Application of USP33 inhibitors in the preparation of anti-SARS-CoV-2 virus drugs, antiviral drugs and preparation methods thereof

Abstract

The present invention provides a use of a USP33 inhibitor in the preparation of an anti-SARS-CoV-2 drug, an antiviral drug, and a method for preparing the same. The present invention has discovered a novel regulatory mechanism for the E protein of the novel coronavirus SARS-CoV-2, namely, that USP33 can enhance the stability of the E protein by removing K48 polyubiquitin chains. This regulation promotes the stability of the E protein more than the deubiquitination modification caused by USP32 and USP39. Based on this, the present invention designs a USP33 inhibitor for the preparation of an anti-SARS-CoV-2 drug, providing a new therapeutic approach for combating SARS-CoV-2 infection.

Description

Technical Field

[0001] The present invention belongs to the technical field of nucleic acid drugs and their preparation, and specifically relates to the use of USP33 inhibitors in the preparation of anti-SARS-CoV-2 virus drugs, antiviral drugs and their preparation methods. Background Art

[0002] The viral particles of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) are composed of four main structural proteins: spike protein (S), nucleocapsid protein (N), membrane protein (M), and envelope protein (E). Among these structural proteins, envelope protein (E) is the smallest, consisting of only 75 amino acid residues. Despite its small size, envelope protein shows a high expression level after the virus infects cells, and this phenomenon is closely related to the pathogenicity of the virus. Studies have shown that envelope protein participates in the assembly and stabilization of viral particles through interaction with membrane protein (M). In addition, envelope protein can form ion channels, affect the integrity of the cell membrane, and regulate the ion balance inside and outside the host cell, thereby leading to host cell apoptosis. Further studies have also found that envelope protein can promote the formation and activation of NLRP3 inflammasome, thereby triggering the release of the inflammatory factor IL-1β and exacerbating the inflammatory response.

[0003] The ubiquitin-proteasome system is a key pathway for intracellular protein degradation that rapidly recognizes and degrades specific viral proteins, thereby mitigating the pathogenic effects of the virus. For example, the ORF6, NSP5, and NDP8 proteins of SARS-CoV-2 can be tagged with polyubiquitin chains and degraded by the proteasome within a short period of time. The ubiquitination process involves an enzymatic cascade mediated by E1 activating enzymes, E2 conjugating enzymes, and approximately 600 E3 ubiquitin ligases. In contrast, deubiquitinating enzymes can rapidly cleave ubiquitin chains, reversing the process. Viruses can also exploit host deubiquitinating enzymes to resist degradation. Therefore, the discovery of deubiquitinating enzymes that can stabilize viral proteins and interfere with this degradation process is considered a potential antiviral strategy.

[0004] Ubiquitin-specific protease 33 (USP33), a protein with deubiquitinating enzyme activity, has been shown to be involved in regulating oncogenic signaling pathways and is therefore considered a potential target for cancer treatment. Recent studies have further revealed the key role of USP33 in neurodegenerative diseases, inflammatory responses, and metabolic disorders. This invention innovatively discovered that USP33 can act as a deubiquitinating enzyme for the E protein in the SARS-CoV-2 virus, playing a crucial role in viral infection and replication.

[0005] E protein was initially identified as a protein susceptible to degradation by the ubiquitin-proteasome system. However, compared with rapidly degraded viral proteins such as ORF9b and ORF6, E protein has a relatively long half-life of approximately 16 hours. This suggests that potential antagonism by deubiquitinating enzymes within host cells may counteract E protein degradation. Previous studies have reported that the stability of various proteins can be regulated by various deubiquitinating enzymes, such as PTEN and p53. In this study, we found that USP33 significantly enhances E protein stability and promotes viral replication. USP33 selectively targets E protein and interacts with viral PLpro to increase its stability. Loss of USP33 leads to rapid ubiquitination and degradation of E protein, resulting in impaired viral replication and inflammatory responses. Compared to the previously reported USP39, USP33 further enhances E protein stability. Furthermore, unlike USP39, whose expression levels increase slightly after viral infection, we observed no changes in total USP33 protein levels after viral infection in various cell lines. However, transcriptomic data from whole blood revealed that USP33 mRNA levels were higher in patients with both mild and severe disease following infection than in healthy individuals. This suggests that elevated USP33 expression may contribute to more severe disease rather than being a direct consequence of infection. USP33 is expressed in both the cytoplasm and the nucleus and interacts with the E protein in the cytoplasm. Interestingly, in the context of SARS-CoV-2 infection, we observed that USP33 migrated from the nucleus to the cytoplasm. However, ectopic expression of the E protein alone had no effect on USP33 localization. This may be due to the presence of other viral proteins, such as M and ORF7b, that interact with USP33, thereby affecting its nuclear localization. Consistent with our findings and previous reports, the E protein is primarily localized in the cytoplasm, suggesting that USP33 regulates E protein stability through a mechanism distinct from that of USP39. These findings reveal the complexity and multidimensionality of the ubiquitination process of viral proteins in host cells and highlight the potential value of combination therapeutic strategies. Summary of the Invention

[0006] The primary objective of the present invention is to provide the use of USP33 (sequence details are provided in the sequence listing) inhibitors in the preparation of anti-SARS-CoV-2 viral drugs. The present invention has discovered a novel regulatory mechanism for the E protein of the novel coronavirus SARS-CoV-2, namely that USP33 can enhance the stability of the E protein by removing K48 polyubiquitin chains. This regulation has a more stabilizing effect than the deubiquitination modification of the E protein caused by USP32 and USP39, thereby designing USP33 inhibitors for the preparation of anti-SARS-CoV-2 viral drugs.

[0007] Furthermore,

[0008] The USP33 inhibitors include: siUSP33.

[0009] Furthermore,

[0010] The siUSP33 sequence is at least one of the following:

[0011] hUSP33#1:CCCAGUAAUACAACAUUAATT

[0012] hUSP33#2:GGAGAAUAGAUGUUCAUAUTT

[0013] hUSP33#3:GCUGCAUUCAUCAAGUCAUTT

[0014] mUSP33#1:GCAGGAGACAAAGCAUUAUTT

[0015] mUSP33#2:GCCGGCUAAUCUGUUCCAATT

[0016] mUSP33#3:GCAGAGCCUCAGAAUCUAUTT

[0017] mUSP33#4:GCUGAACCUGGCCCUAUUUTT;

[0018] Preferred:

[0019] mUSP33#1:GCAGGAGACAAAGCAUUAUTT.

