Application of brucein A in preparation of medicine for resisting porcine epidemic diarrhea virus

Abstract

The invention provides an application of brucein A in preparation of an anti-porcine epidemic diarrhea virus drug, and belongs to the technical field of chemical medicines. Experimental results show that the brucein A has remarkable inhibiting and blocking effects on a-1 ribosomal Frameshift process of a porcine epidemic diarrhea virus (PEDV), can effectively inhibit replication and proliferation of the PEDV, and has an inhibiting effect on a plurality of common strains of the PEDV; the brucein A can be used for preparing a medicine for resisting PEDV (porcine epidemic diarrhea virus) and a medicine for preventing and treating porcine epidemic diarrhea caused by PEDV, and the medicine is a wide-spectrum antiviral medicine, is insensitive to variation of PEDV and has a wide application prospect.

Description

Technical Field

[0001] This invention belongs to the field of chemical medicine, specifically relating to the application of crotonin A in the preparation of drugs against porcine epidemic diarrhea virus. Background Technology

[0002] Porcine epidemic diarrhea virus (PEDV) is a highly contagious coronavirus belonging to the genus *Alpha* of the family Coronaviridae. It primarily infects pigs, especially newborn piglets, where mortality rates are extremely high, often resulting in significant economic losses for the poultry industry. The PEDV genome is a single-stranded, positive-sense RNA of approximately 28 kb, encoding various structural and non-structural proteins. In recent years, PEDV has seen continuous mutations, with some strains exhibiting significantly enhanced pathogenicity and transmissibility, further increasing the difficulty of control. Current research on PEDV mainly focuses on viral receptor recognition, immune evasion mechanisms, and vaccine development. Although some candidate vaccines have entered the trial stage, the high mutation rate of the virus remains a major challenge for control. Therefore, there is an urgent need to develop an antiviral drug that is insensitive to viral mutations. Summary of the Invention

[0003] To address the shortcomings of the existing technology, the present invention aims to provide the application of crotonin A in the preparation of drugs against porcine epidemic diarrhea virus.

[0004] The technical solution adopted in this invention is as follows:

[0005] Application of Brucea javanica extract A in the preparation of drugs against swine epidemic diarrhea virus.

[0006] Bruceine A, also known as Bruceine A, is a bitter component of Brucea javanica. It has antiparasitic and anticancer activities and works by inducing apoptosis or necrosis of cells.

[0007] The molecular formula of crotonin A is: C 26 H 34 O 11 ;

[0008] The structural formula of Brucea javanica glycoside A is:

[0009] .

[0010] In one embodiment of this application, the drug is a drug for preventing and / or treating porcine epidemic diarrhea disease caused by porcine epidemic diarrhea virus infection.

[0011] In one embodiment of this application, the drug is a drug that inhibits the replication of porcine epidemic diarrhea virus.

[0012] In one embodiment of this application, the drug is a drug that inhibits the proliferation of porcine epidemic diarrhea virus.

[0013] In one embodiment of this application, the porcine epidemic diarrhea virus includes one or more genotype strains selected from G1a, G1b, G2a, G2b, and G2c.

[0014] In one embodiment of this application, the drug comprises crotonin A and pharmaceutically acceptable excipients.

[0015] In one embodiment of this application, the crocin A inhibits the replication and proliferation of porcine epidemic diarrhea virus (PEDV) or prevents PED by inhibiting the -1 ribosome frameshift process of PEDV.

[0016] In one embodiment of this application, the drug is an oral preparation or an injection.

[0017] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0018] A ribosomal frameshift element exists in the middle of the open reading frame 1 (ORF1) of the PEDV genome. The virus precisely regulates the expression of genes following ORF1 through this element, including RdRP (RNA-dependent RNA polymerase), a key component of the viral replication complex. Inhibiting the ribosomal frameshift effectively prevents PEDV amplification; therefore, the ribosomal frameshift element is an ideal target for small molecule drugs. Furthermore, this ribosomal frameshift element has a low mutation rate, making inhibitors targeting it insensitive to mutations.

