MjAgo.

[0149] Functional complexes formed by Cas or Ago with their respective partners, such as Cas enzyme / sgRNA complexes, Ago / gDNA complexes, and Cas12a / crRNA complexes, can also be used as protein detection proteins. Preferably, the Cas enzyme / sgRNA complex is a Cas9 / sgRNA complex, more preferably, a spCas9 / sgRNA complex. Preferably, the Ago / gDNA complex is a pfAgo / gDNA complex. Preferably, the Cas12a / crRNA complex is a LbCas12a / crRNA complex.

[0150] In some embodiments, proteins capable of recognizing specific nucleic acid sequences include but are not limited to LbCas12a, FnCas12a, LbCas12a, HbCas12a, Lb4Cas12a, L12a, AsCas12a12a, Lb4Cas12a, BrCa, Cas12a, Cas12b, Cas12b, or a functional complex thereof.

[0151] Preferably, the kit comprises a mixture of reagents for RPA and reagents for digesting non-target sequences, in particular proteins having nucleic acid cleavage activity. In certain embodiments, the mixture further comprises reagents for fragment detection.

[0152] Most preferably, the kit comprises any of the cleavage proteins listed in any of the ID Nos. in Table A and the amplification method listed in the same ID No. for amplifying or enriching the target of the same ID No. In some other embodiments, the kit further comprises a protein for detection listed in the same ID No. for detecting the target of the same ID No. in Table A

[0153]

[0154]

[0155]

[0156] For example, a kit comprising a protein for cutting and a reagent for the amplification method listed in ID No. 1 may include spCas9 and a reagent (s) for performing RT-RPA, and for amplifying or enriching a 12S rRNA fragment containing 1494C>T. The kit may also include a protein for detection, i.e., LbCas12a for detecting the fragment.

[0157] The kit may also include instructions or other materials, such as a preformatted report shell for receiving information from the method for providing the report. The reagents, instructions, and any other useful materials may be packaged in a suitable container. The disclosed kit may be ordered. For example, a researcher may use, for example, an online tool to design guide RNAs and reagents for the performance of the present research method. The guide RNA may be synthesized using a suitable synthesis instrument. The synthesis instrument may be used to synthesize oligonucleotides, such as gRNAs or single guide RNAs (sgRNAs). Any suitable instrument or chemical reagent may be used to synthesize gRNA. The synthesized reagents (e.g., guide RNAs and endonucleases) may be packaged in a container and shipped as a kit.

[0158] In the present disclosure, restriction digestion is included in the amplification (e.g., recombinase polymerase amplification (RPA)) step, destroying nucleic acids without changes or certain changes (such as wild-type sequences), thereby potentially improving detection sensitivity. Using the FLT3 D835 mutation as a model, the method was optimized by crRNAs and RPA primer screening and compared with conventional methods (FGS, NGS, qPCR) on a series of plasmid templates and 112 clinical samples. The sensitivity of this method for detecting the FLT3 D835 mutation was 0.001%, the highest level achieved among all mutation detection methods. The entire workflow (from sample preparation to data output) only takes one hour and requires only simple instruments and operations. Similar detection sensitivity and accuracy were obtained for all other cancer mutations, such as IDH2 R172K, EGFR L858R and e19del, and NRAS G12D, indicating that this method is invaluable for immediate cancer diagnosis and precision medicine.

[0159] The present invention also provides a reagent or a kit for specifically recognizing a specific part of a non-target nucleic acid using one or more proteins having nucleic acid cleavage activity, or a reagent or a kit for amplifying or enriching a specific part compared with a target nucleic acid. Preferably, in addition to the protein(s), the reagent or kit may also include a reagent for amplifying the target nucleic acid, such as a primer, a buffer, etc. The amplifier may be any amplifier disclosed herein.

