Bacteroides uniformis with activity against porcine epidemic diarrhea virus and application thereof

Abstract

The present application relates to the technical field of biotechnology, and aims to provide a Bacteroides uniformis with activity against porcine epidemic diarrhea virus and application thereof. The strain is preserved in China Center for Type Culture Collection, and the preservation name is Bacteroides uniformis ZJNB01, the Latin name is Bacteroides uniformis, and the preservation number is CCTCC NO: M 20241757. The porcine-derived Bacteroides uniformis has significant probiotic properties; due to rapid growth, it has strong resistance to porcine epidemic diarrhea virus. The Bacteroides uniformis and / or its metabolites can be used as a drug active center to produce a drug agent, and have a wide application scenario in the prevention and treatment of porcine epidemic diarrhea virus.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biotechnology, in particular to a Bacteroides uniformis with anti-swine epidemic diarrhea virus function and its application. BACKGROUND

[0002] Various epidemic diseases are one of the most important factors restricting the healthy development of the pig breeding industry, especially the pig diarrhea disease caused by porcine epidemic diarrhea virus (PEDV), which causes the most serious harm and huge direct economic impact every year. PEDV causes acute diarrhea, vomiting, dehydration, etc. in piglets, with a mortality rate of 100%. As an animal coronavirus, PEDV has the characteristics of frequent variation, leading to the repeated emergence of new mutant strains, resulting in poor cross-protection effect of existing vaccines. In view of the breeding mode adopted by modern industry, the pig enteric coronavirus prevention and control strategy puts forward new requirements for green safety, and it is urgent to carry out research and development of new natural antiviral drugs.

[0003] The intestinal microecology is composed of a large number of bacteria, fungi, viruses and their environment, and the intestinal microorganisms are mutually restricted and dependent, and jointly maintain the stability of the intestinal microecology, which is crucial for the body to resist intestinal pathogens. Existing research results show that oral Bacteroides uniformis has good safety and is a kind of intestinal probiotics with good development and application prospect. However, the existing oral Bacteroides uniformis is still mainly used for improving the intestinal environment, enhancing the intestinal mucosal barrier function, and promoting the development of the immune system.

[0004] At present, there is no related report on the use of Bacteroides uniformis for antiviral (especially PEDV) research. SUMMARY

[0005] The technical problem to be solved by the present application is to overcome the deficiencies in the prior art and provide a Bacteroides uniformis with anti-swine epidemic diarrhea virus activity and its application.

[0006] To solve the above technical problems, the solution adopted by the present application is:

[0007] A Bacteroides uniformis with anti-swine epidemic diarrhea virus activity is provided, which is preserved in the China Center for Type Culture Collection (address: Wuhan University, Wuhan, Hubei, China, postcode: 430072, contact number: 027-68754052). The preserved strain is Bacteroides uniformis ZJNB01, the Latin name is Bacteroides uniformis, the preserved number is CCTCC NO: M 20241757, and the preserved date is August 7, 2024.

[0008] In this invention, the monomorphobacteria were isolated from healthy pig feces.

[0009] In this invention, the 16S rRNA gene sequence of the Bacteroides monomorpha is shown in SEQ ID NO: 1.

[0010] The present invention further provides a method for using the aforementioned Bacteroides monomorpha, wherein the Bacteroides monomorpha and / or its metabolites are used as active ingredients in the preparation of pharmaceutical formulations.

[0011] This invention also provides a drug with anti-porcine epidemic diarrhea virus function, wherein the active ingredient of the drug is the aforementioned Bacteroides monomorpha and / or its metabolites, and the content of the active ingredient in the drug is 1×10⁻⁶. 8 cfu / mL; the dosage of this drug is 3 mL / time.

[0012] In this invention, the dosage form of the drug is a suspension or an oral solution.

[0013] Compared with the prior art, the technical advantages of the present invention are:

[0014] 1. The porcine monomorphobacteria described in this invention have significant probiotic properties; due to its rapid growth, it has a strong ability to resist porcine epidemic diarrhea virus.