[0020] Furthermore,

[0021] The USP33 inhibitor comprises: lipid nanoparticles and siUSP33 in combination.

[0022] The final molar ratio of the USP33 inhibitor is Dlin-MC3-DMA:DSPC:cholesterol:DMG-PEG:DOTAP=23-26:4-6:19-20:0.6-1:48-52.

[0023] Among them, Dlin-MC3-DMA is an ionizable cationic lipid, often used as a carrier for delivering siRNA; DSPC (distearoylphosphatidylcholine) is often used to internalize siRNA; cholesterol can be used to prevent net outflow or inflow to maintain membrane integrity; DMG-PEG (dimyristoylglycerol-polyethylene glycol) provides an external polymerization layer to prevent serum protein adsorption and uptake by the mononuclear phagocyte system, prolonging the circulation time in the body and preventing the aggregation of nanoparticles during storage and in the blood; DOTAP ((2,3-dioleyloxypropyl)trimethylammonium chloride) can stably encapsulate nucleic acids inside liposomes through electrostatic effects, and form a lipid bilayer through its hydrophobic tail to encapsulate nucleic acids and drugs.

[0024] The preparation steps of the USP33 inhibitor of the present invention include:

[0025] The preparation steps of the USP33 inhibitor include: 1) taking Dlin-MC3-DMA:DSPC:cholesterol:DMG-PEG:DOTAP = 50mg:6mg:5mg:4mg:45mg, dissolving them together in 3mL of anhydrous ethanol to obtain a lipid solution, transferring it to an eggplant flask, dissolving 5.6mg of siUSP33 in 1mL of 50mM citric acid buffer with a pH of 4 containing 25% ethanol, slowly adding it to the lipid solution, mixing, and incubating for 20 minutes; treating it with ultrasound and passing it through a 100nm filter membrane using a liposome extruder; 2) dialysis using a nanodialysis device using a polycarbonate membrane with a pore size of 10nm; 3) lyophilizing: adding a lyoprotectant and lyophilizing it.

[0026] The second aspect of the present invention is to provide an anti-SARS-CoV-2 virus drug, which is the above-mentioned USP33 inhibitor.

[0027] The third aspect of the present invention is to provide a method for preparing the anti-SARS-CoV-2 virus drug, comprising the following steps:

[0028] The preparation steps of the USP33 inhibitor include: 1) taking Dlin-MC3-DMA:DSPC:cholesterol:DMG-PEG:DOTAP = 50mg:6mg:5mg:4mg:45mg, dissolving them together in 3mL of anhydrous ethanol to obtain a lipid solution, transferring it to an eggplant flask, dissolving 5.6mg of siUSP33 in 1mL of 50mM citric acid buffer with a pH of 4 containing 25% ethanol, slowly adding it to the lipid solution, mixing, and incubating for 20 minutes; treating it with ultrasound and passing it through a 100nm filter membrane using a liposome extruder; 2) dialysis using a nanodialysis device using a polycarbonate membrane with a pore size of 10nm; 3) lyophilizing: adding a lyoprotectant and lyophilizing it.

[0029] The fourth aspect of the present invention aims to provide the use of the siUSP33 in preparing a preparation that promotes the ubiquitination of the E protein in SARS-CoV-2.

[0030] This invention opens avenues for deeper exploration of the role of USP33 in viral replication and inflammation, providing a potential therapeutic target for combating SARS-CoV-2 infection. Future research could focus on optimizing the delivery system of siUSP33 to enhance its efficacy and minimize off-target effects. Furthermore, investigating the broader significance of targeting USP33 in other viral infections could provide valuable insights into the development of broad-spectrum antiviral strategies.

[0031] The present invention innovatively combines lipid nanomaterials with nucleic acid drugs, and by adjusting the components of the nanomaterials, innovatively achieves high lung targeting, high viral capacity and biosafety. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1 To identify USP33 as a preferred target for positively regulating SARS-CoV-2 replication through DUBs library screening; A) DUBs library screening was used to identify key deubiquitinating enzymes that promote viral replication. A human DUBs overexpression library was transfected into Vero cells, which were then infected with SARS-CoV-2 at an MOI of 0.1. After 24 hours, N protein expression was detected by immunofluorescence to quantify the relative abundance of the virus; B) DUBs screening results showed that USP33 is a preferred target for positively regulating SARS-CoV-2 replication.

[0033] Figure 2 To explore the interaction and regulatory relationship between viral proteins and DUBs;

[0034] A) HEK293T cells were transfected with a viral protein plasmid carrying a Strep tag, and the expression of USP33 in the whole cell lysate (WCL) and IP lysate was immunoprecipitated with an anti-USP33 antibody; B) GST and GST-E proteins were overexpressed in BL21 competent cells and precipitated by interaction with GST beads. The beads were then incubated with HEK293T cell lysate and analyzed by immunoblotting; C) HEK293T cells were co-transfected with HA-USP33 and a viral protein plasmid carrying a Flag tag and treated with MG132 (10 mM); the whole cell lysate was then collected, denatured, and immunoprecipitated with Flag. HA-E was transfected into HEK293T cells and then Flag-USP33 and His-tagged WT and K48-mutated Ub plasmids were co-incubated and finally analyzed by immunoblotting; D) HA-E was transfected into HEK293T cells and then Flag-USP33 and His-tagged WT and K48-mutated Ub plasmids were transfected separately or co-transfected and treated with MG132; WCLs (whole cell lysates) were denatured and immunoprecipitated with HAbeads, followed by immunoblotting analysis; E) HA-E was overexpressed in HEK293T cells and Flag-USP33 plasmids were gradiently overexpressed; E protein expression levels were detected by immunoblotting (left panel) and quantified relative to the internal control β-Actin (right panel); F) Flag-USP33 plasmids were gradiently overexpressed in HEK293T cells overexpressing HA-E-K63R, and the protein expression level of E-K63R was analyzed by immunoblotting; G) HA-E was transfected into HEK293T cells overexpressing HA-E and Flag-USP33 plasmids were respectively overexpressed and the protein expression level of E-K63R was analyzed by immunoblotting. HA-E-overexpressing HEK293T cells were transfected with either an empty vector or Flag-USP33 and treated with CHX at the indicated times. Cell samples were collected and analyzed for E protein levels by immunoblotting (left panel); quantitative analysis relative to the internal control β-actin is shown in the right panel; H) HEK293T cells overexpressing HA-E were gradiently transfected with Flag-USP32 or Flag-USP39 plasmids; cells were lysed and E protein levels were detected by immunoblotting (left panel); quantitative results are expressed as the mean ± SD (n = 3 independent experiments) (right panel); I) A549-ACE2 and Calu3 cells expressing HA-E were transfected with Flag-USP33 or Flag-USP39, respectively, to detect E protein expression levels under different treatment conditions (left panel); quantitative results are expressed as the mean ± SD (n = 3 independent experiments) (right panel); Student's t-test (unpaired, two-tailed) was used, **P < 0.01, ***P < 0.001.