[0160] Also provided are reagents or kits for detecting a target nucleic acid of interest and a target nucleic acid using one or more proteins that cleave a non-target nucleic acid specifically to recognize a base at a specific position of the nucleic acid. Preferably, in addition to the protein(s), the reagent or kit may also include reagents for amplifying the target nucleic acid, such as primers, buffers, etc., and / or reagents for detecting the amplified target nucleic acid. The amplification may be any of the amplifications disclosed herein, and the detection may be any of the detections disclosed herein.

[0161] Example

[0162] The following examples are provided to better enable one of ordinary skill in the art to make and use the disclosed compositions and methods, and are not intended to limit the scope of the disclosure in any way.

[0163] method

[0164] Sample processing

[0165] A total of 112 AML patient samples were collected from the Department of Hematology, Zhongnan Hospital of Wuhan University, according to a protocol approved by the Institutional Review Board. To extract genomic DNA, 200–500 μl of peripheral or bone marrow blood samples were mixed with an erythrocyte lysis reagent (Biosharp, Hefei, China) by inversion four times. Then, lysed erythrocytes and unlysed WBCs were separated by a microcentrifuge for 1 min. Finally, the precipitated WBCs were separated by a 100 μl nucleic acid releaser (Suzhou GenDx Biotechnology Co., Ltd., China) at 95 °C for 3 min to release genomic DNA. Two microliters of the processed sample were used for subsequent detection.

[0166] Plasmid construction

[0167] A 675 bp DNA fragment covering the WT FLT3-D835 site was amplified from the genomic DNA of a wild-type patient using primers P1 and P2, and then fused and cloned into a pGem-T vector (Takara, China). The recombinant plasmid was then transformed into Escherichia coli DH5α, extracted using a deoxyprep plasmid miniprep kit (Axygen, CA, USA), and quantified using Nanodrop2000 (Thermo Fisher Scientific, MA, USA). To construct the FLT3-D835Y / H / V / F plasmid, the wild-type Tvec-FLT3-D835 plasmid was amplified using primers P3 and P4 carrying the D835Y mutation, primers P5 and P6 carrying the D835H mutation, primers P7 and P8 carrying the D835V mutation, and primers P9 and P10 carrying the D835F mutation. The amplified fragments were then fused and cloned into a pGem-T vector (Takara, China). In crRNA screening, primers P11 and P12 were used to amplify a 351bp DNA fragment containing the D835 region from the above recombinant plasmid, and then purified and quantified as described above. The plasmid templates of IDH2-R172K, EGFR-L858R, NRAS-G12D and their WT types were constructed in the same way. The plasmid template of EGFR-e19del (E746-A750 deletion) was directly synthesized by GenScript (Nanjing, China). The nucleotide sequences of all primers are shown in Table 2.

[0168] Table 2. PCR and RPA primer sequences

[0169]

[0170]

[0171] *The mutated bases are in bold. The underlined base T in primer P31 is an introduced mutation that creates a TTTG PAM for detection of IDH2-R172K. The underlined base C in primer P33 is an introduced mutation that disrupts an unwanted SaqAI restriction site near the target EGFR-e19del site.

[0172] CRISPR Response System

[0173] The Cas12a-based assay was modified from the previous description (Wang X et al. Commun Biol 3, 62 (2020). [PubMed: 32047240]). In short, crRNA was designed according to the target sequence and synthesized by GenScript (Nanjing, China). The nucleotide sequences of all crRNAs are listed in Table 3. The expression and purification methods of Cas12a protein are as described above (Creutzburg SCA et al. Nucleic Acids Res 48, 3228-3243 (2020). [PubMed: 31989168]). The 20 μl reaction system included Cas12a (200 ng / μl, 1 μl), crRNA (10 nM, 1 μl), 10×NEBuffer3.1 (2 μl, NEB, MA, USA), ribonuclease inhibitor (1 μl, Novoprotein, China), ssDNA-FQ reporter (25 μM, 1 μl, Genewiz, NJ, USA), appropriate amount of PCR product or 5 μl RPA product test, and supplemented with ddH2O. After thorough mixing on a vortex shaker, incubate at 37 ° C for 20 min, and then observe the green fluorescence signal under a 485 nm blue light (Sangon, Shanghai, China). Fluorescence kinetics monitoring uses a monochromator with an excitation light of 485 nm and an emission light of 520 nm.

