Porcine epidemic diarrhea virus strain and application thereof
By optimizing the isolation and culture of porcine epidemic diarrhea virus strain LN21022 and preparing an inactivated vaccine, the problem of non-type immunization in existing vaccines was solved, achieving a highly effective prevention of porcine epidemic diarrhea.
Patent Information
- Application Number
- CN202510664389.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-22
- Publication Date
- 2026-02-13
AI Technical Summary
Existing porcine epidemic diarrhea virus vaccines suffer from immunogenicity issues when facing the prevalence of G2 subgroup strains, resulting in widespread porcine epidemic diarrhea in pig farms and a lack of effective therapeutic drugs and highly effective vaccines.
A strain of porcine epidemic diarrhea virus (PEDV) LN21022 was provided. Through optimized isolation and culture, an inactivated vaccine was prepared. High-purity antigen solution was obtained using hollow fiber column concentration and PEG purification technology to prepare a water-in-oil-in-water inactivated vaccine for the prevention of porcine epidemic diarrhea.
It improves the safety and efficacy of the vaccine, effectively prevents and controls swine epidemic diarrhea, reduces injection reactions, induces high-titer neutralizing antibodies, and provides an effective means of controlling swine epidemic diarrhea.
Smart Images

Figure CN121518404A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of veterinary biological products technology, and in particular to a strain of porcine epidemic diarrhea virus and its application. Background Technology
[0002] Porcine epidemic diarrhea (PED) is a highly contagious intestinal disease caused by a porcine enteric coronavirus, porcine epidemic diarrhea virus (PEDV). Its main characteristics include watery diarrhea, vomiting, dehydration, and high mortality in newborn piglets. PED virus was first identified in the UK and Belgium in 1978. Since then, PED has been reported in many European countries and regions, excluding the Americas. In 1984, my country first identified PEDV as one of the pathogens causing swine diarrhea, successfully culturing and passaged it on primary monolayer cells of intestinal tissue. The presence of PED in China was confirmed by indirect immunofluorescence assays and serum neutralization tests. In 1995, my country effectively controlled the spread of PEDV by using a bivalent inactivated vaccine combining PEDV and TGEV. However, since 2006, PED outbreaks have continued in pig farms that had been vaccinated, causing very serious economic losses to my country's pig farming industry.
[0003] The PEDV genome is an infective, single-stranded, positive-sense RNA virus, approximately 28 kb in length. PEDV's structural proteins mainly include the S, E, M, and N proteins. The S protein, a spike glycoprotein located on the surface of the viral particle, participates in the adsorption and fusion of the virus with host cells and is also the main antigenic molecule inducing the production of neutralizing antibodies in the host. The S protein is also a major structural protein in porcine epidemic diarrhea virus (PEDV) mutations. Based on variations in the gene encoding the S protein, PEDV can be divided into two gene groups: the G1 and G2 gene subgroups. Although there is cross-protection between the two subgroups, it is weak. Recent epidemiological surveys indicate that since 2010, the circulating PEDV strains in my country have undergone significant changes, with the mutated G2 subgroup becoming dominant, while the G1 subgroup also exists. This is the main reason why outbreaks still occur in immunized pig herds.
[0004] Like other viral diseases, there are currently no effective therapeutic drugs for porcine epidemic diarrhea (PED), and immunization is the most effective method for prevention and control. Early commercially available PED vaccines primarily used the G1 subgroup, represented by CV777. With the rise of the G2 subgroup, G2 subgroup vaccines were gradually introduced, achieving good immunization effects. However, recombination and mutation between different genotypes of wild-type strains have led to vaccine mismatch in pig farms, resulting in antibodies that cannot effectively exert a specific neutralizing effect. Clinically, this manifests as a situation where, despite the abundance of commercially available vaccines, porcine epidemic diarrhea remains widespread in pig farms. Given the still very serious epidemic situation, developing a PED vaccine targeting prevalent strains is urgently needed. Summary of the Invention
[0005] (a) Technical problems to be solved
[0006] The purpose of this invention is to provide a porcine epidemic diarrhea virus strain and its application. This strain is an optimized isolated and cultured porcine epidemic diarrhea virus strain that can be stably passaged, providing a foundation for effective vaccine preparation and prevention and control of porcine epidemic diarrhea.
