A semi-cyanine photosensitizer, its preparation method and application

Abstract

This invention provides a hemicyanine photosensitizer, its preparation method, and its applications, belonging to the field of biomedicine. This invention develops a hemicyanine dye-based molecule with a D-π-A structure through donor substitution engineering, the structure of which is shown in Formula I. This hemicyanine dye-based molecule exhibits excellent spectral properties. Based on this hemicyanine dye-based molecule, the PLH1100 nanoassembly further constructed exhibits excellent brain targeting, tumor enrichment, photostability, and biocompatibility, as well as outstanding photothermal conversion efficiency and NIR-II tumor imaging capability, making it suitable for photothermal immunotherapy of glioblastoma. Furthermore, this invention also found that PLH1100 can significantly enhance the efficacy of the bispecific T-cell connector (Fn14×CD3BiTE) targeting Fn14. The combination of PLH1100 and the Fn14×CD3BiTE connector plays a synergistic role in photothermal immunotherapy, opening up new avenues for the clinical treatment of glioblastoma and possessing significant clinical application potential.

Description

Technical Field

[0001] This invention belongs to the field of biomedicine, specifically relating to a semi-cyanide photosensitizer, its preparation method, and its application. Background Art

[0002] Glioblastoma (GBM) is a highly malignant intracranial tumor. Despite advancements in surgery, radiotherapy, and chemotherapy, effective treatment options remain limited. In recent years, bispecific T-cell connectors (BiTEs) have been explored for GBM treatment, and related clinical trials are underway. However, insufficient T-cell activation due to the acidic and immunosuppressive microenvironment (TME) severely limits the success of BiTEs. Photothermal immunotherapy (PTI) not only dissolves tumors through photothermal effects but also activates innate and adaptive immune responses, making it an ideal partner for BiTE strategies. Hemicyanine dye (Hcy) is an organic dye with a donor-π-receptor (D-π-A) structure, comprising a nitrogen-heterocyclic electron acceptor, a conjugated chain, and an aromatic donor with various functional ends. By adjusting the molecular structure, charge transfer between the donor and acceptor can be finely tuned, inducing a Stokes shift in the spectrum of Hcy-based photosensitizers to meet the requirements of long-wavelength absorption.

[0003] However, the application of PTI to treat GBM still faces many challenges: on the one hand, GBM is usually located deep in brain tissue, requiring the use of light sources with longer wavelengths and greater penetration for PTI, but there are limited photosensitizers with good biocompatibility and degradability; on the other hand, the acidic and immunosuppressive microenvironment within GBM significantly hinders the ability of PTI to induce immunogenic cell death (ICD).

[0004] The literature (DOI: 10.1002 / smll.202204851) discloses a heavy atom-free NIR hemicyanin photosensitizer (BHcy) and shows that BHcy can be used for anti-cancer treatment through receptor engineering strategy in 808nm light-mediated synergistic photodynamic therapy / photothermal therapy (PDT / PTT). However, BHcy exhibits NIR absorption / emission at 770 / 915nm and tail emission of NIR-II at 1200nm. When BHcy is assembled with DSPE-PEG2000 to form nanoparticles (BHcy-NPs), the photothermal conversion efficiency is 55.1%, and its photophysical properties need to be improved.

[0005] Therefore, exploring photosensitizers with better photophysical properties and developing new treatment methods for glioblastoma is of great significance. Summary of the Invention

[0006] In order to overcome the shortcomings of the existing technology, the purpose of this invention is to provide a semi-cyanide photosensitizer, its preparation method and application.

[0007] This invention provides a semi-cyanine dye-based molecule, the structure of which is shown in Formula I:

[0008]

[0009] Among them, R1 is selected from hydrogen, C 1-3 Alkyl group, R2 is selected from hydrogen, C 1-3 alkyl.

[0010] Furthermore, its structure is as follows:

[0011]

[0012] The present invention also provides a nanoparticle, which is the product obtained by reacting the above-mentioned hemicyanine dye-based molecule, liposome, ligand-modified liposome and biocatalyst.