[0174] Table 3. crRNA sequences

[0175]

[0176]

[0177] *The target sequence is underlined, the mutated bases are in bold, and the introduced mismatches are in italics.

[0178] Recombinase polymerase amplification reaction

[0179] The plasmid or patient genomic DNA was isothermally amplified using the GenDx ERA kit (Suzhou GenDx Biotech, China). For CRISPR detection, the 50 μl RPA reaction system included 20 μl reaction buffer, 11 μl ERA basic buffer, 2.5 μl forward primer (10 nM), 2.5 μl reverse primer (10 nM), 2 μl DNA template, 2 μl activator, and supplemented with ddH2O. For the method disclosed herein, an additional 2 μl restriction endonuclease was mixed into the above RPA system. Fastcut-EcoRV, FastDigest-BseLI, FastDigest-SaqAI, FastDigest-MscI, and FastDigest-BveI were used to detect FLT3-D835Y, IDH2-R172K, EGFR-e19del, EGFR-L858R, and NRAS-G12D, respectively. Then, the mixture was incubated at 37 ° C for 20 min. After RPA, 5 μl of the amplified product was transferred to the crRNA-guided Cas12a reaction. The primers for RPA are shown in Table 2.

[0180] First-generation sequencing and next-generation sequencing

[0181] For FGS, 25 μl of PCR product or 25 μl of RPA product was purified using the AxyPrep PCR Cleanup Kit (Axygen, CA, USA) and quantified using Nanodrop2000 (Thermo Fisher Scientific, MA, USA). For each sample, approximately 300 ng of amplified DNA fragments were sequenced by Qingke Bio. NGS used different barcode primers to amplify the FLT3-D835 region of different samples. PCR products were purified by the NextSeq500 (2×150) platform of the CAS-MPG Computational Biology Omics Core Collaborative Institute in Shanghai, China and evenly mixed in NGS. The primers for NGS are shown in Table 4. Table 4. Next-generation sequencing primer sequences

[0182]

[0183]

[0184] TaqMan qPCR

[0185] TaqMan qPCR probes and primers were designed and synthesized by Qingke. The probes were complementary sequences to the FLT3-D835Y template and combined with 5' reporter dyes FAM and 3' MGB. The 20 μl qPCR system included 2× Taq Pro HS Universal Probe Master Mix (10 μl, Vazyme, Nanjing, China), qPCR-F (10 μM × 0.4 μl), qPCR-R (10 μM × 0.4 μl), TaqMan probes (10 μM × 0.2 μl), template DNA (1 μl), and ddH2O (8 μl). The PCR cycling conditions were 95 °C for 30 s, 95 °C for 45 cycles for 10 s, and 60 °C for 30 s. The qPCR primer and probe sequences are shown in Table S4. Commercial kits were used for qPCR detection of EGFR-e19del, EGFR-L858R, and NRAS-G12D mutations.

[0186] Statistical analysis

[0187] All experiments were repeated three times. Statistical analysis was performed using GraphPad Prism 8.0. Unpaired two-tailed Student's t-test was used for comparison between the two groups. Quantitative data are presented as mean ± standard error. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001; ns, not significant.

[0188] Example 1: Verification by detecting drug-resistant FLT3-D835 mutations

[0189] As a proof of concept, we used our method to detect drug-resistant FLT3-D835 mutations in acute myeloid leukemia (AML), which contained 4 major mutations according to the cBioportal database: 45% D835Y (c.2503G>T); 22% D835H (c.2503G>C); 14% D835V (c.2504A>T) and less than 1% D835F (c.2503GA>TT) ( Figure 1 b). EcoRV restriction enzyme can recognize and digest the WT D835 sequence (-GATATC-), while ignoring the D835 mutant sequence. We first tested the activity and specificity of EcoRV restriction enzyme digestion using 100% WT and 100% D835Y / H / V / FPCR fragments in its special buffer. As expected, the WT D835 fragment was completely degraded, while the D835Y / H / V / F fragment was resistant ( Figure 1 c).