[0035] Figure 3 To explore whether USP33 regulates E protein specifically in SARS-CoV-2;

[0036] A) Amino acid sequence alignment of the E proteins of seven human coronaviruses; B) Amino acid sequence similarity of the E proteins of seven human coronaviruses; C) Homology of the E proteins of seven human coronaviruses was assessed using ClustalW; D) Myc-tagged E protein plasmids were overexpressed in HEK293T cells infected with seven human coronaviruses, treated with CHX for the indicated times, and then collected for immunoblotting to detect E protein levels (top); the relative amount to β-Actin is expressed as the mean ± SD (n = 3 independent experiments) (bottom); E) HEK293T cells were transfected with plasmids containing Myc-E and HA-USP33, and protein levels were analyzed by immunoblotting; F) HEK293T cells were transfected with plasmids containing Myc-E and HA-USP33, Myc beads were added to the cell lysate for immunoprecipitation, and protein expression was analyzed by immunoblotting; G) Alignment of the interaction sites of the E proteins of seven human coronaviruses.

[0037] Figure 4 To verify the regulatory relationship of USP33 in mouse cells and design and synthesize the corresponding siRNA

[0038] A) Flag-E-overexpressing MH-S cells were transfected with an empty vector or HA-mUSP33, treated with CHX, and harvested at the indicated times for immunoblotting analysis of E protein levels. Two-way ANOVA was performed for multiple groups. ***P < 0.001. B) Four siRNAs targeting mUSP33 and a control siRNA were transfected into mouse alveolar macrophages MH-S. Cells were harvested 48 hours later, and USP33 protein levels were detected by immunoblotting.

[0039] Figure 5 : Design and synthesize lung-targeted materials;

[0040] A) Relevant parameters of LNP-nsRNA (control group) and LNP-siUSP33, including hydrodynamic diameter (nm), polydispersity index (PDI), and zeta potential (mV); B) Representative transmission electron microscopy images of LNP-nsRNA and LNP-siUSP33, scale bar, 100 nm; C) Lung-associated cells and non-lung-associated cells were transfected with siRNA (100 pmol) or added with LNP-siRNA (0.132 g), as shown in the figure. Approximately 48 hours later, cells were collected for immunoblotting to detect USP33 protein levels; D) Representative images of mice measured by IVIS imaging system Whole-body bioluminescence images (left) and quantification results are shown as mean ± SD (n = 3 independent experiments) (right); E) Representative ex vivo images of siRNA fluorescence in organs of injected mice captured using the IVIS imaging system (top) and quantification results are shown as mean ± SD (n = 3 independent experiments) (bottom); F) Lungs of mice with different treatments were collected on the indicated days, and USP33 protein levels in the lungs were compared and quantified with those of the PBS-treated group. Two independent groups were compared using Student's t-test (unpaired, two-tailed), and two-way ANOVA was performed for comparisons of multiple groups; *P < 0.05; **P < 0.01; ***P < 0.001.

[0041] Figure 6 : Verify the safety of materials;

[0042] AB) Peripheral blood was collected from mice in different treatment groups on day 1 (A) and day 4 (B) to analyze routine physiological parameters including blood routine examination (WBC, RBC, HGB, and PLT), liver function tests (ALP, TBA, ALT, and AST), and renal function tests (UREA, UA, and CREA).

[0043] Figure 7 : Verify the validity of the material.

[0044] To validate the antiviral effect of USP33 in mice, we used AAV to overexpress human ACE2 protein in the lungs of mice. Six days after AAV infection, we injected PBS, LNP-nsRNA, and LNP-siUSP33 into the mice via retroorbital intravenous injection. The next day, we infected the mice with the wild-type strain of SARS-CoV-2 via intranasal inoculation.

[0045] A) After infection, the weight of mice was recorded once a day for 8 days, and the quantification results of weight compared with pre-infection are expressed as mean ± standard deviation (n = 5 independent experiments); B) Total RNA was extracted from lung tissue, and the relative level of SARS-CoV-2N gene was detected. The lung tissue was then ground into a homogenate and infected with Vero cells, and the viral titer was calculated using FFA; C) The lung tissue of mice was collected on the 8th day after infection, and the levels of the corresponding proteins therein were detected; D) Immunohistochemical analysis was performed using anti-SARS-CoV-2N antibodies. To assess the relative viral load of SARS-CoV-2 in the lungs, scale bar, 100 μm; E) H&E staining of lung tissues from mice in different treatment groups to observe the intensity of inflammatory infiltration, scale bar, 1000 μm (top) and 50 μm (bottom); F) Total RNA was extracted from the lungs, and the relative levels of the indicated inflammatory genes were detected using qRT-PCR; G) Schematic diagram of SARS-CoV-2-infected K18-hACE2 mice; H) FFA was used to calculate the viral load in the lungs, liver, and kidneys of each treatment group on day 4 after infection. The Student's t-test (unpaired, two-tailed) was used to compare two independent groups, and two-way ANOVA was used for multiple group comparisons; *P < 0.05; **P < 0.01; ***P < 0.001; ns, not significant. DETAILED DESCRIPTION

[0046] The following examples are intended to further illustrate the present invention, but are not intended to limit the present invention.

[0047] Example 1: Screening for DUBs that promote viral replication using a DUB library

[0048] An overexpression library of human deubiquitinating enzymes (DUBs) was transfected into Vero cells, which were then infected with SARS-CoV-2 at a multiplicity of infection (MOI) of 0.1. The wild-type SARS-CoV-2 strain was isolated from nasopharyngeal swab samples collected from COVID-19 patients at Shenzhen Third People's Hospital and amplified in Vero E6 cells. The infection process was summarized as follows: When the cell confluence reached 90%, the culture medium was replaced with serum-free medium containing the virus. After incubation at 37°C for 1 hour, the medium was removed, the cells were washed with phosphate-buffered saline (PBS), and cultured in medium supplemented with 10% fetal bovine serum. The medium containing the progeny virus was collected, serially diluted threefold, and used to infect Vero-E6 cells for 1 hour, after which the medium was replaced with 1.2% carboxymethylcellulose (CMC). After 24 hours, nucleocapsid protein expression was detected by immunofluorescence, and the relative abundance of the virus was quantified.