[0019] This application discovers a novel use of bruceine A in inhibiting porcine epidemic diarrhea (PEDV). Experiments have demonstrated that bruceine A exhibits a highly significant inhibitory and blocking effect on the -1 ribosomal frameshifting process of PEDV, effectively suppressing PEDV replication and thus inhibiting PEDV proliferation. Furthermore, it shows inhibitory effects on multiple genotypes of PEDV, indicating that the inhibition of PEDV proliferation by bruceine A is insensitive to PEDV mutations. Therefore, bruceine A can be used to treat and prevent porcine epidemic diarrhea caused by PEDV infection, to prepare anti-PEDV drugs, and to prepare drugs for treating and preventing porcine epidemic diarrhea caused by PEDV infection. This drug is a broad-spectrum antiviral agent, insensitive to PEDV mutations, and has promising application prospects.

[0020] PEDV is mainly divided into two genotypes: G1 (classical strain) and G2 (mutant strain). G1 is further divided into two subgroups, G1a and G1b, while G2 is divided into three subgroups: G2a, G2b, and G2c. The crocin A discovered in this application has a highly significant inhibitory effect on all five subgroups of PEDV strains (G1a, G1b, G2a, G2b, and G2c). Attached Figure Description

[0021] To more clearly illustrate the technical solutions in the embodiments of this application or the prior art, the accompanying drawings used in the description of the embodiments or the prior art will be briefly introduced below.

[0022] Figure 1 The diagram shows the design principle (a), experimental procedure (b), and experimental results (c) for crotonin A to inhibit the PEDV ribosome frameshift process in a luciferase reporter system.

[0023] Figure 2 The diagram shows the design principle (a), experimental procedure (b), and experimental results (c) for using crotonin A to inhibit the PEDV ribosome frameshift process in a fluorescent protein reporter system.

[0024] Figure 3 The results of experiments on the toxicity of different concentrations of crotonin A on Vero cells and the results of experiments on its antiviral activity against intracellular PEDV are presented.

[0025] Figure 4 The results show the inhibitory effect of crotonin A on CPE (cytopathic effect) induced by PEDV G2c strain in Vero cells.

[0026] Figure 5 The results of antiviral experiments on PEDV (G1a, G1b, G2a, G2b, G2c strains) by crotonin A, as detected by RT-PCR.

[0027] Figure 6 The results of an antiviral experiment on PEDV in live pigs are presented by crotonin A. Detailed Implementation

[0028] In the following description, only certain exemplary embodiments are briefly described. As those skilled in the art will recognize, the described embodiments can be modified in various ways without departing from the spirit or scope of the invention. Therefore, the drawings and description are considered to be exemplary in nature and not restrictive.

[0029] Example 1

[0030] Evaluation of the inhibitory effect of crotonin A on the -1 Ribosomal Frameshifting process of PEDV (luciferase reporter system).

[0031] 1. Experimental Methods

[0032] The inhibitory effect of a drug (Bruceine A) on the -1 ribosomal frameshifting process of PEDV was studied using in vitro cell culture. First, a lentiviral vector containing the PEDV viral genome sliding sequence was constructed, and the drug's effect was detected in the porcine kidney cell line PK15. The initial screening concentration of the drug was 10 μM.