[0007] (II) Technical Solution
[0008] The first aspect of this invention discloses a strain of porcine epidemic diarrhea virus, named porcine epidemic diarrhea virus strain LN21022, which was deposited on November 25, 2024, at the China General Microbiological Culture Collection Center (CGMCC). The address of the depository is: Institute of Microbiology, Chinese Academy of Sciences, No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing, 100101, China; the classification name is: porcine epidemic diarrhea virus; the Latin scientific name is: Porcine epidemic diarrhea virus; and the accession number is CGMCCNO.46295.
[0009] In a second aspect, the present invention also discloses the application of the aforementioned porcine epidemic diarrhea virus strain in the preparation of a drug for the prevention of diseases caused by porcine epidemic diarrhea virus.
[0010] In a third aspect, the present invention further proposes a vaccine containing inactivated porcine epidemic diarrhea virus or a culture thereof.
[0011] Furthermore, the vaccine comprises an inactivated antigen prepared from the porcine epidemic diarrhea virus or a culture thereof, and an adjuvant.
[0012] Furthermore, the viral fluid used to prepare the vaccine contains a virus strain derived from the porcine epidemic diarrhea virus as an inactivated antigen, and the viral content is ≥10. 7.00 TCID50 / ml.
[0013] In a fourth aspect, the present invention also provides a method for preparing an inactivated porcine epidemic diarrhea virus vaccine, comprising: mixing and emulsifying an aqueous phase containing an inactivated antigen from the porcine epidemic diarrhea virus strain with a vaccine adjuvant to obtain an inactivated porcine epidemic diarrhea virus vaccine.
[0014] Furthermore, the mixing and emulsification process includes: mixing the aqueous phase with the vaccine adjuvant and emulsifying at 30-33°C for at least 30 minutes.
[0015] Further, the inactivation method includes: mixing 0.25‰ of β-propiolactone and inactivating it at 80–100 r / min and 0–8 °C; then hydrolyzing it in a water bath at 35–40 °C.
[0016] Furthermore, inactivation for more than 24 hours; and / or hydrolysis for more than 24 hours.
[0017] In a fifth aspect, the present invention further proposes the application of an inactivated vaccine, or a method for preparing an inactivated vaccine, as described above, in the preparation of a drug for preventing diseases caused by porcine epidemic diarrhea virus.
[0018] (III) Beneficial Effects
[0019] Compared with existing technologies, the beneficial effects of this invention are as follows: The porcine epidemic diarrhea virus (PEDV) LN21022 provided by this invention is a domestically prevalent strain. This strain has strong virulence and good immunogenicity. Because this strain is isolated from the small intestine of clinically ill piglets, it is suitable for use in inactivated vaccines with good immunization efficacy. The PEDV inactivated vaccine provided by this invention utilizes hollow fiber column concentration and PEG purification to prepare porcine epidemic diarrhea virus antigen, which can remove most of the impurity proteins, thereby obtaining a purer antigen solution with a higher titer for vaccine preparation, thus improving the safety and efficacy of the prepared inactivated vaccine. Safety and efficacy tests of the finished vaccine show that the PEDV inactivated vaccine prepared by this invention does not cause significant local or systemic adverse reactions due to injection and can be used for the prevention and control of porcine epidemic diarrhea. Attached Figure Description
[0020] Figure 1 These are optical microscope images of Vero cells infected with the primary strain of PEDV / LN21022 provided by this invention; A is a negative control; B is Vero cells infected with the primary strain of PEDV / LN21022.
[0021] Figure 2 This is an electron microscope image of the PEDV / LN21022 strain provided by the present invention.
[0022] Figure 3 The image shows the homology analysis results for strain LN21022.
[0023] Figure 4 The phylogenetic tree analysis results for strain LN21022 are shown in the figure.
[0024] The porcine epidemic diarrhea virus strain LN21022 provided was deposited on November 25, 2024, at the China General Microbiological Culture Collection Center (CGMCC). The address of the depository is: Institute of Microbiology, Chinese Academy of Sciences, No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing; Postcode: 100101; Classification and Nomenclature: Porcine epidemic diarrhea virus; Latin name: Porcine epidemic diarrhea virus; Accession number: CGMCC NO.46295. Detailed Implementation
[0025] The present invention will be further described below with reference to specific embodiments, and the advantages and features of the present invention will become clearer with the description. However, the embodiments are merely exemplary and do not constitute any limitation on the scope of the present invention. Those skilled in the art should understand that modifications or substitutions can be made to the details and form of the technical solutions of the present invention without departing from the spirit and scope of the present invention, but all such modifications and substitutions fall within the protection scope of the present invention.