[0049] Attachment Figure 1The results showed that Vero cells transfected with USP33 showed higher fluorescence abundance and the highest viral abundance in all fluorescence quantitative analysis results, which also suggests that USP33 is the preferred target for positively regulating SARS-CoV-2 replication.

[0050] Example 2: Exploring the interaction and regulatory relationship between viral proteins and DUBs

[0051] Vero cells were transfected with strep-tagged SARS-CoV-2 viral protein expression plasmids, and then Co-IP was performed using strep beads (Sigma). The pull-down of endogenous USP33 was detected using USP33 antibody to clarify their interaction relationship. Figure 2 Results A showed that there was interaction between M protein, E protein, ORF7b and USP33. At the same time, a prokaryotic expression vector expressing the E protein of the new coronavirus with GST fusion was constructed, the fusion protein was purified in BL21 (DE3) Escherichia coli competent cells, and GST-pulldown assay was performed with GST Agarose to analyze the in vitro interaction between viral proteins and DUBs, and WB detection was performed. The results are as follows Figure 2 As shown in Figure B, the interaction between E protein and USP33 was further verified by purifying E protein from E. coli and performing GST pull-down experiments. Subsequently, HA-tagged USP33 plasmids and other viral protein plasmids tagged with flag were co-transfected into the cells. Co-IP was performed using Flag beads (Sigma), and the pull-down of USP33 protein was detected, verifying their interaction at both endogenous and exogenous levels. Figure 2 CD revealed that USP33 acts as a deubiquitinase, removing ubiquitin chains bound to substrate proteins. Therefore, further in vivo ubiquitination experiments revealed that, despite significant ubiquitination of E, M, and ORF7b proteins, USP33 only removes polyubiquitin chains from E proteins. In the ubiquitin-proteasome degradation pathway, proteins recognized and degraded by the proteasome typically form K48 polyubiquitin chains. RNF5 is the primary E3 ubiquitin ligase for E proteins, catalyzing ubiquitination at the K63 site of E proteins. By screening different ubiquitin mutants, we determined that the primary ubiquitination type on E proteins is K48 polyubiquitin chains, and that USP33 significantly removes K48-type polyubiquitin chains from E proteins.

[0052] In addition, USP32 and USP39, which have also been reported to act as deubiquitinating enzymes for E proteins and can slightly enhance the stability of E proteins, have also been reported to act as deubiquitinating enzymes for E proteins. However, our results showed that the effect of USP33 was more significant than that of USP32 and USP39 ( Figure 2 E; Figure 2H). In different lung-related cells, such as A549-ACE2 and Calu3, overexpression of USP33 more strongly enhanced E protein levels than overexpression of USP39 ( Figure 2 I). When an anti-ubiquitination mutation was introduced at K63, the effect of USP33 on E protein stability was no longer observed ( Figure 2 F). Overexpression of USP33 significantly prolonged the half-life of E protein ( Figure 2 G).

[0053] Example 3: Exploring whether USP33 regulates E protein specifically in SARS-CoV-2

[0054] The E protein is an important component of the coronavirus particle and is found in all seven human coronaviruses. In addition to the high homology between SARS-CoV and SARS-CoV-2 (89.3%), there are also significant differences in the E protein between other human coronaviruses ( Figure 3 AC). Although half-life analysis showed that all seven E proteins decreased after 24 h after CHX treatment, the degradation of SARS-CoV and SARS-CoV-2 E proteins was most obvious. USP33 only enhanced the stability of SARS-CoV and SARS-CoV-2 E proteins ( Figure 3 This is consistent with the fact that USP33 can only interact with the E proteins of SARS-CoV and SARS-CoV-2, as we have shown that the interaction site is conserved in these two coronaviruses, but exists in different amino acid forms in other coronaviruses ( Figure 3 FG).

[0055] Example 4: Design and synthesis of siRNA targeting USP33

[0056] According to the design principles, three human siRNAs and four mouse siRNAs were designed and synthesized to screen out the most effective siRNA.

[0057] 10 μl of the synthesized siRNA solution (100 nM) was transfected into human and mouse lung cells using the Lipo-3000 transfection kit. The medium was replaced every 6-8 hours. After 48 hours of continuous culture, the cells were harvested, lysed with Trizol, and frozen at -20°C for RNA extraction to detect USP33 expression.

[0058] hUSP33#1:CCCAGUAAUACAACAUUAATT

[0059] hUSP33#2:GGAGAAUAGAUGUUCAUAUTT

[0060] hUSP33#3:GCUGCAUUCAUCAAGUCAUTT

[0061] mUSP33#1:GCAGGAGACAAAGCAUUAUTT

[0062] mUSP33#2:GCCGGCUAAUCUGUUCCAATT

[0063] mUSP33#3:GCAGAGCCUCAGAAUCUAUTT

[0064] mUSP33#4:GCUGAACCUGGCCCUAUUUTT

[0065] Detection of USP33 RNA expression

[0066] RNA extraction process:

[0067] (1) Place the lysed cells and tissues on ice at room temperature for 5 minutes to allow for complete lysis. Add 200 μL of chloroform to each tube of tissue or cell lysate, shake vigorously for 15 seconds, and place at low temperature for 5 minutes to allow the layers to separate.

[0068] (2) Centrifuge at 2-8°C, 12,000 rpm for 15 minutes. The sample separates into three layers: the organic phase at the bottom is red, the protein layer in the middle is white, and the aqueous phase at the top is colorless. The nucleic acid in the top layer is what we need.

[0069] (3) Pipette 450 μL of the upper layer liquid into a new enzyme-free tube, add 450 μL of isopropanol, gently invert upside down to mix, and place it at low temperature for 15 minutes.

[0070] (4) Centrifuge at 2-8°C, 12,000 rpm for 15 minutes. A white precipitate will appear at the bottom of the tube after centrifugation. Gently discard the supernatant and carefully retain the precipitate at the bottom.

[0071] (5) Add 1 mL of 75% ethanol to each tube until the precipitate floats off the tube wall (75% ethanol is prepared with DEPC water). Centrifuge at 7500 rpm for 5 minutes at 2-8°C. Discard the supernatant. Repeat this step twice, centrifuging once and discarding the supernatant.

[0072] (6) Dissolve the white precipitate in nuclease-free water to obtain RNA. Promote dissolution: incubate at 50-60°C or in a refrigerator at 4°C overnight.