[0033] 1.1. Construction of luciferase reporter gene vector

[0034] (1) Synthesis of PEDV virus-1 Ribosomal Frameshift sliding region gene sequence (frameshift elements of 5 strains were synthesized respectively: G1a, G1b, G2a, G2b, G2c). The lentiviral backbone vector was double-digested with EcoRI+BamHI. Digestion conditions: 37℃, 15 minutes. After digestion, the digestion products were recovered by nucleic acid electrophoresis. For the synthesized PEDV virus-1 Ribosomal Frameshift sliding region gene sequence, it was first denatured at 95℃ for 10 minutes and annealed at 72℃ for 30 seconds. Then, the annealing product was mixed with the digestion product at a ratio of annealing product: digestion product = 3:1. 10 μL of T4 ligase was added to the above mixture and ligated in a constant temperature metal bath at 16℃ for 16 hours. Plasmid transformation of competent cells: Competent cells were removed from a -80°C freezer and thawed on ice. A lentiviral vector containing the PEDV virus-1 Ribosomal Frameshift gene sequence was added to every 100 μL of competent cells, and the mixture was incubated on ice for 30 minutes. The mixture was then placed in 42°C water for 90 seconds for heat shock. After heat shock, the mixture was cooled on ice for 10 seconds. The cooled mixture was transferred to a solid LB agar plate, and the liquid was evenly spread on the surface of the solid LB medium using a glass rod. The plate was then inverted and incubated at 37°C for 16 hours. After incubation, single-clone plaques were picked up with a pipette tip and inoculated into liquid LB medium. After incubation at 37°C for 8 hours, the plaques were sent to a commercial sequencing company for sequencing. Single clones with correct sequencing results were amplified and plasmids were extracted.

[0035] (2) By homologous recombination, the luciferase of Renidae was constructed upstream of the -1 Ribosomal Frameshift region, and the luciferase of Firefly was constructed downstream of the -1 Ribosomal Frameshift region.

[0036] The specific method is as follows: The gene sequences of Renidae luciferase and firefly luciferase were amplified by PCR, and homologous arms were added upstream and downstream of the sequences, respectively. The vector obtained in step (1) was subjected to PCR to obtain a linearized vector. The gel recovery products of Renidae luciferase and firefly luciferase and the linearized vector were obtained by nucleic acid electrophoresis and gel recovery. Homologous recombination: The gel recovery products of Renidae luciferase and firefly luciferase and the linearized vector were mixed at a mass ratio of 3:1, and 2 μL of homologous recombination enzyme were added. The mixture was reacted at 37°C for 15 minutes.

[0037] (3) Transform competent cells with plasmids, select single clones and sequence them, and amplify and extract plasmids from viral backbone vectors with correct sequencing. The transformation of competent cells and extraction steps are the same as in step (1).

[0038] 1.2. Establishing a luciferase reporter gene screening cell system

[0039] (1) The viral backbone vector containing dual luciferase and -1 Ribosomal Frameshift region, PMD2.G, and pspax2 packaging vector were mixed with PEI (polyethyleneimine) in a volume ratio of 4:2:1. 70 micrograms of PEI were added for every 35 micrograms of DNA and transfected into 293T cells.

[0040] (2) Collect the culture supernatant of 293T cells 48h and 72h after transfection with viral plasmid, centrifuge at 12000g for 10min to remove cell impurities, and then collect lentivirus particles by cesium chloride gradient centrifugation.

[0041] (3) Lentiviral particles were added to PK15 cells. After 7 days of infection, positive cells were screened by Puro. Single-cell suspensions were prepared by trypsin digestion of the cells and single-clone sorting was performed by flow cytometry.

[0042] (4) Genotyping of the cultured monoclonal cells and expansion culture of positive clones to obtain PK15 cells (CMV-Renilla-framshift-Firefly) containing the -1 Ribosomal Frameshift region.

[0043] 1.3. Drug screening based on luciferase reporter genes

[0044] (1) Five types of PK15 cells containing -1 Ribosomal Frameshift region were mixed and cultured in a 96-well plate at a ratio of 1:1:1:1:1. After 24 hours, different test compounds (control group: DMSO; experimental group: crotonin A) were added to the plate, with a drug concentration of 10 μM.

[0045] (2) After culturing for 8 hours, the cells were lysed, and firefly luciferase substrate was added to the lysate. After 0.5 hours, the luminescence value was detected by an enzyme-linked immunosorbent assay (ELISA) reader.