[0015] 2. The Bacteroides monomorpha and / or their metabolites described in this invention can be used as drug active centers to produce pharmaceutical agents, and have broad application scenarios in the prevention and treatment of porcine epidemic diarrhea virus. Attached Figure Description

[0016] Figure 1 Colony morphology of Bacteroides monomorphosum ZJNB01 from porcine origin;

[0017] Figure 2 Gram staining microscopic image of porcine monomorphobacter ZJNB01 under 100x oil immersion;

[0018] Figure 3 Electron micrograph of porcine monomorphic bacterium ZJNB01;

[0019] Figure 4 Evolutionary analysis of 16S rRNA from porcine monomorphobacter ZJNB01;

[0020] Figure 5 Growth curve of porcine monomorphobacter ZJNB01;

[0021] Figure 6 The results of cytotoxicity assays for porcine monomorphobacter ZJNB01;

[0022] Figure 7The result chart of PEDV infection Vero cell to produce cytopathic effect; wherein, A is normal morphology of Vero cell; B is cytopathic morphology of Vero cell;

[0023] Figure 8 The determination result chart of the influence of porcine Bacteroides uniformis ZJNB01 on the expression of PEDV N protein; A is the Western Blot detection of the expression content of virus N protein; B is the gray scale analysis of virus N protein;

[0024] Figure 9 The determination result chart of porcine Bacteroides uniformis ZJNB01 inhibiting PEDV replication; A is the indirect immunofluorescence observation of the fluorescence intensity and distribution of virus N protein expression; B is the column chart analysis of virus fluorescence expression rate;

[0025] Figure 10 The determination result chart of the influence of porcine Bacteroides uniformis ZJNB01 metabolite and bacteria on the expression of PEDV N protein; A. Western Blot detection of the expression content of virus N protein; B. Gray scale analysis of virus N protein;

[0026] Figure 11 The determination result chart of porcine Bacteroides uniformis ZJNB01 metabolite anti-PEDV infection immunofluorescence; A is the indirect immunofluorescence observation of the fluorescence intensity and distribution of virus N protein expression; B is the column chart analysis of virus fluorescence expression rate;

[0027] Figure 12 The determination result chart of porcine Bacteroides uniformis ZJNB01 metabolite on PEDV titer.

[0028] Figure 13 The observation chart of porcine Bacteroides uniformis ZJNB01 metabolite on PEDV in the intestinal tissue of piglets in vivo.

[0029] Figure 14 The determination chart of porcine Bacteroides uniformis ZJNB01 metabolite on the virus load of PEDV in piglets in vivo. DETAILED DESCRIPTION

[0030] The specific embodiments of the present application are described in detail below with reference to the accompanying drawings.

[0031] 1. The source of experimental materials and reagents in the embodiments of the present application

[0032] 1.1 Fecal sample and virus

[0033] In the following examples, fresh pig fecal samples of Bacteroides uniformis ZJNB01 strain were extracted from a pig farm in Ningbo, Zhejiang Province. The porcine epidemic diarrhea virus used as the test object was PEDV ZQ2022 strain, whose original strain (GenBank accession no. OR061129) was isolated and identified by the Animal Preventive Medicine and Public Health Laboratory of the College of Animal Medicine, College of Animal Science and Technology, Zhejiang University of Agriculture and Forestry; the survival sample used in this example was stored in the laboratory.

[0034] 1.2 Cell lines and culture

[0035] Vero cells were cultured in DMEM medium containing 10% FBS, and passaged when they grew into a monolayer of adherent cells. The cells were completely digested in about 2 min using 0.25% trypsin containing 0.02% EDTA. The specific steps are as follows: select a well-grown Vero cell monolayer, discard the old culture medium, and wash the cells twice with 1 × PBS (pH = 7.2) buffer to remove residual old culture medium; add 1 mL of 0.25% trypsin-EDTA digestion solution to the bottle, gently shake to make the digestion solution flow over the surface of all cells, and place it in the incubator for digestion; observe under a microscope when the cells are obviously rounded, the intercellular space is increased, and the cell monolayer appears misty, immediately pour off the digestion solution, and add 1 mL of DMEM culture medium containing 10% FBS to terminate the digestion; use a pipette to aspirate the culture medium in the bottle, repeatedly blow the cells to make them detach and disperse, forming a cell suspension; divide the cell suspension into new culture bottles and add a certain amount of 10% FBS DMEM culture medium to make the total volume 5 mL; gently shake to make the cells evenly distributed, cover the bottle cap, and return to the cell culture box for culture.

[0036] 1.3 Main reagents

[0037] Brain Heart Infusion (BHI) medium (HB8297-1), anaerobic gas pack, anaerobic culture bag and Gram staining reagent kit were purchased from Qingdao Haibo Biotechnology Co., Ltd.; Bacterial genomic DNA extraction kit was purchased from Tiangeng Biochemical Technology (Beijing) Co., Ltd.; DNA Marker DL2000 and Taq DNA polymerase were purchased from Kangwei Century Biotechnology Co., Ltd.; DMEM high-sugar medium, trypsin and fetal bovine serum (FBS) were purchased from Gibico Company of the United States; PBS buffer (pH 7.2-7.4) and GAPDH antibody were purchased from Sigma-Aldrich Company of the United States; polyclonal antibody of PEDV N protein was provided by Harbin Veterinary Research Institute, Chinese Academy of Agricultural Sciences; 4% paraformaldehyde, skimmed milk powder and horse anti-mouse immunoglobulin G (IgG) were purchased from Shanghai Baishasi Biological Technology Co., Ltd.; 10% PAGE gel ultra-fast preparation kit, 5x protein loading buffer, PVDF membrane and protein pre-stained marker were purchased from Beijing Solap Biochem Co., Ltd.; Western cell lysis buffer, CCK-8 kit and BCA protein concentration determination kit were purchased from Shanghai Biyun Tian Biotechnology Co., Ltd.