[0190] Next, to test the feasibility of EcoRV in RPA reactions, 5e10 copies of 100% WT and 100% D835Y / H / V / F PCR fragments were treated in a primer-free RPA mixture at 37°C for 20 minutes and detected by Cas12a reaction. EcoRV digestion eliminated the fluorescent signal of the WT D835 fragment ( Figure 1 de), while the fluorescence signal of the D835Y / H / V / F fragment was slightly enhanced for unknown reasons ( Figure 1 de), indicating that EcoRV did not affect RPA and could improve the sensitivity of detecting the rare D835Y / H / V / F mutation.

[0191] Example 2: Optimizing crRNA to enhance specificity

[0192] The specificity of crRNA in the Cas12a reaction determines the accuracy of CRISPR detection. In order to screen the best crRNA for detecting FLT3-D835Y, we designed 4 crRNAs (Table 3), among which FLT3-D835Y-crRNA1 completely matched the mutant sequence, while FLT3-D835Y-crRNA2-4 had various mismatches ( Figure 2 a). We compared the sensitivity and specificity of these four crRNAa for detecting D835Y in PCR fragments containing both D835Y and WT alleles (1e10 copies) with the mutant accounting for 100%, 50%, 10%, and 0% of the total DNA, respectively ( Figure 2 b). After Cas12a reaction for 30 minutes, the four crRNAs, especially crRNA1 and crRNA2, can detect 100% of the D835Y sample, and crRNA1 and crRNA2 can also produce strong signals ( Figure 2 bc, Figure 7 ). In addition, for crRNA2, when detecting 100% D835Y samples, extending the incubation time (to 60min) resulted in stronger fluorescence, but the WT allele (in 100% WT samples) remained undetectable. Therefore, crRNA2 has good sensitivity and specificity and seems to be the best crRNA for D835Y detection ( Figure 2 d, Figure 8 The optimal crRNA for D835H / V / F was also determined ( Figure 2 d, Figure 9-11 We also identified crRNAs in WT and internal control (IC) cases ( Figure 12-13 ).

[0193] To simplify the diagnosis of the four drug-resistant FLT3-D835 mutations, we combined D835Y / H / V / F crRNAs (MMT-crRNAs) and the four mutant templates into one reaction and found that it produced a strong fluorescent signal ( Figure 2 e), while the WT sample showed no signal, which was consistent with expectations ( Fig.14 ).

[0194] Example 3: Optimizing RPA primers to improve sensitivity

[0195] Next, we attempted to improve the sensitivity of the method by optimizing the RPA amplification efficiency. To this end, we designed three forward (RPA-F1-3) and reverse (RPA-R1-3) primers (Table 2) ( Figure 2 f, Fig.15 ) and tested on the D835Y plasmid template in a standard RPA reaction (20 minutes at 37°C). The amplified products were then detected using the MMT-crRNAs-induced Cas12a reaction, indicating that the F2R1 combination produced the strongest signal ( Figure 2 g, Fig.16 ). Further analysis showed that using F2R1, only in the Cas12a reaction ( Figure 2 min) before 10 plasmid templates ( Figure 2 h, Fig.17 ). Therefore, in subsequent experiments, we selected F2 and R1 as the primer pair for RPA and selected 20 min as the reaction time for Cas12a.

[0196] Example 4: The sensitivity of FLT3-D835Y detection is 0.001%

[0197] We determined the detection limit of the FLT3-D835Y method using optimized gRNA and primers. We first quantified the effect of EcoRV on the WT sequence and found that EcoRV could almost completely inhibit the amplification of up to 1e6 copies ( Fig.18 ), but retained the mutant target as expected ( Fig.19 ). We then mixed mutant and WT templates at different ratios, with FLT3-D835Y consisting of 100%, 50%, 25%, 10%, 1%, 0.1%, 0.01%, and 0.001% of the total template, and found a detection limit of 0.001% using an input method of 1e6 template. In contrast, in the absence of EcoRV, the detection limit was reduced by 1000-fold (1%) ( Figure 3 ab). WT has an inhibitory effect on the Cas12a response induced by WT-crRNA ( Figure 3cd). Finally, FGS directly demonstrated that EcoRV significantly enriched the mutant allele in the RPA mixture, from 10%, 1% and 0.1% to 100%, 98% and 51%, respectively (3e-f).