[0046] (3) Add the Renaissance luciferase substrate and detect the luminescence value using an enzyme-linked immunosorbent assay (ELISA) reader.

[0047] (4) The ratio of firefly luciferase to Renilla luciferase is used as a reference for the -1 Ribosomal Frameshift efficiency. A larger ratio indicates a higher -1 Ribosomal Frameshift efficiency, and a lower ratio indicates a lower -1 Ribosomal Frameshift efficiency. In other words, a lower ratio indicates a higher efficiency of the drug in inhibiting the -1 Ribosomal Frameshift process, and a better ability to inhibit the -1 Ribosomal Frameshift process.

[0048] 2. Experimental Results

[0049] Experimental results are as follows Figure 1 As shown, Figure 1 This document presents a schematic diagram of the design principle, experimental procedure, and experimental results for the inhibition of PEDV ribosomal frameshifting by crotonin A in a luciferase reporter system. Specifically, Figure 1 In the 'a' section, the reporter gene design scheme is as follows: when ribosome frameshift occurs normally, both the reporter genes Renilla and Firefly are expressed. However, when ribosome frameshift is blocked, the reporter gene Renilla is expressed, while Firefly is not expressed. Figure 1 The workflow of the multivariate mixed screening reporter system is as follows: First, the reporter vector is stably integrated into the host cell (porcine kidney cell line PK15) via a lentiviral vector. The mixed system of 5 positive monoclonal cells is then treated with compounds (control group: DMSO; experimental group: crotonin A). The effects of the compounds on the PEDV ribosome frameshift process are determined by a dual-luciferase reporter gene assay kit and an enzyme-linked immunosorbent assay (ELISA) reader. Figure 1 In the image, 'c' represents the results of the luciferase reporter gene screening experiment. (From...) Figure 1As shown in Figure c, 10 μM crotonin A significantly inhibited the -1 ribosomal frameshifting process of PEDV (G1a, G1b, G2a, G2b, G2c strains) (* indicates P < 0.05).

[0050] Example 2

[0051] Evaluation of the inhibitory effect of crotonin A on the -1 Ribosomal Frameshifting process of PEDV (fluorescent protein reporter system).

[0052] 1. Experimental Methods

[0053] 1.1. Construction of fluorescent protein reporter gene vector

[0054] (1) Synthesis of PEDV virus-1 Ribosomal Frameshift sliding region gene sequence (frameshift elements of 5 strains were synthesized respectively: G1a, G1b, G2a, G2b, G2c). The lentiviral backbone vector was double-digested with EcoRI+BamHI. Digestion conditions: 37℃, 15 minutes. After digestion, the digestion products were recovered by nucleic acid electrophoresis. For the synthesized PEDV virus-1 Ribosomal Frameshift sliding region gene sequence, it was first denatured at 95℃ for 10 minutes and annealed at 72℃ for 30 seconds. Then, the annealing product was mixed with the digestion product at a ratio of annealing product: digestion product = 3:1. 10 μL of T4 ligase was added to the above mixture and ligated in a constant temperature metal bath at 16℃ for 16 hours. Plasmid transformation of competent cells: Competent cells were removed from a -80°C freezer and thawed on ice. A lentiviral vector containing the PEDV virus-1 Ribosomal Frameshift gene sequence was added to every 100 μL of competent cells, and the mixture was incubated on ice for 30 minutes. The mixture was then placed in 42°C water for 90 seconds for heat shock. After heat shock, the mixture was cooled on ice for 10 seconds. The cooled mixture was transferred to a solid LB agar plate, and the liquid was evenly spread on the surface of the solid LB medium using a glass rod. The plate was then inverted and incubated at 37°C for 16 hours. After incubation, single-clone plaques were picked up with a pipette tip and inoculated into liquid LB medium. After incubation at 37°C for 8 hours, the plaques were sent to a commercial sequencing company for sequencing. Single clones with correct sequencing results were amplified and plasmids were extracted.