[0073] cDNA preparation process:

[0074] (1) Follow the instructions of the reverse transcription kit:

[0075]

[0076] After mixing thoroughly, add the following ingredients:

[0077]

[0078] (2) Reaction procedure:

[0079] 25℃ 5 minutes

[0080] 42℃ 60 minutes

[0081] 70℃ 5 minutes

[0082] (3) The reaction is completed on a PCR instrument. After the reaction is complete and each tube has cooled to 12°C, the sample is removed for subsequent experiments or stored at -20°C for long-term storage.

[0083] qPCR experimental steps and reaction procedures

[0084] (1) Reaction system

[0085]

[0086] (2) The reaction procedure is as follows:

[0087]

[0088] (3) Export the reaction results and calculate the Ct, ΔCt, and 2-ΔΔCt of the target gene and reference gene. Calculation method:

[0089] Ct values ​​were calculated using ABI 7500 Manager software; ΔCt1 = Ct of the target gene in the experimental group minus Ct of the reference gene in the experimental group; ΔCt2 = Ct of the target gene in the control group minus Ct of the reference gene in the control group; ΔΔCt = ΔCt1 - ΔCt2; and 2-ΔΔCt was calculated using the formula. Results were analyzed using Graph RAD Prism 7 to generate histograms and analyze the 2-ΔΔCt values ​​of circRNAs in cells. Independent sample t-tests were used to analyze the 2-ΔΔCt values ​​of circRNAs in cells.

[0090] We used LNPs to target the delivery of siUSP33. With 89.5% homology between mouse and human USP33, we first demonstrated that mUSP33 can also enhance the stability of E protein in mouse lung cells, including lung cancer cells (LLCs) and alveolar macrophages (MH-S) ( Figure 4A). We designed four siRNAs targeting mouse USP33, and after the above experimental steps, we found that siRNA#1 had the highest knockdown efficiency among the USP33 knockdowns ( Figure 4 B), therefore, siRNA#1 will be used in all subsequent experiments.

[0091] Example 5: Design and synthesis of lung-targeted materials

[0092] We incorporated selective organ-targeting nanotechnology into the traditional MC3-based LNP formulation used in the FDA-approved RNAi therapy Patisiran / Onpattro by adding the supplementary cationic lipid DOTAP (1,2-dienyl-3-trimethylammonium-propane). This produced highly lung-selective LNPs with a final molar ratio of Dlin-MC3-DMA:DSPC (1,2-distearoyl-sn-glycero-3-phosphocholine):cholesterol:DMG-PEG:DOTAP of 25:5:19.3:0.8:50. (Take Dlin-MC3-DMA:DSPC:cholesterol:DMG-PEG:DOTAP = 50mg:6mg:5mg:4mg:45mg, dissolve them together in 3mL of anhydrous ethanol, transfer to an eggplant flask, dissolve 5.6mg of siUSP33 in 1mL of citric acid buffer (50mM citrate, pH = 4) containing 25% ethanol, slowly add to the lipid, mix well, and incubate for 20 minutes. Treat with ultrasound and a liposome extruder (100nm filter membrane); dialyze using a nanodialysis device (polycarbonate membrane, pore size 10nm); 3) Lyophilization: Add a lyoprotectant and lyophilize. The preparation method refers to Cui Z, Zeng C, Huang F, et al. Cas13d knockdown of lung protease Ctsl prevents and treats SARS-CoV-2 infection. Nat Chem Biol. 2022; 18(10): 1056-1064. doi: 10.1038 / s41589-022-01094-4) LNP-siNC and LNP-siRNA have high reproducibility, are about 100nm in size, and are spherical and uniform. They were observed by transmission electron microscopy and verified by physiological and biochemical indicators. ( Figure 5-7 )

[0093] 1H&E staining and immunohistochemical analysis

[0094] The lungs of infected and uninfected mice were taken and first fixed in 4% paraformaldehyde for 24 hours. The samples were then dehydrated and embedded in paraffin. Thin sections (4-5 μm) were cut and stained with hematoxylin and eosin to observe tissue morphology. For immunohistochemistry, paraffin-embedded sections were deaffinity, dehydrated, and subjected to antigen extraction. Before blocking the primers, they were first incubated with a primary antibody specific for SARS-COV-2-nucleoprotein, followed by incubation with an HRP-labeled secondary antibody and DAB (peroxidase) to visualize the antigen localization and expression levels in the tissue.

[0095] 2 Cryogenic transmission electron microscopy (Cryogenic TEM)

[0096] Cryo-transmission electron microscopy (Cryo-TEM) sample preparation and imaging were performed as follows: First, 5 μL of sample was carefully coated onto a glow-discharge-treated grid (R1.2 / 1.3 Au, 300 mesh, GiG). The grid was then subjected to a 4-second water absorption treatment at 100% humidity and 4°C. Subsequently, the grid was rapidly immersed in liquid ethane using a Mark IV vitrobot (ThermoFisher). Imaging was performed using a Talos Glacios transmission electron microscope (ThermoFisher). Magnification was set to 92,000×, with a pixel size of 1.57 Å.

[0097] 3 In vivo imaging software imaging

[0098] Lipid nanoparticles (LNPs) containing CY5-modified siRNA were injected into C57BL / 6 mice via retroretinal vein injection (dose: 0.5 mg / kg). Fluorescence imaging of the whole body and major organs (heart, liver, spleen, lungs, and kidneys) was performed using the IVIS Lumina XR system and Living Image Software v.4.3.1 (Caliper Life Science).

[0099] Typically, LNPs accumulate in the liver and kidneys, but LNPs with a high molar ratio of ionizable cationic lipids show better lung targeting. Therefore, we prepared siUSP33 encapsulated in DOTAP-LNPs (LNP-siUSP33) and characterized the size and surface charge of the LNP-encapsulated siRNA ( Figure 5 A). The morphology of LNP-siRNA was further characterized by transmission electron microscopy, which revealed a clear core structure ( Figure 5B) By transfecting free siUSP33 or LNP-siUSP33 into various mouse cell lines, we found that in lung-related cells such as LLC, MLE-12, and TC-1, LNP-siUSP33 delivered siUSP33 had higher knockdown efficiency than traditional siUSP33 transfected with lipo-3000. In non-lung-related cells such as MEF, NIH-3T3, and AML12, LNP-siUSP33 had lower knockdown efficiency, while traditional transfection methods had higher knockdown efficiency ( Figure 5 C).