[0038] Other reagents or materials not specifically described were obtained from commercial channels.

[0039] 2. Isolation and identification of porcine Bacteroides uniformis

[0040] 2.1 Isolation and purification of porcine Bacteroides uniformis

[0041] Fresh fecal samples were collected from healthy sows, and 1 g of the fecal sample was added to 9 mL of sterile normal saline under sterile conditions, shaken well, centrifuged at 10,000 rpm / min for 10 min at 4℃, and the supernatant was gradient diluted to 10 -4 ,10 -5 ,10 -6 The BHI medium was prepared and sterilized, then poured into a plate, and after solidification, 100 μL of sample dilution of different gradients was taken and spread on the plate, numbered and recorded, and then placed in a 37℃ incubator for anaerobic culture for 48 h. The typical colonies were picked onto BHI agar plates for 3 times of streaking and purification. The BHI liquid medium was poured into a specially designed anaerobic vial, filled with nitrogen after sealing, and sterilized at high temperature. The purified single colony was inoculated into the BHI liquid medium and cultured anaerobically at 37℃ for 48 h. The strain ZJNB01 was successfully obtained, glycerol was added (final concentration 25%) and stored in a -80℃ ultra-low temperature refrigerator. The pH value of the medium is preferably 7.2±0.2.

[0042] 2.2 Morphological identification of porcine Bacteroides uniformis

[0043] The isolated strain was activated, 100 μL of 10-6 、10 -7 、10 -8 The bacterial liquid of dilution degree was coated on BHI solid culture medium, placed in a culture bag containing anaerobic gas bag, and placed in a 37℃ incubator for anaerobic culture for 48h. The bacterial colony growth morphology was observed every day. Single colonies were picked on glass slides, a small drop of sterile water was added, and fixed on an alcohol lamp. Then, crystal violet primary staining, iodine solution medium staining, 95% ethanol decolorization, and safranine staining were performed in sequence at the smear site, and the morphology of the bacteria was observed under an oil immersion lens. Single colonies were inoculated into a special anaerobic vial containing BHI liquid medium, and after 37℃ anaerobic culture for 48h, centrifugation was performed at 8,000rpm for 5min, the supernatant was discarded, and the bacterial body was resuspended with PBS buffer and repeatedly washed by centrifugation for 3 times. 2.5% glutaraldehyde solution was added for fixation for 2h, and then sent to Wuhan Saiver Biological Technology Co., Ltd. for scanning electron microscope detection. The specific operation steps are as follows: the bacterial body was rinsed with 0.9% NaCl solution twice, 15min each time, then fixed with 1% osmium acid for 2h, dehydrated with 20%, 50%, 80% and 100% gradient concentration ethanol solution, and then subjected to critical point drying treatment and ion bond gold plating treatment, and finally observed under a scanning electron microscope.

[0044] The colony morphology of the isolated strain ZJNB01 on the BHI agarose plate is shown in Figure 1 , which is grayish white, semi-transparent round, convex in the middle, smooth and bright on the surface, and with neat edges. It is a negative bacterium by gram staining microscopic examination, with blunt ends, single distribution, rod-shaped, and no spores Figure 2 , which is consistent with the basic morphology of Bacteroides uniformis. In addition, scanning electron microscope observation found that the bacterial body of strain ZJNB01 was attached with long, undulating curved filaments, i.e. flagella Figure 3 .

[0045] 2.3 PCR identification of porcine Bacteroides uniformis

[0046] The isolated strain ZJNB01 was subjected to genomic DNA extraction according to the procedure of the bacterial DNA extraction kit, and the 16S rRNA gene of the strain was amplified using 27F (5' AGAGTTTGATCCTGGCTCAG 3') and 1492R (5' TACGGTTACCTTGTTACGACTT 3') universal primers with the strain as a template. The PCR reaction system was Taq DNA polymerase 12.5 μL, each of the upper and lower primers 0.5 μL, DNA template 3 μL, and ddH2O 8.5 μL, and the amplification conditions were: pre-denaturation at 95°C for 5 min; 95°C for 30 s, 56°C for 30 s, 72°C for 90 s for a total of 35 cycles, and 72°C for 10 min for annealing extension. After 6 μL of the PCR product was subjected to 1% (w / v) agarose gel electrophoresis detection, the remaining PCR product was sent to Hangzhou Yikang Biotechnology Co., Ltd. for sequencing. The sequence was compared with the NCBI database (https: / / blast.ncbi.nlm.nih.gov), and a phylogenetic tree was established using MEGA11 software to analyze the genetic evolution.