[0055] (2) By homologous recombination, ubiquitin-green fluorescent protein (Ub-GFP) was constructed upstream of the -1 Ribosomal Frameshift region, and red fluorescent protein (RFP) was constructed downstream of the -1 Frameshift region.

[0056] The specific method is as follows: The Ub-GFP and RFP gene sequences were amplified by PCR, and homologous arms were added upstream and downstream of the sequences, respectively. The vector obtained in step (1) was subjected to PCR to obtain a linearized vector. The gel-recovered products of Ub-GFP and RFP and the linearized vector were obtained by nucleic acid electrophoresis and gel recovery. Homologous recombination: The gel-recovered products of Ub-GFP and RFP and the gel-recovered product of linearized vector were mixed at a mass ratio of 3:1, and 2 μL of homologous recombinase was added. The mixture was reacted at 37°C for 15 minutes.

[0057] (3) Transform competent cells with plasmids, select single clones and sequence them, and amplify and extract plasmids from viral backbone vectors with correct sequencing. The transformation of competent cells and extraction steps are the same as in step (1).

[0058] 1.2. Establishing a fluorescent protein reporter gene screening cell system

[0059] (1) The viral backbone vector containing dual fluorescent protein and -1 Ribosomal Frameshift region, PMD2.G, and pspax2 packaging vector were mixed with PEI in a volume ratio of 4:2:1. 70 micrograms of PEI were added for every 35 micrograms of DNA and transfected into 293T cells.

[0060] (2) Collect the culture supernatant of 293T cells 48h and 72h after transfection with viral plasmid, centrifuge at 12000g for 10min to remove cell impurities, and then collect lentivirus particles by cesium chloride gradient centrifugation.

[0061] (3) Lentiviral particles were added to PK15 cells. After 7 days of infection, positive cells were screened by Puro. Single-cell suspensions were prepared by trypsin digestion of the cells and single-clone sorting was performed by flow cytometry.

[0062] (4) Genotyping of cultured monoclonal cells and expansion culture of positive clones to obtain PK15 cells (CMV-Ub-GFP-framshift-RFP) containing -1Ribosomal Frameshift region.

[0063] 1.3. Drug screening based on fluorescent protein reporter genes

[0064] (1) Five PK15 fluorescent reporter gene cells containing -1 Ribosomal Frameshift region were mixed and cultured in a 96-well plate at a ratio of 1:1:1:1:1. After the cells were plated for 24 hours, different test compounds (control group: DMSO; experimental group: crotonin A) were added to the plates. The drug concentration was 10 μM for all groups, and autofluorescent compounds were excluded.

[0065] (2) After culturing for 8 hours, MG132 was added, and after culturing for 4 hours, the changes in fluorescence signal were observed under a high-content fluorescence microscope.

[0066] (3) The ratio of RFP to GFP is used as a reference for the efficiency of -1 Ribosomal Frameshift. The larger the ratio, the higher the efficiency of -1 Ribosomal Frameshift; the lower the ratio, the lower the efficiency of -1 Ribosomal Frameshift. In other words, the lower the ratio, the higher the efficiency of the drug in inhibiting the -1 Ribosomal Frameshift process, and the better it can inhibit the -1 Ribosomal Frameshift process.

[0067] 2. Experimental Results

[0068] Experimental results are as follows Figure 2 As shown, Figure 2 This document presents a schematic diagram of the design principle, experimental procedure, and experimental results for the inhibition of PEDV ribosomal frameshifting by crotonin A in a fluorescent protein reporter system. Specifically, Figure 2 In the design scheme of the fluorescent protein reporter system, when the ribosome is frameshifted, both the reporter genes GFP and RFP are expressed. When the ribosome frameshift is blocked, the reporter gene GFP is expressed, but RFP is not expressed. Figure 2 In section b, the workflow of the fluorescent protein reporter system is as follows: First, the reporter vector is stably integrated into the host cell (PK15 cell) via a lentiviral vector. Positive monoclonal cells are then treated with compounds (control group: DMSO; experimental group: crotonin A). Fluorescence images are obtained using a high-content fluorescence microscope, and the inhibitory effect of the compounds on the PEDV ribosome frameshift process is determined by fluorescence signal analysis. Figure 2 In the figure, c represents the experimental results of the fluorescent protein reporter system. Figure 2 As shown in Figure c, 10 μM crotonin A significantly inhibited the -1 ribosomal frameshifting process of PEDV (G1a, G1b, G2a, G2b, G2c strains) (* indicates P < 0.05).