[0198] Example 5: FLT3-D835Y detection method is superior to qPCR-based detection method

[0199] Next, we compared our method with commonly used qPCR-based detection methods. We designed two D835Y-specific TaqMan probes and a pair of qPCR primers (Table 5) for FLT3-D835Y detection ( Fig. 20 ), and then the above samples were used to detect the two probes. The results showed that the amplification curves of different samples were mainly different in D835Y probe 1, while the qPCR involved in D835Y probe 2 was not different, indicating that probe 1 had a higher specificity. Therefore, we selected probe 1 for D835Y qPCR detection ( Figure 21-22 ). The results of probe 1 showed that the amplification curves of the 100%, 50%, 25%, and 10% mutant samples gradually shifted to the right, consistent with the reduction in the amount of D835Y template. The amplification curves of the 1%, 0.1%, and 0.01% mutant samples were indistinguishable from the amplification curve of the WT sample ( Figure 3 g). Comparison of their Ct values ​​also showed that d835y-probe 1-involved qPCR could not distinguish between 1% mutant samples and WT samples, indicating that its sensitivity was only between 1% and 10% ( Figure 3 h). In summary, this method is more sensitive than TaqMan qPCR in detecting FLT3-D835Y mutation.

[0200] Table 5. Primers and probes for Taqman qPCR

[0201] name Sequence (SEQ ID No.: 90-93) 835-qPCR-F cgggaaagtggtgaagatatgtg 835-qPCR-R ctgacaacatagttggaatcactcatg D835Y probe 1 FAM-ctcgaGatatcatgagtg-MGB D835Y probe 2 FAM-ttggattggctcgaGatat-MGB

[0202] *The base of the D835Y mutation is in bold.

[0203] Example 6: This method accurately detects FLT3-D835Y / V / H / F mutations in clinical samples

[0204] After plasmid template detection, frozen cell samples from AML patients were used for D835Y / V / H / F mutation detection. Briefly, the genomic DNA of the patient's cells was released by a nucleic acid release agent and then treated with this method. Finally, the results were observed by naked eyes under blue light ( Figure 4a). The FLT3 gene mutation status of these samples was previously analyzed using NGS, among which P6, P12, P17, P27, and P31 carried the drug-resistant D835Y / V / H / F mutation, with mutation rates of 6.7% (Y), 17.2% (Y), 3.4% (V), 1.2% (Y), and 10.9% (H and Y), respectively ( Figure 4 b, Fig.23 ). We then applied our method and FGS to detect mutations in these 32 AML cell samples. The results showed that our method successfully identified 5 mutation samples, but FGS only identified 2 samples with higher mutation rates, P12 with 17.2% and P31 with 10.9% ( Figure 4 c, Fig.23 ). Therefore, our method is applicable to clinical samples.

[0205] Example 7: This method achieves clinical diagnosis within one hour

[0206] Considering that clinical detection of drug-resistant mutations by NGS is time-consuming, our aim was to further simplify the entire diagnostic process for FLT3-D835 drug-resistant mutations. To this end, we developed a white blood cell (WBC) enrichment method for fresh peripheral blood (FLB / c) from AML patients. Fig.24 ). Briefly, 200-500 μl of blood is incubated with 4 times the volume of red blood cell (RBC) lysis buffer for 1 minute to eliminate nucleus-free red blood cells, and centrifuged for 1 minute to obtain WBC precipitate. Then, the genomic DNA of these WBCs is released using a simple nucleic acid releaser and tested by our above-mentioned method. From the time of blood drawing, the diagnostic results can be completed within 45 minutes, and then mutation-sensitive drugs can be delivered to relevant patients to avoid ineffective FLT3 inhibitor treatment. In this way, the entire process from blood drawing to treatment decision making can be completed within 1 hour ( Figure 5 a). More importantly, our method is simple and economical, requiring only a small centrifuge, a 20 μl pipette and tip, a thermostat, and a blue light lamp with a wavelength of 485 nm ( Figure 5 b).