[0026] Unless otherwise specified, the methods used in the following examples are conventional methods. For specific steps, please refer to: Molecular Cloning: A Laboratory Manual (Sambrook, J., Russell, David W., 3rd edition, 2001, NY, Cold Spring Harbor).
[0027] The methods for obtaining various biological materials described in the embodiments are merely to provide experimental methods for specific disclosure purposes and should not be construed as limiting the sources of biological materials used in this invention. In fact, the sources of biological materials used are wide-ranging, and any biological material that can be obtained without violating laws and ethical standards can be substituted and used according to the suggestions in the embodiments.
[0028] Example 1: Isolation and Identification of Porcine Epidemic Diarrhea Virus (PEDV) Strain LN21022
[0029] 1. Materials and Methods
[0030] 1.1 Virus isolation
[0031] Small intestines were collected from pigs infected with epidemic diarrhea in a swine farm in Liaoning Province, my country. The collected small intestines were suspended in DMEM at a volume ratio of 1:5, ground, and subjected to a freeze-thaw cycle at -80°C. The suspension was then centrifuged at 12000 rpm for 30 min at 4°C. The supernatant was filtered through a 0.22 μm filter to obtain a virus suspension, which was then treated with double antibiotics (100 μg streptomycin / ml and 100 U penicillin / ml) and stored at -4°C for later use. Rapid freezing of the small intestine suspension at -80°C during virus isolation accelerated the release of the virus from the placenta while minimizing the loss of live virus during freezing, thus increasing the success rate of virus isolation.
[0032] VERO cells (25cm) 2 After forming a monolayer by culturing at 37℃ for 24–48 h, each bottle was inoculated with 1 ml of filtered supernatant of the diseased suspension (containing trypsin at a final concentration of 10 μg / ml). After adsorption for 1–2 h, 10 ml of DMEM medium containing double antibiotics (100 μg streptomycin / ml and 100 U penicillin / ml) was added, and the culture was continued at 37℃. Cytopathic effect (CPE) was observed for 3–5 days. When more than 90% of the cells showed CPE changes, the virus was harvested. The F1 strains with CPE were identified by PCR amplification using primers for the S gene of PEDV.
[0033] PEDV-F (SEQ ID NO.2): AATGGTAAGTTGCTAGTGCGT;
[0034] PEDV-R (SEQ ID NO. 3):GGTTTAGGCGTGCCAGTAATC.
[0035] Tests have shown that the isolated strain is a PED virus, named porcine epidemic diarrhea virus strain LN21022.
[0036] The full sequence of strain LN21022 was determined, and its sequence is shown in SEQ ID NO.1. Figure 3 and Figure 4 As shown, strain LN21022 shares 96.7% homology with the whole genome sequence of CV777 (accession number AF353511.1) in GenBank, and 98.7% homology with the whole genome sequence of AJ1102 (accession number JX188454.1). Figure 4 The phylogenetic tree shown indicates that strain LN21022 is closely related to strains AJ1102 and CV777.
[0037] The virus strain was deposited at the China General Microbiological Culture Collection Center, located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, with the accession number CGMCC NO. 46295, and the deposit date was November 25, 2024.
[0038] 1.2 Culture and Plaque Purification of Toxins
[0039] Vero cells for virus culture were cultured in DMEM cell culture medium containing 10% fetal bovine serum. Vero cells were then revived using this cell culture medium or passaged in sterile cell culture flasks until a healthy cell monolayer was formed, at which point the cells were used for virus inoculation.
[0040] The isolated porcine epidemic diarrhea virus (PEDV) strain LN21022 was serially diluted 10-fold with DMEM to 10⁻¹ to 10⁻⁴. The culture medium in the six-well plates containing Vero cells that had grown into a dense monolayer was discarded. After washing twice with maintenance medium, 400 μL of the virus solution (containing 4 μg of trypsin) at the above different dilutions was added to each well. After incubation for 1 hour, the liquid was discarded, and a first layer of nutrient agar about 3 mm thick was added. The nutrient agar consisted of equal volumes of 2% low-melting-point agarose and 2×DMEM (containing 20 μg / ml of trypsin). After standing at room temperature for 30 minutes, the cells were incubated upside down at 37°C and 5% CO₂ for 3 days. When the cells showed lesions, a second layer of nutrient agar was added. After standing at room temperature for 30 minutes, the cells were incubated upside down at 37°C and 5% CO₂ in the dark. The growth of lesions was observed and recorded daily.