[0069] Example 3

[0070] Evaluation of the in vitro antiviral activity and cytotoxicity of crotonin A

[0071] 1. Experimental Methods

[0072] Experiments were conducted under P2 laboratory conditions. PEDV virus (G2c strain) was cultured in Vero (African green monkey kidney) cells, and trypsin was added to promote viral adsorption. Two hours after infection, the culture medium was replaced with normal medium, and a compound (Brucea javanica extract A) was added at concentrations of 0.01, 0.0625, 0.125, 0.25, 0.5, 1, 2, 5, 10, 20, 40, and 80 μM. Lesions were observed after 48 hours. Viral replication levels were detected using quantitative real-time PCR. The relationship between drug concentration and viral inhibition rate was calculated, and the viral inhibition rate EC was determined by fitting a curve. 50 Cells were treated with drugs at concentrations of 0.01, 0.0625, 0.125, 0.25, 0.5, 1, 2, 5, 10, 20, 40, and 80 μM individually. Cell viability was determined by the CCK8 assay, and the cytotoxicity rate (CC) was calculated using a fitted curve. 50 The calculation of the selection index SI is CC. 50 / EC 50 .

[0073] 2. Experimental Results

[0074] Experimental results are as follows Figure 3 As shown, the toxicity marker CC of crocin A in Vero cells 50 The concentration was 13.66 μM, which is the half-maximal cytotoxic concentration (CMC) of crotonin A in Vero cells. 50 The concentration was 13.66 μM; crotonin A inhibited the -1 Ribosomal Frameshifting process of PEDV, with a half-maximal effective concentration (EC50) of 13.66 μM. 50 The concentration was 0.051 μM; the selectivity index (SI) was 267.84. An SI value greater than 5.00 indicates that the drug is effective and has high safety, and the larger the value, the wider the safety range of the drug.

[0075] Example 4

[0076] To evaluate the antiviral effect of crotonin A in in vitro cultured cells.

[0077] 1. Experimental Methods

[0078] Experiments were conducted under P2 laboratory conditions. PEDV virus (G2c strain) was cultured in Vero (African green monkey kidney) cells, and trypsin was added to promote viral adsorption. Two hours after infection, the culture medium was replaced with normal medium, and a compound (DMSO or crocin A) at a concentration of 1 μM was added. The images were taken under a bright-field microscope after 48 hours.

[0079] 2. Experimental Results

[0080] Experimental results are as follows Figure 4 As shown, Vero cells uninfected with PEDV exhibited good growth and no viral cytopathic effect (CPE). After PEDV infection, the solvent-treated group (DMSO) showed extensive CPE and extremely poor cell condition, while the crotonin A treatment group showed a significant reduction in CPE, with cell condition approaching that of the uninfected group. This indicates that crotonin A has a significant inhibitory effect on PEDV G2c-induced CPE in Vero cells.

[0081] Example 5

[0082] To evaluate the antiviral effect of crotonin A against different PEDV strains (G1a, G1b, G2a, G2b, and G2c).

[0083] 1. Experimental Methods

[0084] Experiments were conducted under P2 laboratory conditions. PEDV virus (G1a, G1b, G2a, G2b, and G2c strains) were cultured in Vero (African green monkey kidney) cells, and trypsin was added to promote viral adsorption. Two hours after infection, the culture medium was replaced with normal medium, and a compound (Brucea javanica extract A) at a concentration of 1 μM was added. Viral replication levels were detected by quantitative real-time PCR after 48 hours.