[0013] Furthermore, the biocatalyst is lactate oxidase;

[0014] The ligand is a ligand that targets low-density lipoprotein receptor-associated protein-1;

[0015] Preferably, the amino acid sequence of the ligand is shown in SEQ ID No. 1; the method for preparing the ligand-modified liposomes includes the following steps: reacting a thiolated ligand with a maleimide-containing liposome to obtain ligand-modified liposomes;

[0016] More preferably, the liposomes are DSPE-PEG2000.

[0017] Furthermore, the mass ratio of the thiolated ligand to the maleimide-containing liposome is 2-4:1; the reaction is carried out under nitrogen atmosphere at a temperature of 30-45°C for 10-15 hours.

[0018] Furthermore, the mass ratio of the thiolated ligand to the maleimide-containing liposome is 3:1; the reaction is carried out under nitrogen atmosphere at a temperature of 37°C for 12 hours.

[0019] The present invention also provides a method for preparing the above-mentioned nanoparticles, the method comprising the following steps: heating and reacting hemicyanine dye-based molecules, liposomes and ligand-modified liposomes to obtain a mixture, and reacting the mixture with a biocatalyst again to obtain nanoparticles.

[0020] Furthermore, the mass ratio of the hemicyanine dye-based molecule, liposome, ligand-modified liposome, and biocatalyst is 1:1-3:0.5-2:1-3; the solvent for the heating reaction is an inorganic solvent; the temperature of the heating reaction is 60-80°C, and the time is 20-40 minutes; the temperature of the second reaction is 10-40°C, and the time is 1-3 hours.

[0021] Furthermore, the mass ratio of the hemicyanine dye-based molecule, liposome, ligand-modified liposome, and biocatalyst is 1:2:1:2; the solvent for the heating reaction is chloroform; the reaction temperature is 70°C and the time is 30 minutes; the temperature for the second reaction is 20–30°C and the time is 2 hours.

[0022] Furthermore, after the reaction is complete, the following purification steps are included: the reaction solution is ultrafiltered through a membrane with a molecular weight cutoff of 100,000 Da at 3700 rpm for 20 minutes, and then filtered to obtain the final product.

[0023] The present invention also provides the use of the above-mentioned semicyanine dye-based molecules or nanoparticles in the preparation of photosensitizers.

[0024] Furthermore, the photosensitizer is a drug for the prevention and / or treatment of glioblastoma.

[0025] The present invention also provides a combination drug comprising the above-mentioned nanoparticles and bispecific T-cell connectives for simultaneous or separate administration in unit formulations of the same or different specifications, and a pharmaceutically acceptable carrier.

[0026] Preferably, the bispecific T cell connector is a bispecific T cell connector that targets Fn14;

[0027] The mass ratio of the nanoparticles to the bispecific T-cell connector is 4-6:0.05-0.15, preferably 5:0.1.

[0028] The present invention also provides the use of the above-mentioned combined drug and light-emitting device in the preparation of an apparatus for treating glioblastoma; preferably, the wavelength of the light source in the light-emitting device is 950-1000 nm, and the irradiance is 0.3-0.7 W / cm². 2 The irradiation time is 5-15 minutes; more preferably, the wavelength of the light source in the light-emitting device is 980 nm, and the irradiance is 0.5 W / cm². 2 The irradiation time is 10 minutes.

[0029] Compared with the BHcy photosensitizer and BHcy-NPs nanoparticles in the literature (DOI:10.1002 / smll.202204851), the present invention achieves the following beneficial effects:

[0030] (1) The NIR-II Hcy1100 of the present invention has superior photophysical properties, exhibiting a maximum absorption wavelength of over 1000 nm and a strongest emission wavelength of 1100 nm. However, BHcy only exhibits NIR absorption / emission at 770 / 915 nm and only exhibits weak NIR-II emission at 1100 nm.