[0041] After plaque formation, small and isolated plaques were selected from the cell pores, aspirated with a 10 μl pipette tip, and placed together with agarose into 1.0 ml of serum-free DMEM. The plaques were repeatedly frozen and thawed three times to ensure full release of the virus. New blank Vero cells were then inoculated to promote viral proliferation. This cloning process was repeated three times. Five plaques from the fourth-generation clone were randomly selected for passage culture. After passage to the 10th generation, the viral content of each passage was measured. The strain with the highest viral content was selected as the purified porcine epidemic diarrhea virus LN21022.
[0042] 1.3 Determination of the toxicity of the poison
[0043] Take a 96-well cell culture plate containing well-grown, monolayered Vero cells, discard the cell culture medium, and wash twice with PBS. Serially diluted 10-fold with serum-free DMEM medium, and inoculate 10⁻²-10⁻⁶ dilutions into 96-well cells, four wells per dilution. Positive and negative controls were also included. The plates were incubated at 37°C in a 5% CO₂ incubator for 3-5 days, and CPE was observed and recorded daily. Viral titers were calculated using the Reed-Muench method. The results are shown in Table 1. The results indicate that the porcine epidemic diarrhea (PED) plaque virus strain PEDV / LN21022 can be stably passaged in Vero cells, yielding high-titer viral solutions, and can be used as a candidate strain for a porcine epidemic diarrhea (PED) vaccine.
[0044] Table 1. Results of Virus Tit Determination for Bantamvirus Strains
[0045]
[0046] 1.4 Electron Microscopy Observation
[0047] Porcine epidemic diarrhea virus (PEDV / LN21022) virus solution was centrifuged at 10,000 rpm for 30 minutes. The supernatant was then centrifuged at 40,000 rpm for 5 hours. The supernatant was discarded, and the precipitate was dissolved in 0.5 ml of deionized water. The solution was then negatively stained with 2% sodium phosphotungsten for 30 minutes and allowed to air dry at room temperature before observation under a transmission electron microscope. Figure 2 As shown, the virus particles of this isolate are approximately spherical, with a size of about 90-150 nm, and have an envelope, which is consistent with the characteristics of porcine epidemic diarrhea virus.
[0048] 1.5 Virus Pathogenicity Experiment
[0049] PEDV / LN21022 isolated viral fluid (10) 6 After centrifuging at 10,000 rpm for 15 minutes with TCID50 / ml, the virus solution was serially diluted 10-fold using serum-free DMEM medium. Five piglets were inoculated with each dilution (50-10⁻⁵ TCID50 / ml) at 3-5 days of age (sow neutralizing antibody <1:4). Each piglet was orally inoculated with 2ml of the solution. Empty DMEM was used as a negative control. The clinical symptoms of the piglets were observed daily for 7 days. Results showed that diarrhea began in piglets 16 hours after inoculation, and deaths occurred subsequently. The diarrhea and mortality rates are shown in Table 2.
[0050] Table 2 Clinical symptoms in piglets challenged with PEDV / LN / 21022 strain
[0051]
[0052] Anal swabs were collected daily after piglets were inoculated with the virus for PCR testing. The virus shedding status was recorded as shown in Table 2. The results showed that all anal swabs collected on the day of inoculation were negative for PCR, while those collected 24 hours later were positive for PCR.
[0053] Table 3. Virus shedding in piglets challenged with PEDV / LN / 21022 strain
[0054]
[0055]
[0056] Intestinal tissue from one dead piglet in each group was ground and inoculated into Vero cells according to method 1.1 to isolate the virus. Results showed that, except for 10... 2.0 TCID50 and 10 1.0 Intestinal tissue from the remaining groups in the TCID50 group showed cytopathic effects after blind passage.
[0057] Example 2: Preparation of Virus Inactivated Vaccine
[0058] 2.1 Preparation of porcine epidemic diarrhea virus seed virus
[0059] Take Vero adherent cells that have grown into a well-developed monolayer, discard the original culture medium, add an appropriate amount of maintenance medium (DMEM medium containing trypsin at a final concentration of 10 μg / ml), and then add PEDVLN / 21022 virus strain at a ratio of 1% (v / v). Incubate at 37°C under 5% CO2 conditions. When cytopathic effects reach ≥80%, harvest the virus solution and freeze-thaw three times to obtain the basal seed virus. Calculate the TCID50 of this basal seed virus using the Reed-Muench method. The calculated viral load of this seed virus is no less than 10. 6.5 TCID50 / ml.