[0207] Example 8: This method is superior to FGS in the analysis of clinical samples

[0208] Next, we benchmarked our method against the commonly used FGS for detecting FLT3-D835 mutations in 80 AML patients with unknown FLT3-D835 mutation status (P33-P112), using samples analyzed by NGS as the gold standard. Our method detected D835Y in P38, P59, P71, P80, P83, and P106, but not in FGS ( Figure 5 c, Fig.25). NGS confirmed that all six samples had the D835Y mutation (4.5%, 2.7%, 4.1%, 3.5%, 1.2%, and 2.4%, respectively). Notably, NGS showed that P86 carried a 10.9% non-resistant D835E (GAT>GAA) mutation. Since this mutation did not generate a signal in our method, the data confirmed the high specificity of the method ( Figure 5 c). Statistical analysis of 80 patients showed that the sensitivity of this method was much higher than that of FGS (100% vs. 0%) ( Figure 5 d).

[0209] Example 9: This method is applicable to other cancer mutations

[0210] To verify the versatility of our method, we applied it to mutations in 4 other genes (IDH2, EGFR, and NRAS). IDH2 R172K is a hotspot mutation in glioma and leukemia with prognostic and therapeutic value. EGFRe19del and L858R are two major mutations that are sensitive to EGFR-TKIs and have great therapeutic value for lung cancer patients. Meanwhile, NRAS G12D is a driver mutation in leukemia and colorectal cancer. All four mutations are important clinical detection items. We first compared this method with the CRISPR detection method to detect 1e5 plasmid template copies with a mutation rate of 1% or 0.1%. The results showed that the WT fluorescence signal was strong in the CRISPR detection, while the signals of the four mutations were all weak. However, the WT signal of this method was almost invisible, while the mutation signal was significantly increased ( Figure 6 a). The FGS results of the amplified products also confirmed that this method has a good mutation enrichment effect. Specifically, after restriction endonuclease integration RPA, the mutation rates of IDH2-R172K, EGFR-e19del, EGFR-L858R, and NRAS-G12D were 1%, 99%, 100%, 98%, and 98%, respectively ( Fig.26 ). Further analysis showed that the MT / WT fluorescence ratio of this method was hundreds of times higher than that of the CRISPR detection method ( Figure 6 b).

[0211] Example 10

[0212] We also used a commercial kit based on fluorescence qPCR to detect EGFR-e19del, EGFR-L858R, and NRAS-G12D mutations. The samples tested were 1e5 copies of the plasmid template, and the mutation rates were 10%, 1%, 0.1%, and 0% (WT), respectively. The results of the three sites all showed that the amplification curves of different samples gradually shifted to the right, consistent with the decrease in mutation rate. However, we noticed a strong fluorescence signal in the WT sample ( Figure 6ce). In our assay, the WT signal was completely suppressed by restriction digestion and mutation-specific crRNA. Therefore, this method is a general and reliable method for detecting cancer gene mutations, especially rare mutation rates.

[0213] Merge by reference

[0214] References and citations to other documents, such as patents, patent applications, patent publications, journals, books, papers, web content, etc. All such documents are hereby incorporated in their entirety into this Agreement.

[0215] Equivalent

[0216] The disclosure may be embodied in other specific forms without departing from its spirit or essential characteristics. The above embodiments are therefore intended in all respects to be illustrative rather than limiting of the disclosure described herein. The scope of the disclosure is therefore indicated by the appended claims rather than the foregoing description, and all changes coming within the meaning and range of the claims are therefore intended to be embraced therein.