[0047] Through PCR amplification and sequencing of the strain ZJNB01, a 16S rRNA gene sequence of about 1500 bp was obtained, and the gene sequence is shown as SEQ ID NO: 1:

[0048]

[0049] BLAST alignment showed the highest homology with *Bacteroides uniformis* (B. uniformis); phylogenetic tree analysis based on this sequence and a reference sequence is as follows. Figure 4 As shown, the isolated strain ZJNB01 showed the closest homology to the 16S rRNA of Bacteroides monomorphosum NB-14 (ID: AB117564.1), Bacteroides monomorphosum NB-13 (ID: AB117563.1), Bacteroides monomorphosum JCM 5828 (ID: NR_040866.1), Bacteroides monomorphosum mat-344 (ID: AB215084.1), Bacteroides monomorphosum JCM5828 (ID: NR_112945.1), and Bacteroides monomorphosum 23-18 (ID: AB247142.1) in GenBank of NCBI. Therefore, this strain was identified as Bacteroides monomorphosum and named ZJNB01.

[0050] In addition, the applicant submitted Bacteroides monomorpha ZJNB01 to the China Center for Type Culture Collection on August 7, 2024 for preservation. The specimen was found to be viable. Its accession number is CCTCC NO: M 20241757. The deposit address is the Wuhan University Collection Center, Wuhan, Hubei Province, 430072, China. The contact number is 027-68754052.

[0051] 3. Study on the biological characteristics and anti-PEDV properties of porcine monomorphobacteria

[0052] In this embodiment, GraphPad Prism 8.0.2 was used to detect whether the data followed a normal distribution and to plot the relevant histograms. All data are expressed as "mean ± standard error (Means ± SEM)". A p-value < 0.05 indicates a significant difference between the two groups.

[0053] 3.1 Determination of the growth curve of porcine monomorphobacter ZJNB01

[0054] The activated strain was cultured in BHI liquid medium for 48 hours, and then inoculated at a rate of 2% into several 10 mL sterile anaerobic tubes containing 5 mL of BHI liquid medium. The tubes were then incubated statically at 37°C. From 0 h to 72 h, one tube was taken out every four hours, and its optical density at OD 600 nm was measured using a specific instrument. A growth curve was plotted with OD value on the ordinate and time on the abscissa.

[0055] The results are as follows Figure 5As shown, the strain was in the lag phase at 0-28 h; in the logarithmic growth phase at 28-44 h, the strain ZJNB01 showed a rapid growth trend; 44-60 h was the stable growth phase, and the OD 600 value (0.40±0.01) reached the highest at 48 h; and entered the aging period after 60 h. The above shows that the ZJNB01 strain reaches a relatively stable number at 48 h of anaerobic culture, which can be used for subsequent experimental research.

[0056] 3.2 Cell toxicity detection of porcine B. hominis ZJNB01

[0057] The Vero cell suspension was diluted to a concentration of 5×10 3 cells / mL, inoculated into a 96-well cell culture plate, 100 μL was added to each well, and incubated in a 37°C, 5% CO2 incubator for 24 h. The old culture medium was discarded, and the cells were washed twice with 1×PBS buffer. 2 mL of B. hominis ZJNB01 culture solution was diluted by 2-fold gradient, and 1, 1 / 2, 1 / 4, 1 / 8, 1 / 16, 1 / 32 and 1 / 64 dilutions were selected. Each well of the treatment group was added with 100 μL of bacterial culture solution of different dilutions, each dilution was repeated 5 times, and was placed in a 37°C, 5% CO2 incubator for incubation for 12 h, and a cell control was set. 10 μL of CCK-8 solution was added to each well, and was placed in a cell incubator for further incubation for 2 h. Before reading the plate, it was gently shaken on a shaker, and the absorbance at 450 nm was measured using an enzyme marker. According to the formula: cell viability = (treatment group OD 450 -blank group OD 450 ) / (control group OD 450 -blank group OD 450 )×100%, the toxicity of B. hominis ZJNB01 to cells was evaluated.