[0060] 2.2 Antigen concentration and purification: Take the virus solution prepared in step 2.1, thaw it, and centrifuge it at 8000 rpm for 40 min to obtain a clear supernatant. Use a 500 KD hollow fiber column to concentrate the antigen solution 10 times (during the concentration process, it is necessary to wash and filter with PBS to replace the virus maintenance solution) to obtain the antigen concentrate.
[0061] Add PEG6000 to the prepared antigen concentrate to a final concentration of 8% (v / v), mix well at 2-8℃ (for at least 2 hours), let stand overnight, centrifuge at 6000-10000 rpm for at least 15 minutes, discard the supernatant, collect the precipitate, and resuspend in PBS (pH 7.4, concentration 0.06 mol / L) to obtain the purified antigen solution for vaccine preparation. Calculate the TCID50 of this antigen solution using the Reed-Muench method. The calculated virus content of this antigen solution is not less than 10. 7.0TCID50 / ml.
[0062] 2.3 Purity test of antigen solution used for seedling preparation
[0063] According to the current appendix of the Chinese Veterinary Pharmacopoeia, the test results showed that the basic strain was free from bacterial, mycoplasma, and exogenous viral contamination.
[0064] 2.4 Inactivation of virus solution for vaccine preparation
[0065] β-propiolactone was inactivated at a ratio of 1:3000 (v / v) at 4℃ for 28 h, followed by hydrolysis at 37℃ for 2 h to obtain the inactivated antigen solution. The inactivated virus solution was diluted with DMEM culture medium containing 10 μg / ml trypsin and seeded into well-grown Vero adherent cells at a culture medium ratio of 10% (v / v). Two controls were set up using the same method: one bottle contained normal cells, and the other bottle contained maintenance medium containing β-propiolactone and hydrolyzed at 37℃ for 2 h (β-propiolactone content was consistent with the inactivated antigen solution). The cells were incubated at 37℃ in a 5% CO2 incubator for 5 days, and observed daily. After three freeze-thaw cycles at -80℃, the cultures were blindly passaged three times using the same method, and cell erosion (CPE) was observed in each passage. The results showed that no CPE was produced, confirming complete inactivation.
[0066] 2.5 Vaccine Preparation
[0067] 2.5.1) Aqueous phase preparation: Take the qualified inactivated antigen solution prepared in step 2.4 as the aqueous phase.
[0068] 2.5.2) Preparation of oil phase: Take 206 adjuvant (purchased from SECICO (Shanghai) Specialty Chemicals Co., Ltd., item number: 36022E), filter and sterilize it, and preheat it to 30°C to obtain the oil phase.
[0069] 2.5.3) Emulsification: Mix the aqueous phase and oil phase at a mass ratio of 1:1 (add the aqueous phase to the oil phase), emulsify at 30-33℃ for 30 minutes, dispense the emulsified vaccine according to the specifications, label it, and store it at 2-8℃ for later use.
[0070] 2.6 Vaccine Testing
[0071] 2.6.1) Characteristics
[0072] (1) Appearance: Milky white or light pink viscous emulsion.
[0073] (2) Dosage form: Water-in-oil-in-water (W / O / W). Take a clean pipette, draw a small amount of vaccine and drop it onto a clean, cold water surface. It will diffuse in a cloud-like manner.
[0074] (3) Stability: Add 10.0 ml of vaccine to a centrifuge tube and centrifuge at 3000 r / min for 15 minutes. The amount of water separated at the bottom of the tube should not exceed 0.5 ml.
[0075] (4) Viscosity: Tested according to the appendix of the current Chinese Veterinary Pharmacopoeia, it should not exceed 200 cP.
[0076] 2.6.2) Content inspection: The content shall be inspected in accordance with the appendix of the current Chinese Veterinary Pharmacopoeia and shall comply with the regulations.
[0077] 2.6.3) Sterility test: The test shall be conducted in accordance with the appendix of the current Chinese Veterinary Pharmacopoeia, and no sterile growth shall be observed.
[0078] 2.6.4) Endotoxin content detection: Take 12ml of vaccine and place it in a 15ml centrifuge tube. Incubate at 50±5℃ for 90 minutes, then centrifuge at 15000g for 10 minutes at 4℃. Take 5.0ml of the aqueous phase and test it according to Appendix I of the current Chinese Veterinary Pharmacopoeia. The endotoxin content of each dose of vaccine should not exceed 20EU.