Claims

1. A method for amplifying or enriching a target nucleic acid at a specific location in a sample with a specific alternation, comprising digesting or degrading the non-target nucleic acid by exposing the non-target nucleic acid to a protein having nucleic acid cleavage activity; wherein, The alternation of the target nucleic acid includes deletion, substitution and / or insertion of one or more base(s) at a specific site compared to the sequence of the non-target nucleic acid.

2. A method for detecting a target nucleic acid of interest at a specific location in a sample, comprising exposing a non-target nucleic acid to a non-target nucleic acid having nucleic acid activity at a specific location at a specified location in the sample, and detecting the amplified target nucleic acid; wherein, The alternation of the target nucleic acid includes deletion, substitution and / or insertion of one or more bases at the specific site compared to the sequence of the non-target nucleic acid.

3. According to the method of claim 1 or 2, the protein having nucleic acid cleavage activity is selected from restriction endonucleases, Cas enzymes, proenzymes, ZFN enzymes, story enzymes and functional complexes thereof, such as Cas enzyme / sgRNA complexes, Ago / gDNA complexes or Cas12a / crRNA.

4. The method according to claim 3, wherein: Restriction enzymes were selected from BclI, BsaBI, AclWI, Bst4CI, XmiI, BlsI, PspFI, CviKI-1, CviJI, MscI, EcoP15I, BspACI, BseLI, BstKTI, PspN4I, BspLI, NlaIV, BmiI, MaiI, RsnAI, BspEI, HpaII, MroI, Kpn2I, BcoDI, BstDEI, Bpu10I, BtsIMutI, BasBI, BtsCI, NspI, FaiI, EcoRV and BtsaI; The Cas enzyme is selected from the group consisting of Cas 9, Cas 12, Cas 13, and Cas 14, in particular SpCas9, SaCas9, HypaCas9, St1Cas9, spCas9-NG, LbCas12a, spCas9-mut, and ScCas9; The Ago enzyme is selected from a group of enzymes including pfAgo, cbAgo, LrAgo, pfAgo-mut, ApoI, pfAgo, TtAgo and MjAgo.

5. The method of claim 1, wherein exposing the non-target nucleic acid to one or more proteins having nucleic acid cleaving activity is achieved by adding the non-target nucleic acid to an amplification mixture to amplify the target nucleic acid.

6. The method of claim 1, wherein the amplification is selected from the group consisting of helicase-dependent amplification (HAD), polymerase chain reaction (PCR), DNA ligase chain reaction (LCR), isothermal DNA amplification, QBeta RNA replicase, RNA transcription amplification reaction, loop-mediated isothermal amplification (LAMP), RT-LAMP, recombinase polymerase amplification (RPA), reverse transcription-recombinase polymerase amplification (RT-RPA), helicase-dependent amplification (HDA), strand displacement amplification (SDA), nucleic acid sequence-based amplification (NASBA), transcription-mediated amplification (TMA), nickase amplification reaction (NEAR), rolling circle amplification (RCA), multiple displacement amplification (MDA), break-apart (RAM), loop helicase-dependent amplification (cHDA), single primer isothermal amplification (SPIA), signal-mediated RNA amplification (SMART), self-sustained sequence replication (3SR), genomic exponential amplification reaction (GEAR), and isothermal multiple displacement amplification (IMDA).

7. The method of claim 2, wherein the target nucleic acid is detected by DNA staining, nucleic acid amplification, spectrophotometry, sequencing, fluorescent probe hybridization, fluorescence resonance energy transfer, optical microscopy, electron microscopy, CRISPR detection, visual detection, visual detection, sensor detection, color detection, gold nanoparticle detection, electrochemical detection, semiconductor sensing, or a combination thereof.