[0058] The results are shown in Figure 6 , the undiluted ZJNB01 culture solution has high cell toxicity, and the cell survival rate is only 11%; when the dilution is 1 / 2, 1 / 4, 1 / 8, 1 / 16, 1 / 32 and 1 / 64, the survival rate of Vero cells is more than 90%. Therefore, the safe concentration range of ZJNB01 culture solution in cells in vitro is 1 / 2 to 1 / 64, so that the bacterial culture solution with a dilution of 1 / 2 is the maximum safe concentration.

[0059] 3.3 Virus proliferation and virus titer determination of PEDV

[0060] The Vero cell suspension was diluted to a concentration of 5×10 5Vero cells at a concentration of 1 x 105cells / mL were inoculated into a T25 cell culture bottle, and incubated in a 37°C, 5% CO2 incubator until the cells formed a monolayer. Then, 50 μL of PEDV ZQ2022 virus solution was mixed with 1 mL of serum-free inoculation medium (DMEM medium containing 0.4% trypsin) to inoculate the Vero cells. The cell culture bottle was incubated in a 37°C, 5% CO2 incubator for 1 h, and then 4 mL of inoculation medium was added. The cells were cultured for 24-48 h, and the cell state was observed every day. When more than 80% of the cells showed pathological changes, the cell culture bottle containing the virus solution was placed in a -80°C freezer, and the cells were completely broken to release the virus by repeated freezing and thawing three times. The harvested virus suspension was centrifuged at 4,000 rpm for 10 min to remove cell debris, and the virus supernatant was collected, aliquoted, and stored at -80°C for later use.

[0061] The titer (TCID 50 / mL) of the PEDV virus solution was calculated by the Reed-Muench method, and the specific steps were as follows: Vero cells at a concentration of 1 x 105 5 cells / mL were inoculated into a 96-well plate, and 100 μL was added to each well. When the cells grew to 90% confluence, the PEDV ZQ2022 virus solution was diluted 10-fold in 1.5 mL sterile centrifuge tubes using inoculation medium. -7 The diluted virus solution was inoculated into the 96-well plate at 100 μL / well, with 8 replicate wells for each gradient. Eight wells inoculated with an equal amount of inoculation medium were set as controls, and the plate was incubated in a 37°C, 5% CO2 incubator for 5 days. The cell pathological changes (CPE) were observed and recorded every day, and the TCID 50 of the PEDV virus solution was calculated by the Reed-Muench method.

[0062] To determine the infection ability of PEDV ZQ2022 on Vero cells, the virus solution was inoculated into Vero cells, and a cell control group without virus inoculation was set. The plate was incubated in a 37°C, 5% CO2 incubator for 24-48 h, and the cell state was observed every day. The morphology of normal Vero cells is shown in Figure 7 A, and the cells were uniformly distributed, with compact density, clear boundaries, and good condition. The Vero cells infected with PEDV showed obvious pathological changes Figure 7 B, with blurred cell boundaries, rounded, fused, and broken cells, and cell debris floating in the culture medium. Further calculation by the Reed-Muench method showed that the titer of PEDV ZQ2022 strain in Vero cells was 10 5.875 TCID 50 / mL. The above results showed that the PEDV ZQ2022 virus particles could infect Vero cells.

[0063] 3.4 Detection of the effect of B. hominis ZJNB01 strain on the expression of viral N protein by Western Blot

[0064] In order to explore the influence of porcine B. hominis ZJNB01 on the replication of PEDV, the expression levels of PEDV N protein in the ZJNB01 bacterial liquid treatment group and the control group were detected by Western Blot and indirect immunofluorescence method in this embodiment.