[0100] Next, we compared several different LNP administration routes, including retroorbital injection, intravenous injection (tail injection), and intranasal inoculation. Whole-body bioluminescence imaging and in vitro fluorescence detection showed that retroorbital injection of LNP-siUSP33 into the lungs had the least loss and reached a peak at 12 hours ( Figure 5 D). Retroorbital injection also showed the best inhibitory effect on the 1st, 2nd and 4th day after treatment ( Figure 5 E). To better analyze the effects of LNP-siUSP33 on the lungs and the efficiency of USP33 knockout over time after injection, mice were injected with PBS, Free-siUSP33, and LNP-siUSP33. Whole-body bioluminescence imaging showed that after injection, Free-siUSP33 rapidly spread throughout the body and gradually accumulated in the liver and kidneys, while LNP-siUSP33, although also accumulated in small amounts in the liver and kidneys, gradually targeted the lungs (in vitro fluorescence detection of lung, brain, liver, kidney, and spleen tissues was performed on days 0.5, 1, 2, 4, 7, 10, 14, and 21 after injection. The results showed that LNP-siUSP33 specifically targeted the lungs, and its protein level analysis showed that in the lungs, USP33 decreased significantly 1 day after injection, lasted for at least 14 days, and returned to its original level on the 21st day ( Figure 5 F).

[0101] Considering that the in vivo delivery peak of LNP is on the first day after injection, and the USP33 knockout efficiency is at its optimal level 4 days after injection, we collected blood samples from each group on the 1st and 4th days for analysis of blood routine and blood biochemical physiological indicators. The results showed that there were no significant changes in hematological indicators, and the liver and kidney functions of the mice were basically normal ( Figure 6 This suggests that our strategy of encapsulating siRNA with Dlin-MC3-DMA and adding an additional cationic lipid (DOTAP) is effective in reducing side effects. The LNP system maintains a relatively neutral surface charge at physiological pH. We also kept its diameter below 140 nm to minimize LNP binding to fibrinogen and clot formation. These results suggest that our LNP delivery strategy and USP33 knockdown represent a potential antiviral approach.

[0102] To verify the antiviral effect of USP33 in mice, we used adeno-associated virus (AAV) to overexpress human ACE2 protein in the lungs of mice (to construct new coronavirus-susceptible mice). Six days after AAV transduction, we injected PBS, LNP-nsRNA, and LNP-siUSP33 into mice through the retroorbital route. The next day, we infected mice with nasal inoculation of the wild-type strain of SARS-CoV-2 and recorded daily weight changes within 8 days after infection. There was no difference between the LNP-nsRNA group and the PBS group, and the body weight gradually decreased, reaching a minimum level of about 20% on the 7th day. However, the body weight of mice injected with LNP-siUSP33 reached the lowest level on the third or fourth day after infection, decreased by about 5%, and gradually returned to the original weight ( Figure 7 A). Detection of USP33 protein expression in the lungs of AAV-hACE2 mice in different treatment groups showed that the viral load in the lungs of mice in the LNP-siUSP33 group was significantly lower than that in the PBS and LNP-nsRNA groups ( Figure 7 BC). The immunohistochemical results were consistent with this. H&E staining showed that LNP-nsRNA did not alleviate the inflammation caused by viral infection, while the viral load of mice in the LNP-siUSP33 group was significantly reduced, and the inflammatory infiltration of the lungs was also significantly reduced ( Figure 7 DE). The inhibitory effect of LNP-siUSP33 on viral virulence was also confirmed by detecting the expression of inflammatory factors in lung tissue ( Figure 7 F). K18-hACE2 transgenic mice (transgenic mice expressing human angiotensin-converting enzyme 2 (hACE2) can be used to study SARS-CoV-2 infection and disease manifestations.) were also used to measure the effects of LNP-siUSP33. Unlike AAV-hACE2 mice that express hACE2 only in the lungs, K18-hACE2 mice can express hACE2 in multiple organs. The results showed that after 4 days of infection, the viral load and inflammatory infiltration in the lung tissue of mice treated with LNP-siUSP33 were significantly reduced, but due to targeted delivery, there was no significant change in the viral load in the liver and kidneys ( Figure 7 FG). These results indicate that LNP-siUSP33 can specifically target the lungs, inhibit viral replication, and reduce the inflammatory response induced by the virus.