8. The method according to claim 2, wherein the amplified target nucleic acid is detected using a protein(s) capable of recognizing one or more specific nucleic acid sequences or their functional complexes; Preferably, the protein(s) capable of recognizing a specific nucleic acid sequence includes Cas enzymes, Ago enzymes, ZFN enzymes, TALEN enzymes, and functional complexes thereof; Preferably, the Cas enzyme is selected from the group consisting of Cas 9, Cas 12, Cas 13 and Cas 14, in particular including but not limited to SpCas9, SaCas9, HypaCas9, St1Cas9, spCas9-NG, LbCas12a, spCas9-mut and ScCas9; Preferably, the Ago enzyme is selected from pfAgo, cbAgo, LrAgo, pfAgo-mut, ApoI, pfpAgo, TtAgo and MjAgo; Preferably, the functional complex is selected from the group consisting of a Cas enzyme / sgRNA complex, an Ago / gDNA complex, and a Cas12a / crRNA complex; more preferably, the Cas enzyme / sgRNA complex is a Cas9 / sgRNA complex, more preferably a spCas9 / sgRNA complex; the Ago / gDNA complex is a pfAgo / gDNA complex; and the Cas12a / crRNA complex is a LbCas12a / crRNA complex; More preferably, LbCas12a, FnCas12a, Lb5Cas12a, HkCas12a, TsCas12a, BbCas12a, BoCas12a, Lb4Cas12a, LbuCas13a, LwaCas13a, LbaCas13a, PprCas13a, HheCas13a, EreCas13a, AsCas12a, TsCas12a, BbCas12a, BoCas12a, Lb4Cas12a, spCas9, pfAgo, cbAgo, LrAgo, Cas12b, Cas12a-mut, Cas12b-mut, AapCas12b, BrCas12b, CcaCas13b, PsmCas13b and AacCas12b or a functional complex thereof.

9. The method according to claim 1 or 2, wherein the mutation(s), protein for cleavage, protein for detection and amplification method are listed in Table 1 for each ID No.

10. A kit for alternately amplifying, enriching or detecting a target nucleic acid at a specific position in a sample, comprising reagents for alternately amplifying the target nucleic acid at a specific position in the sample and reagents for alternately digesting a non-target nucleic acid at a specified position in the sample; wherein the alternation of the target nucleic acid comprises deletion, replacement and / or insertion of one or more bases relative to the sequence of the non-target nucleic acid.

11. The kit according to claim 10, wherein the reagent for digesting nucleic acid comprises a protein having nucleic acid cleavage activity as defined in claim 3 or 4.

12. The kit according to claim 10, wherein the reagents for amplification include reagents for performing helicase-dependent amplification (HAD), polymerase chain reaction (PCR), DNA ligase chain reaction (LCR), isothermal DNA amplification, QBeta RNA replicase, RNA transcription amplification reaction, loop-mediated isothermal amplification (LAMP), RT-LAMP, recombinase polymerase amplification (RPA), reverse transcription-recombinase polymerase amplification (RT-RPA), helicase-dependent amplification (HDA), strand displacement amplification (SDA), nucleic acid sequence amplification (NASBA), transcription-mediated amplification (TMA), nickase amplification reaction (NEAR), rolling cycle amplification (RCA), multiple displacement amplification (MDA), separation (RAM), loop helicase-dependent amplification (cHDA), single primer isothermal amplification (SPIA), signal-mediated RNA amplification (SMART), self-sustained sequence replication (3SR), genomic exponential amplification reaction (GEAR) and isothermal multiple displacement amplification (IMDA).

13. The kit according to claim 10, wherein the kit further comprises reagents for detecting target nucleic acids; preferably, the reagents for detecting target nucleic acids include reagents for DNA staining, nucleic acid amplification, spectrophotometry, sequencing, sequencing, fluorescent probe hybridization, fluorescence resonance energy transfer, optical microscopy, electron microscopy, CRISPR-based detection, sensor-based detection, color detection, gold nanoparticle-based detection, electrochemical detection, and semiconductor-based sensing.

14. The kit according to claim 12, wherein the reagent for detecting the target nucleic acid is as described in claim 8.

15. The kit according to claim 10, wherein the kit comprises a kit comprising a cleavage protein listed in any one of the ID Nos. in Table A and an amplification method listed in the reagent(s), and optionally a detection protein listed in the same ID No. for detection.

Images