[0065] The concentration of 1×10 5Vero cells at 1×106cells / mL were inoculated into twelve-hole cell culture plates, 1 mL was added to each hole, and when the cells grew to 100% confluence, the old culture medium was discarded, the cells were washed twice with 1×PBS buffer; 500 μL of B. odontolyticus ZJNB01 culture solution with a dilution of 1 / 2 was mixed with 500 μL of MOI = 0.01 PEDV ZQ2022 virus liquid in a 1.5 mL sterile centrifuge tube and inverted to mix well; 1 mL of the mixed solution was inoculated into the monolayer Vero cells of the twelve-hole plate, and placed in a 37°C, 5% CO2 constant temperature incubator for 12 h; after the old culture medium was discarded, the cells were washed twice with PBS buffer, 100 μL of RIPK cell strong lysis solution and 1 μL of protease inhibitor were added, and placed on an ice box for 10 min of lysis, the cells at the bottom of the hole were scraped with a disposable cell scraper into a 1.5 mL sterile centrifuge tube, and the pipette gun was continued to blow for 2 min to fully lyse, and centrifuged at 12000 rpm for 10 min at 4°C. Carefully aspirate the supernatant into another pre-cooled 1.5 mL sterile centrifuge tube, and ice bury the protein concentration determination. At the same time, set up a control group inoculated with an equal volume of BHI liquid medium. Then, according to the steps of the BCA protein concentration determination kit, the protein concentration of the sample was detected, and the final concentration of the sample was adjusted to 2 μg / μL with 5×protein loading buffer and PBS buffer, and after 100°C metal bath for 10 min, it was used for SDS-PAGE protein electrophoresis. The specific operation steps are as follows: prepare the separation gel and the concentration gel according to the steps of the 10% PAGE gel ultra-fast preparation kit, and insert the comb into the installed gel preparation device; after the concentration gel is solidified, insert 1×SDS electrophoresis liquid, pull out the comb, and add 8 μL of the above protein sample and Marker to the hole. The electrophoresis instrument is adjusted to 80V, and the voltage is adjusted to 120V when the protein sample is electrophoresed to the separation gel. When it reaches the bottom of the separation gel, select the area according to the size of the Marker, and use dry transfer method for transfer. After transfer, the PVDF membrane is placed in 5% skim milk for blocking for 2 h; wash 5 times with 1×TBST buffer for 10 min each time to remove excess skim milk, and incubate with PEDV N protein primary antibody (1:1500) at 4°C overnight; wash 3 times with 1×TBST buffer for 10 min each time, and incubate with donkey anti-mouse secondary antibody (1:1000) in a 37°C constant temperature incubator for 1 h; wash 3 times with 1×TBST buffer, add developing solution to the PVDF membrane, observe the image, and use Image J for gray scale analysis to calculate the PEDV N protein expression difference between the treatment group and the control group.

[0066] The Western Blot detection results are as follows: Figure 8As shown, compared with the control group, the expression level of PEDV N protein in the B. uniformis ZJNB01 culture solution treatment group was lower, and gray scale analysis showed that the gray value of the virus N protein in the treatment group was 0.14, which was significantly lower than that in the control group (P<0.05). Indirect immunofluorescence observation found that all the cell nuclei in the two groups were stained blue by DAPI, the Mock group had no green fluorescence, the control group had multiple specific green fluorescence, and the fluorescence intensity in the treatment group was reduced and the distribution was weakened. After statistics, the fluorescence expression rate of the treatment group was 20.66%, which was significantly lower than that of the control group (P<0.05). Figure 9 ) The above data show that the ZJNB01 strain can inhibit the expression of PEDV N protein in cells in vitro, thereby clarifying the inhibitory effect of porcine B. uniformis ZJNB01 on PEDV replication.

[0067] 3.5 Detection of the effect of B. uniformis ZJNB01 strain on PEDV replication by indirect immunofluorescence method

[0068] Referring to the experimental method in step 3.4, after the ZJNB01 culture solution and the virus solution were co-incubated in ST cells for 12 h, the old culture medium was discarded, the cells were washed with 1×PBS buffer for 3 times, 500 μL of 4% paraformaldehyde fixing solution was added, and the cells were fixed at room temperature for 30 min; the fixing solution was discarded, the cells were washed with 1×PBS buffer for 3 times, 500 μL of 0.5% Triton-X-100 solution was added, and the cells were permeabilized at room temperature for 20 min; the permeabilization solution was discarded, the cells were washed with 1×PBS buffer for 3 times, 500 μL of 5% BSA solution was added, and the cells were blocked at room temperature for 30 min; 500 μL of PEDV N protein primary antibody (1:500) was added, and the cells were blocked in a 37°C, 5% CO2 incubator for 2 h; the primary antibody was discarded, the cells were washed with 1×PBS buffer for 3 times, 500 μL of donkey anti-mouse secondary antibody (1:1000) was added, and the cells were incubated in a 37°C, 5% CO2 incubator for 1 h; the secondary antibody was discarded, the cells were washed with 1×PBS buffer for 3 times, 500 μL of DAPI staining solution was added, and the cells were stained at room temperature for 5 min; the cells were washed with 1×PBS buffer for 3 times, and the fluorescence phenomenon was observed under a fluorescence inverted microscope, and the photos were taken. At the same time, a control group inoculated with an equal volume of BHI liquid medium was set.

[0069] 4. Study on the biological characteristics and anti-PEDV virus characteristics of porcine B. uniformis metabolites

[0070] 4.1 Preparation of B. uniformis ZJNB01 strain metabolites and bacterial bodies

[0071] Preparation of B. uniformis ZJNB01 strain metabolites: the bacterial suspension concentration of B. uniformis ZJNB01 strain was adjusted to 1×10 8cfu / mL; after centrifugation at 3,000 x g for 10 min, the supernatant was filtered through a 0.22 μm filter, and the filtered suspension was the metabolic product of B. hominis ZJNB01 strain.