[0103] Human USP33 sequence

[0104] ATGACAGGATCAAATTCACACATAACGATATTAACCTTAAAGGTGTTACCTCATTTTGAAAGTCTTGG

[0105] GAAACAGGAAAAAATTCCTAACAAAATGTCAGCTTTTCGAAATCATGTCCACATTTGGATTCAGTT

[0106] GGTGAAATAACAAAGAAGATTTGATACAAAAATCCCTTGGTACTTGGTCAGGATTGTAAAGTCCAAG

[0107] GACCAAATCTTTGGGCATGTCTGGAGAATAGATGTTCATATGTTGGCTGTGGTGAATCACAAGTAGA

[0108] TCACAGCACCATACATTCTCAGGAGACAAAGCATTATCTAACTGTGAACCTTACCACTCTTCGAGTAT

[0109] GGTGTTATGCTTGCAGCAAAGAAGTATTTTTTGGATAGGAAATTAGGAACTCAGCCTTCATTGCCTCAT

[0110] GTAAGACACCTCACCAAATACAAGAAAACAGTGTCCAGGATTTTAAAATACCCAGTAATACAACAT

[0111] TAAAAACTCCTCTGGTTGCCGTATTTGATGATCTGGATATAGAAGCGGATGAAGAAGATGAACTTAG

[0112] GGCCAGAGGTCTTACAGGTTTGAAAAATATTGGAAATACTTGTTACATGAATGCAGCTTTGCAGGCT

[0113] CTTTCTAATTGCCCACCTTTGACACAGTTTTTTCTTGATTGTGGAGGACTAGCTCGAACAGATAAGAA

[0114] ACCTGCCATTTGTAAAAGTTATCTCAAACTAATGACAGAGCTGTGGCATAAAAGCAGGCCAGGATCT

[0115] GTTGTGCCTACTACTCTGTTTCAAGGAATTAAAACTGTAAATCCAACATTTCGGGGGTATTCTCAGCA

[0116] GGATGCTCAAGAATTCCTTCGATGTTTAATGGATTTGCTTCATGAAGAATTGAAAGAGCAAGTCATG

[0117] GAAGTAGAAGAAGATCCGCAAACCATAACCACTGAGGAGACAATGGAAGAAGACAAGAGCCAGTC

[0118] GGATGTAGATTTTCAGTCTTGTGAATCTTGTAGCAACAGTGATAGAGCAGAAAATGAAAATGGCTCT

[0119] AGATGCTTTTCTGAAGATAATAATGAAACAACAATGTTAATTCAGGATGATGAAAACAATTCAGAAA

[0120] TGTCAAAGGATTGGCAAAAAGAGAAGATGTGCAATAAGATTAATAAAGTAAATTCTGAAGGCGAAT

[0121] TTGATAAAGATAGAGACTCTATATCTGAAACAGTCGACTTAAACAACCAGGAAACTGTCAAAGTGCA

[0122] AATACACAGCAGAGCTTCAGAATATATCACTGATGTCCATTCGAATGACCTGTCTACACCACAGATC

[0123] CTTCCATCAAATGAAGGTGTTAATCCACGTTTATCGGCAAGCCCTCCTAAATCAGGCAATTTGTGGCC

[0124] AGGATTGGCACCACCACACAAAAGCTCAGTCTGCATCTCCAAAGAGAAAAACAGCACAAGAA

[0125] ATACAGAAGTGTTATTTCAGACATATTTGATGGAACAATCATTAGTTCAGTGCAGTGTCTGACTTGTG

[0126] ACAGGTGTCTGTAACCCTCGAGACCTTTCAAGATCTGTCCTTGCCAATTCCTGGCAAGGAAGACCTT

[0127] GCTAAGCTGCATTCATCAAGTCATCCAACTTCTATAGTCAAAGCAGGATCATGTGGCGAAGCATATG

[0128] CTCCACAAGGGTGGATAGCTTTTTTCATGGAATATGTGAAGAGCTGGTTTTGGGGTCCAGTAGTAAC

[0129] CTTGCAAGATTGTCTTGCTGCCTTCTTTGCCAGAGATGAACTAAAAGGTGACAATATGTACAGTTGTG

[0130] AAAAATGCAAAAAGTTGAGAAATGGAGTGAAGTTTTGTAAAGTACAAAACTTTCCTGAGATTTTGTG

[0131] CATCCACCCTTAAGATTCAGACATGAACTAATGTTTTCCACCAAAATCAGTACCCATGTTTCATTTC

[0132] CGCTAGAAGGCTTGGATCTTCAGCCATTTCTTGCTAAGGATAGTCCAGCTCAAATTGTGACATATGAT

[0133] CTTCTGTCAGTCATTTGCCATCATGGAACTGCAAGTAGTGGACACTATATAGCCTACTGCCGAAACA

[0134] ATCTAAATAATCTCTGGTATGAATTTGATGATCAGAGTGTCACTGAAGTTTCAGAATCTACTGTACAA

[0135] AATGCAGAAGCTTACGTTCTTTTCTATAGGAAGAGCAGCGAAGAGGCACAAAGGAGAGGAGAAGG

[0136] ATATCAAATTTATTGAACATAATGGAACCAAGCCTCCTTCAGTTTTATATTTCTCGACAGTGGCTTAA

[0137] TAAATTTAAGACCTTTGCCGAACCTGGCCCTATTTCAAATAATGACTTTCTTTGTATTCATGGAGGTG

[0138] TTCCTCCAAGAAAAGCTGGTTATATTGAAGACCTGGTTTTGATGCTGCCTCAGAACATTTGGGATAAC

[0139] CTATATAGCAGGTATGGTGGAGGACCAGCTGTCAACCATCTGTACATTTGTCATACTTGCCAAATTGA

[0140] GGCGGAGAAAATTGAAAAAAGAAGAAAAACTGAATTGGAAATTTTTATTCGGCTTAACAGAGCGTT

[0141] CCAAAAAGAGGACTCTCCAGCTACTTTTTATTGCATCAGTATGCAGTGGTTTAGAGAATGGGAAAGT

[0142] TTTGTGAAGGGTAAAGATGGAGATCCTCCAGGTCCTATTGACAATACTAAGATTGCAGTCACTAAAT

[0143] GTGGTAATGTGATGCTTAGGCAAGGAGCAGATTCTGGCCAGATTTCTGAAGAAACATGGAATTTTCT

[0144] GCAGTCTATTTATGGTGGAGGGCCTGAAGTTATCCTGCGACCTCCGGTTGTTCATGTTGATCCAGATA

[0145] TACTTCAAGCAGAAGAAAAAATTGAAGTAGAAACTCGGTCTTTGTAA

[0146] Mouse USP33 sequence

[0147] ATGACGACTTTTCGAAATCATTGTCCACATTTGGATTCAGTTGGTGAAATAACGAAAGAGGACTTGA

[0148] TACAGAAATCTCTCGGCGCTTGTCAGGACTGTAAAGTCAGAGGACCAAACCTGTGGGCGTGCCTGGA

[0149] GAATAGGTGCTCCTATGTTGGCTGCGGGGAGTCGCAAGTGGACCACAGCACCATACACTCGCAGGAG

[0150] ACAAAGCATTATCTAACTGTGAACCTCACCACTCTTCGAGTATGGTGTTATGCTTGCAGCAAAGAAG

[0151] TATTTTTGGATAGAAAATTAGGAACTCCTCCTTCATTACCTCATGTAAGACAGCCTCAACAAACACAA

[0152] GAAAACAGTGTCCAGGATTTTAAAATTCCCAGTAATCCAGCATTGAAAACCCCCATGGTTGCTGTGT

[0153] CTGAAGATCTGGATATAGAAGTGGAAGAGGAAGACGAGCTGAAGGCTAGAGGCCTGACAGGTTTGA

[0154] AAAACATTGGAAATACTTGTTATATGAACGCGGCGCTGCAGGCTCTTTCTAACTGCCCACCTTTGACA

[0155] CAGTTCTTTCTTGATTGTGGAGGACTGGCTAGAACAGATAAGAAACCAGCAATTTGTAAAAGTTATC

[0156] TCAAACTAATGACCGAGTTGTGGCACAAGAGCAGGCCAGGATCTGTTGTGCCGGCTAATCTGTTCCA

[0157] AGGAATTAAAACTGTAAATCCAACTTTTCGAGGTTATTCTCAGCAGGATGCCCAGGAATTCCTTCGCT

[0158] GTCTAATGGACCTGCTTCATGAGGAGCTGAAGGAGCAGGTCATGGAAATGGAGGAAGAGCCTCAAA

[0159] CACTAACTTCTGAGGAGACGGTGGAGGAAGAGAAGAGCCAGTCAGATGTGGATTTTCAGTCGTGCG