[0085] The qPCR primers are as follows:

[0086] PEDV MF GGTTGCTACTGGCGTACAGGTA,

[0087] PEDV MR GAAGCATTGACTGAACGACCAACA;

[0088] GAPDH-F GAAGGTGAAGGTCGGAGTCA,

[0089] GAPDH-R CATGTAAACCATGTAGTTGAGGTC.

[0090] 2. Experimental Results

[0091] Experimental results are as follows Figure 5 As shown. Figure 5 The results of RT-PCR assays were used to detect the antiviral activity of crotonin A against PEDV strains G1a, G1b, G2a, G2b, and G2c. Figure 5It is evident that crotonin A exhibits highly significant antiviral effects against PEDV strains G1a, G1b, G2a, G2b, and G2c (*** indicates P < 0.001), suggesting that crotonin A possesses a broad-spectrum antiviral effect against PEDV.

[0092] Example 6

[0093] To evaluate the antiviral effect of bruceine A against PEDV in live pigs.

[0094] 1. Experimental Methods

[0095] Dissolve crotonin A (the drug) in DMSO. Select 21-day-old PEDV antibody-negative weaned piglets (10 piglets per group) and divide them into an experimental group (challenge + drug treatment), a positive control group (challenge + DMSO), and a negative control group (no challenge). After 7 days of pre-feeding, the piglets were orally inoculated with 10.0 TCID50 (median infectious dose of tissue culture) of PEDV-G2c strain. The administration method was intramuscular injection at a dose of 10 mg / kg body weight, once a day. Diarrhea score, body temperature, and feed intake were recorded. Seven days after challenge, jejunal tissue was collected to detect viral load. Biosafety measures (glutaraldehyde disinfection, protective clothing operation) were performed throughout the experiment.

[0096] 2. Experimental Results

[0097] Experimental results are as follows Figure 6 As shown, Figure 6 The viral load in the jejunal tissue of the experimental group and the positive control group was determined by... Figure 6 It is evident that crotonin A has a highly significant antiviral effect against PEDV (*** indicates P < 0.001).

Claims

1. Application of Brucea javanica extract A in the preparation of drugs against porcine epidemic diarrhea virus.

2. The application of crotonin A according to claim 1 in the preparation of drugs against porcine epidemic diarrhea virus, characterized in that, The drug is a drug for the prevention and / or treatment of porcine epidemic diarrhea caused by porcine epidemic diarrhea virus infection.

3. The application of crotonin A according to claim 1 in the preparation of drugs against porcine epidemic diarrhea virus, characterized in that, The drug is used to inhibit the replication of porcine epidemic diarrhea virus.

4. The application of crotonin A according to claim 1 in the preparation of drugs against porcine epidemic diarrhea virus, characterized in that, The drug is used to inhibit the proliferation of porcine epidemic diarrhea virus.

5. The application of crotonin A according to claim 1 in the preparation of drugs against porcine epidemic diarrhea virus, characterized in that, The porcine epidemic diarrhea virus includes one or more genotypes of the strains G1a, G1b, G2a, G2b, and G2c.

6. The application of crotonin A according to claim 1 in the preparation of drugs against porcine epidemic diarrhea virus, characterized in that, The drug comprises crotonin A and pharmaceutically acceptable excipients.

7. The use of crocin A according to any one of claims 1 to 6 in the preparation of a drug for treating porcine epidemic diarrhea virus, characterized in that, The crocin A inhibits the replication and proliferation of porcine epidemic diarrhea virus (PEDV) or prevents PEDV by inhibiting the -1 ribosome frameshift process of PEDV.

8. The use of crocin A according to any one of claims 1, 2, or 6 in the preparation of a drug for treating porcine epidemic diarrhea virus, characterized in that, The drug is an oral preparation or an injection.

Images