[0031] (2) The components including NIR-II Hcy1100 and DSPE-PEG2000 of the present invention are assembled to form nanoparticles (PLH1100), which have a higher photothermal conversion efficiency (58.7%), while BHcy and DSPE-PEG2000 are assembled to form nanoparticles (BHcy-NPs), which have a photothermal conversion efficiency of 55.1%.

[0032] Furthermore, the PLH1100 nanoassemblies prepared based on NIR-II Hcy1100 in this invention have excellent brain targeting, tumor enrichment, photostability and biocompatibility, as well as excellent photothermal conversion efficiency and NIR-II tumor imaging capability, making them suitable for photothermal immunotherapy of glioblastoma.

[0033] This invention also found that PLH1100 can significantly enhance the efficacy of bispecific T-cell connectives targeting Fn14. The combined use of PLH1100 and bispecific T-cell connectives in photothermal immunotherapy has played a synergistic role, opening up new avenues for the clinical treatment of glioblastoma and showing significant clinical application potential.

[0034] Obviously, based on the above description of the present invention, and according to common technical knowledge and conventional methods in the field, various other modifications, substitutions or alterations can be made without departing from the basic technical concept of the present invention.

[0035] The following detailed embodiments further illustrate the above-described content of the present invention. However, this should not be construed as limiting the scope of the present invention to the following embodiments. All technologies implemented based on the above-described content of the present invention fall within the scope of the present invention. Attached Figure Description

[0036] Figure 1Schematic diagrams for optimizing geometry, DFT calculations, MEP plots, and fluorescence spectra. (A) Molecular view of NIR Hcy800, NIRHcy970, and NIR-II Hcy1100; (B) HOMO–LUMO distribution, energy levels, and energy gap data of NIR Hcy800, NIR Hcy970, and NIR-II Hcy1100 calculated using B3LYP / 6-311G(d,p); (C) MEP plots of NIR Hcy800, NIR Hcy970, and NIR-II Hcy1100 under the calculated structures; (D) Absorption and normalized fluorescence spectra of NIRHcy800, NIR Hcy970, and NIR-II Hcy1100 in PBS (5 μg / mL, pH = 7.4).

[0037] Figure 2 Characterization of PLH1100 in vitro. (A) Normalized absorption spectra of NIR-II Hcy1100 and PLH1100 in PBS buffer; (B) Transmission electron microscopy (TEM) image of PLH1100. Scale bar: 200 nm; (C) Dynamic light scattering (DLS) data of PLH1100; (D) Zeta potential of PH1100, PLH1100 and LOX; (E) Infrared thermograms of PBS and PLH1100 (15 μg / mL) under 980 nm light (0.5 W / cm2) irradiation; (F) Photothermal heating curves of PLH1100 at different concentrations; (G) Heating-cooling curves of PLH1100 (15 μg / mL, 0.5 W / cm2); (H) Linear fitting of cooling time with -ln(θ); (I) Photothermal stability of PLH1100 under 980 nm laser irradiation (0.5 W / cm2) for 4 heating-cooling cycles.

[0038] Figure 3 (A) Fluorescence emission spectrum of PLH1100 in PBS (5 μg / mL); (B) Standard curve of NIR-II Hcy1100 in methanol; (C) Standard curve of BCA protein assay kit; (D) Stability of PLH1100 (red line represents hydrodynamic dimensions, blue line represents PDI value); (E) Photograph of PLH1100 after 7 days; (F) Photothermal conversion of PLH1100 (10 μg / mL) under 980 nm laser irradiation at different exposure intensities (0.1, 0.3, 0.5, 0.7 W / cm2).