[0160] AGTCTTGTAGCAGCAGCGAGAAAGCAGAAAATGAGAGTGGCTCCAAAGGCTTTCCTGAGGACAGCA

[0161] ATGAGACCACCATGCTCATCCAGGACGAGGATGACCTGGAGATGGCCAAAGACTGGCAGAAAGAGA

[0162] AGGTGTGCAATAAGATCAACAAGGCAAATGCCGATGTAGAACTGGACAAAGACAGGGACACAGTGT

[0163] GTGAAACAGTTGACCTAAACAGCCAGGAGACCGTCAAAGTGCAGATACACGGCAGAGCCTCAGAAT

[0164] CTATCACTGATGTCCATCTGAATGACCTAGCTACGTCACAGATCCTTCCTTCAAATGAAAGTGTTAGT

[0165] CCACGGTTATCAGCAAGCCCTCCTAAGCTAGGCAGTCTGTGGCCAGGACTGTCGCCTCCACACAAGA

[0166] AAGCTCAGTCTACATCTGCAAAGAGGAAAAAGCAGCATAAGAAATACAGAAGTGTCATCTCCGACA

[0167] TATTCGATGGAACAGTCATTAGCTCGGTACAGTGTCTGACGTGCGATAGGGTGTCTATAACCCTCGA

[0168] GACCTTTCAGGATCTGTCCTTGCCGATTCCTGGCAAGGAGGACCTGGCTAAGCTGCACTCCTCCAGTC

[0169] ACCCAACTATAGTCAAAGCAGGGTCATGTGGTGAAGCGTACGCCCCGCAGGGGTGGATAGCTTTCTT

[0170] CATGGAGTATGTGAAGAGCTGGTTTTGGGGTCCAGTAGTTACCTTGCAAGATTGTCTTGCTGCCTTCT

[0171] TCGCCAGAGATGAACTTAAAGGTGACAACATGTACAGTTGTGAAAAATGCAAAAAGTTGAGGAATG

[0172] GAGTAAAGTTTTGTAAAGTACAGAAGTTTCCTGAGATTTTGTGTATCCACCTTAAAAGATTTCGACAT

[0173] GAACTGATGTTTTCCACCAAAATTAGCACCCATGTTTCCTTCCCCCTGGAAGGCCTCGATCTTCAGCC

[0174] ATTTCTTGCAAAGGACAGCCCAGCTCAGATTGTGACATATGATCTCCTGTCAGTCATCTGTCACCATG

[0175] GGACTGCAAGTAGTGGGCACTACATTGCCTACTGCCGAAACAATTTAAATAACCTGTGGTATGAGTT

[0176] TGATGACCAGAGCGTCACTGAAGTTTCAGAGTCCACTGTACAGAATGCCGAGGCCTACGTCCTTTTCT

[0177] ACAGGAAGAGCAGTGAAGAGGCACAAAAGGAGAGGCGGAGGATATCAAATTTGTTGAACATCATGG

[0178] AACCTAGCCTCCTTCAGTTCTACATATCTCGACAGTGGTTGAATAAATTTAAGACCTTTGCTGAACCT

[0179] GGCCCTATTTCAAATAATGATTTTCTCTGTATCCATGGAGGTATTCCTCCACGAAAAGCGAGTTATAT

[0180] TGAAGACTTAGTTTTGATGCTGCCTCAGAACATTTGGGATAACCTCTATAGCAGGTATGGAGGAGGG

[0181] CCTGCTGTCAACCATCTCTACATCTGCCACACCTGCCAAATTGAGTTAGAGAAGATTGAAAAACGAA

[0182] GAAAAACCGAATTGGAAATTTTTATTCGGCTCAACAGAGCATTTCAAGAGGAGGACTCCCCAGCTAC

[0183] TTTTTACTGTATCAGCATGCAGTGGTTTAGAGAATGGGAGAGTTTTGTAAAGGATCCCCCAGGTCCA

[0184] ATCGACAACACTAAAATTGCGGTTACTAAATGTGGCAGTGTGATGCTCAAGCAAGGAGCAGACTCTG

[0185] GTCAAATTTCAGAAGAAACATGGAATTTCCTGCAGTCTATATATGGTGGGGGGCCTGAAGTTATCCT

[0186] CCGACCTCCAGTTGTTCATGTTGACCCTGATGTACTCCAAGCAGAGGAAAAGATTGAAGTAGAAACT

[0187] CGCTCTTTGTAG

Claims

1. Application of USP33 inhibitors in the preparation of anti-SARS-CoV-2 drugs; The USP33 inhibitors include: siUSP33; the siUSP33 sequence is as follows: mUSP33#1: GCAGGAGACAAAGCAUUAUTT.

2. The use according to claim 1, characterized in that The USP33 inhibitor comprises: lipid nanoparticles and siUSP33 in combination.

3. The use according to claim 2, characterized in that The final molar ratio of the components in the lipid nano-delivery particles of the USP33 inhibitor is Dlin-MC3-DMA:DSPC:cholesterol:DMG-PEG:DOTAP=23-26:4-6:19-20:0.6-1:48-52.

4. The use according to claim 2 or 3, characterized in that The preparation steps of the USP33 inhibitor include: 1) taking Dlin-MC3-DMA:DSPC:cholesterol:DMG-PEG:DOTAP = 50mg:6mg:5mg:4mg:45mg, dissolving them together in 3mL of anhydrous ethanol to obtain a lipid solution, transferring it to a flask, dissolving 5.6mg of siUSP33 in 1mL of 50mM citric acid buffer with a pH of 4 containing 25% ethanol, slowly adding it to the lipid solution, mixing, and incubating for 20 minutes; treating it with ultrasound and passing it through a 100nm filter membrane using a liposome extruder; 2) dialysis using a nanodialysis device using a polycarbonate membrane with a pore size of 10nm; 3) freeze-drying: adding a lyoprotectant and freeze-drying.

5. An anti-SARS-CoV-2 virus drug, characterized in that: The USP33 inhibitor according to any one of claims 1 to 4.

6. The method for preparing the anti-SARS-CoV-2 virus drug according to claim 5, characterized in that: The following steps are involved: 1) Dissolve 50 mg of Dlin-MC3-DMA:DSPC:cholesterol:DMG-PEG:DOTAP (6 mg, 5 mg, 4 mg, 45 mg) in 3 mL of anhydrous ethanol to obtain a lipid solution. Transfer the solution to an eggplant flask and slowly add 5.6 mg of siUSP33 to 1 mL of 50 mM citric acid buffer (pH 4) containing 25% ethanol. Mix thoroughly and incubate for 20 minutes. Ultrasonicate and pass through a liposome extruder through a 100 nm filter. 2) Dialyze using a nanodialysis device using a polycarbonate membrane with a pore size of 10 nm. 3) Freeze-dry by adding a lyoprotectant.

Images