[0079] 2.6.5) Safety Inspection
[0080] (1) Small animal testing: Five guinea pigs weighing 350-400g were subcutaneously injected with 0.5ml of vaccine. They were observed daily for 7 days. No deaths, obvious local reactions, or systemic adverse reactions caused by the vaccine injection should occur.
[0081] (2) Animal testing: Five healthy susceptible pigs aged 2-6 months were injected with 4.0 ml (2 doses) of vaccine into the neck muscle of each pig. They were observed daily for 14 days. None of them should show clinical symptoms caused by PEDV or obvious local or systemic adverse reactions caused by the vaccine injection.
[0082] The safety test results of the vaccine prepared using the qualified inactivated antigen solution prepared in step 2.4 are shown in Table 5 below. It can be seen that no death or obvious local or systemic adverse reactions caused by the injection of the vaccine occurred, whether tested on small animals or on the animal itself, indicating that the PED inactivated vaccine prepared by this invention is safe.
[0083] Table 5. Vaccine Safety Inspection Status
[0084]
[0085] 2.6.6 Efficacy Testing
[0086] Ten 8-12 week old pigs that were negative for both PEDV antigen and antibody were randomly divided into two groups of five each. The immunized group received a PED / LN21022 strain inactivated vaccine via intramuscular injection in the neck, at a dose of 2 mL per pig, followed by a booster immunization with the same dose 14 days later. The other group served as a blank control and was not vaccinated. Blood samples were collected from all pigs before immunization, 14 days after the first immunization, 14 days after the second immunization, and 28 days after the second immunization. Serum was separated, and the levels of PEDV IgG ELISA antibodies and neutralizing antibodies were measured. The PEDV IgG antibody level was detected using the Korean Anjie PEDV IgG antibody diagnostic kit. The results are shown in Table 6 below.
[0087] Table 6 Results of antibody titer detection in immunized pigs
[0088]
[0089]
[0090] The above results indicate that pigs immunized with the inactivated vaccine prepared using the porcine epidemic diarrhea virus strain provided by this invention, aged 2-6 months, can develop high-titer neutralizing antibodies against porcine epidemic diarrhea virus (≥64) 28 days after the second immunization. Therefore, the inactivated vaccine provided by this invention can effectively protect against porcine epidemic diarrhea virus infection. This invention provides a porcine epidemic diarrhea virus strain with good passage stability, strong pathogenicity, good immunogenicity, and the ability to induce high-titer neutralizing antibodies with a long duration. When prepared into a vaccine, this strain can specifically prevent or treat diseases caused by porcine epidemic diarrhea virus, providing important medical value for the prevention and treatment of porcine epidemic diarrhea virus infection.
[0091] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.
Claims
1. A strain of porcine epidemic diarrhea virus, characterized in that, CGMCC NO. 46295.
2. The strain of porcine epidemic diarrhea virus according to claim 1 for use in the preparation of a medicament for preventing the disease caused by porcine epidemic diarrhea virus.
3. A vaccine, characterized in that, The medicament contains the inactivated porcine epidemic diarrhea virus according to claim 1 or culture thereof.
4. The vaccine of claim 3, characterized in that, The vaccine contains inactivated antigens prepared from the porcine epidemic diarrhea virus or culture thereof and adjuvants.
5. The vaccine of claim 3, characterized in that, The virus content of the virus liquid containing the porcine epidemic diarrhea virus strain as inactivated antigen prepared for the preparation of a vaccine is ≥ 10 7.00 TCID50 / ml.
6. A method of preparing the porcine epidemic diarrhea virus inactivated vaccine of claim 4, comprising: The water phase containing inactivated antigens from the strain of porcine epidemic diarrhea virus according to claim 1 is mixed and emulsified with vaccine adjuvants to prepare the inactivated vaccine of porcine epidemic diarrhea virus.
7. The production method according to claim 6, characterized by, The mixing and emulsifying operation includes mixing the water phase with vaccine adjuvants and then emulsifying at 30-33℃ for more than 30 minutes.
8. The preparation method according to claim 6, characterized in that, The inactivation method includes mixing 0.25‰ β-propiolactone and then inactivating at 80-100 r / min and 0-8℃; and then hydrolyzing in a water bath at 35-40℃.
9. The preparation method according to claim 7, characterized in that, The inactivation is for more than 24 hours; and / or, the hydrolysis is for more than 24 hours.
10. The use of the inactivated vaccine according to any one of claims 3 to 5, or the preparation method of the inactivated vaccine according to any one of claims 6 to 9 in the preparation of a medicament for preventing the disease caused by porcine epidemic diarrhea virus.