[0072] Preparation of B. hominis ZJNB01 strain cells: the bacterial suspension of B. hominis ZJNB01 strain was adjusted to 1 x 10 8 cfu / mL; after centrifugation at 3,000 x g for 10 min, the supernatant was filtered through a 0.22 μm filter, and the filtered suspension was the metabolic product of B. hominis ZJNB01 strain.

[0073] 4.2 Effect of metabolic product and cells of B. hominis ZJNB01 strain on expression of viral N protein

[0074] 500 μL of virus liquid containing PEDV ZQ2022 at MOI = 0.01 was mixed with 500 μL of metabolic product suspension, cell suspension and BHI liquid medium of B. hominis ZJNB strain, respectively, and inoculated into Vero cells in a twelve-well plate for 12 h, and the cells were collected. The expression levels of PEDV N protein in the treatment and control groups were detected by Western blot and indirect immunofluorescence, and the steps were referred to steps 3.4 and 3.5.

[0075] To clarify the components of porcine B. hominis ZJNB01 strain that exert an anti-PEDV infection effect, the expression levels of viral N protein on Vero cells were detected by Western Blot using the metabolic product and cells of ZJNB01. The results are shown in Figure 10 Compared with the control group and the cell treatment group, the PEDV N protein content of the B. hominis ZJNB01 metabolic product treatment group was significantly reduced (P < 0.05), but there was no significant difference between the control group and the cell treatment group. This indicates that B. hominis ZJNB01 strain exerts an inhibitory effect on PEDV replication through its metabolic product.

[0076] 4.3 Effect of metabolic product of B. hominis ZJNB01 strain on PEDV titer

[0077] Referring to the test method in step 4.2, the metabolic product-virus mixture was inoculated into Vero cells for 12 h, and a BHI-virus liquid control group was set up, the old culture medium was discarded, washed with 1 x PBS buffer for 3 times, 1 mL of inoculation culture medium was added, and stored at -80°C, and the virus was released by repeated freezing and thawing for three times. The above freeze-thaw liquid was inoculated into a 96-well plate with a single layer of Vero cells, and the titer (TCID50 / mL).

[0078] To verify the effect of B. uniformis ZJNB01 metabolites on PEDV replication, the intensity of virus N protein fluorescence expression in the metabolite treatment group and the control group was detected by indirect immunofluorescence. The results, as shown in Figure 11 , the Mock group had no green fluorescence, and the control group observed multiple obvious green fluorescence, the fluorescence distribution in the metabolite treatment group was weakened, and the statistical results showed that the fluorescence expression rate of the metabolite treatment group was 18.53%, which was significantly lower than that of the control group (P<0.05). It can be seen that the fluorescence intensity and distribution of virus N protein in the cells can be significantly weakened after the metabolite treatment, thereby verifying that the B. uniformis ZJNB01 metabolites can antagonize PEDV infection.

[0079] To further identify the effect of B. uniformis ZJNB01 metabolites on the titer of PEDV, the Reed Muench method was used to calculate the change of virus titer (TCID 50 / mL) in the metabolite treatment group and the control group. The results, as shown in Figure 12 , the TCID 50 of the B. uniformis ZJNB metabolite treatment group was 10 -4.4583 / mL, and the TCID 50 of the control group was 10 -4.8333 / mL. It can be seen that the virus titer of the metabolite treatment group was significantly lower than that of the control group (P<0.05), thereby confirming that the B. uniformis ZJNB01 metabolites can inhibit virus replication.

[0080] 5、Evaluation of the protective effect of B. uniformis ZJNB01 metabolites on piglets against PEDV infection

[0081] 5.1 Effect of B. uniformis ZJNB01 metabolites on PEDV in the intestinal tissue of piglets

[0082] In this experiment, 9 three-day-old piglets were selected, and the PEDV, PDCoV, TGEV and PRoV antigens were all negative by colloidal gold kit detection. They were randomly divided into 3 groups: culture medium inoculation group, culture medium + PEDV inoculation group, and metabolite + PEDV inoculation group, which were raised in 3 separate rooms. Before the challenge, the piglets in the culture medium + PEDV inoculation group and the metabolite + PEDV inoculation group were orally administered 4 times of 3 mL BHI liquid medium and B. uniformis metabolites, with an interval of 6 hours, and the challenge dose was 1.33 x 10 6 TCID 50PEDV virus liquid. The piglets in the medium inoculation group were orally administered with an equal volume of BHI liquid medium. After 36 h of challenge, all piglets were dissected to observe and compare the pathological changes in the intestines of piglets in different groups.

[0083] Results are shown in Figure 13 As shown in the middle photograph, the intestines of piglets in the medium + PEDV inoculation group showed thin and transparent intestinal wall, intestinal tube distension, yellowish water-like content, and a small amount of bleeding; the intestinal damage of piglets in the metabolite + PEDV inoculation group was relatively mild, and no obvious lesions were observed in the intestinal wall; and no visible lesions were observed in the intestines of piglets in the medium inoculation control group.

[0084] 5.2 Effect of porcine Bacteroides uniformis ZJNB01 metabolite on viral load of PEDV in piglets

[0085] After 36 h of challenge, the fecal samples of piglets in the medium + PEDV inoculation group and the metabolite + PEDV inoculation group were collected after 36 h of challenge, and the ileal tissue of piglets was collected after dissection. Total RNA was extracted according to the steps of the total RNA extraction kit. The ultra-micro nucleic acid protein concentration detector was used to determine the RNA concentration of the sample, and the cDNA was reversely transcribed. The fecal and ileal cDNA were amplified by real-time fluorescence quantitative PCR (Quantitative Real-time-PCR, qPCR) using specific primers PEDV ORF3-F (5'-GCACTTATTGGCAGGCTTTGT-3') and PEDV ORF3-R (5'-CCATTGAGAAAAGAAAGTGTCGTAG-3'). The reaction system is shown in Table 1, and the reaction program is as follows: 95°C pre-denaturation for 15 s; 40 cycles including 95°C denaturation for 15 s, 60°C annealing for 30 s, and 72°C extension for 30 s. β-Actin was used as an internal reference gene, and the starting copy number of the sample was calculated according to the method of 2 -ΔΔCt Methods for calculation and analysis.

[0086] Table 1 qPCR system

[0087]

[0088] In order to clarify the effect of porcine Bacteroides uniformis ZJNB01 metabolite on the excretion of PEDV in piglets, the fecal and intestinal tissue samples of piglets after 36 h of challenge were collected, and the PEDV viral load level of the above samples was detected by qPCR method. The results showed that compared with the medium + PEDV inoculation group, the viral load of the feces of piglets in the metabolite + PEDV inoculation group was significantly down-regulated (P<0.01) Figure 14 , and the viral load of the ileum and rectum tissue of the metabolite + PEDV group also showed the same down-regulation trend (P<0.01)Figure 14 The above results show that the metabolic product of the porcine Bacteroides uniformis ZJNB01 can protect piglets against PEDV infection.

[0089] Therefore, it can be confirmed that the metabolic product (drug) prepared by the porcine Bacteroides uniformis ZJNB01 strain of the present application can meet the prevention and control needs of PEDV virus in the actual scenario of pig feeding.

[0090] Based on the above research results and animal experiment data, the present application proposes a specific application mode of the ZJNB01 strain:

[0091] The Bacteroides uniformis and / or its metabolic product are used as active ingredients to prepare a pharmaceutical preparation with the function of resisting porcine epidemic diarrhea virus, and the content of the active ingredient in the medicine is 1×10 8 cfu / mL, and the usage amount is 3 mL / time. The dosage form of the medicine can be selected as a suspension or an oral solution. Since the method or process for preparing the strain into a medicine is disclosed in a large number of existing documents, the present application will not be described in detail.

Claims

1. A strain of Bacteroides uniformis having activity against porcine epidemic diarrhea virus, characterized in that, The strain is preserved in China Center for Type Culture Collection, the preservation name is Bacteroides uniformis ZJNB01, the Latin name is Bacteroides uniformis The Bacteroides uniformis is isolated from healthy pig feces. , and the preservation number is CCTCC NO: M 20241757.

2. The B. hominis of claim 1, wherein, The 16S rRNA gene sequence of the Bacteroides uniformis is shown as SEQ ID NO:

1.

3. The B. hominis of claim 1, wherein, The Bacteroides uniformis is used as an active ingredient for manufacturing a pharmaceutical preparation.

4. The method of using B. hominis according to any one of claims 1 to 3, wherein, The pharmaceutical preparation is in the form of a suspension or an oral solution.

5. A medicine having an anti-swine epidemic diarrhea virus function, characterized by, The active ingredient of the medicine is the monopolar bacterium as claimed in any one of claims 1 to 3, and the content of the active ingredient in the medicine is 1 x 10 8 cfu / mL; the use amount of the medicine is 3 mL / time.

6. The medicament according to claim 5, characterized in that, ​

Images