[0039] Figure 4To evaluate the enzymatic catalytic activity and cytotoxicity of PLH1100. (A) In vitro consumption of lactate by PLH1100; (B) Generation of hydrogen peroxide and consumption of oxygen in lactate solution; (C) HPLC analysis of PLH1100 dispersed in 5 mM lactate solution at 37°C at 20, 40, 60, 80 and 100 minutes; (D) Quantitative results of HPLC integrated area; (E) Flow cytometry analysis of necrosis in GL261 cells under different treatments; (F) Percentage of late apoptotic or necrotic GL261 cells (PI+, Annexin V+); (G) Addition of lactate to explore the killing effect of endogenous H2O2 on GL261 cells; (H) Cytotoxicity of lactate on GL261 and U87 cells; (I) Detection of H2O2 generation induced by LOX in GL261 cells. Scale bar: 20 μm; (J) Flow cytometry analysis of necrosis in U87 cells after different treatments (left). The right side shows the percentage of cells in late apoptosis or necrosis (PI). + Annexin V + (K) Cytotoxicity of PLH1100 to U87 cells with or without lactate under light (980 nm, 0.5 W / cm2, 10 min) or dark conditions; (L) Determination of H2O2 levels in U87 cells induced by LOX. Scale bar: 20 μm.

[0040] Figure 5To detect DAMPs and study the synergistic effect of PLH1100 combined with mBiTE in vitro. (A, B) Confocal laser scanning microscopy (CLSM) images of HMGB1 exposure in GL261 and U87 cells under different treatments; scale bar: 20 μm; (C) Analysis of HMGB1 signal intensity in GL261 and U87 cells after treatment; (D) Flow cytometry analysis of CRT expression on the surface of GL261 and U87 cells under different treatments; (E, F) Detection of ATP secretion levels in GL261 and U87 cells by chemiluminescence; (G, H) Schematic diagram and SDS-PAGE analysis of Fn14×CD3 mBiTE; (I) Representative images of each treatment group: PLH1100 + light, PLH1100 + light + mBiTE, PLH1100 + light + mT cells, mBiTE + mT cells, PLH1100 + light + mBiTE + mT cells. Blue arrows indicate ruptured GL261-hFn14 / luc cells; yellow arrows show mT cells clustered around tumor cells; dashed circles highlight mT cell lysis of GL261-hFn14 / luc cells; effector cell to target cell ratio (E:T): 8:1; incubation time: 4 hours; mBiTE concentration: 0.1 μg / mL; scale bar: 50 μm; (J) percentage of tumor lysis at 4, 8, and 12 hours after treatment; E:T ratio: 8:1; hBiTE concentration: 0.1 μg / mL; (K) CytoTell TM Flow cytometry analysis of Red-labeled mT cells showed decreased signal intensity, indicating increased cell proliferation. (L) MTT cytotoxicity assays showed specific lysis of GL261-hFn14 / luc cells by mouse T cells and mBiTE. E:T ratio 8:1; incubation time 4 h; mBiTE, 0.1 μg / mL. (M) Specific lysis of GL261-hFn14 / luc cells varied with mBiTE concentration. E:T ratio 8:1; incubation time 4 h. (N) Representative images of different treatment groups: PLH1100 + light, PLH1100 + light + hBiTE, PLH1100 - light + hT cells, hBiTE + hT cells, and PLH1100 + 5 light + hBibE + hT cells. Blue arrows indicate shriveled, lysed U87 cells; yellow arrows indicate hT cells clustered around U87 cells; dashed circles highlight hT cells lysing U87 cells; E:T ratio 8:1; incubation time 4 h; BiTE, 0.1 μg / mL; (O) Percentage of U87 cell lysis at 4, 8, and 12 hours post-treatment; E:T ratio 8:1; hBiTE, 0.1 μg / mL; (P) hT cell proliferation was assessed by detecting CytoTell™ Red signal intensity. Scale bar: 50 μm.

[0041] Figure 6 This study demonstrates in vivo imaging and photothermal antitumor effects in BALB / c-nu mice. (A) Schematic diagram of coronal and axial GBM in mouse brains and actual MRI images (indicated by red dashed circles); (B) Ex vivo fluorescence imaging of brain tumors and major organs at 0, 3, 6, 9, 12, and 24 hours after injection of Cy5.5 and Ang-2 modified PLH1100; (C) In vivo NIR-II fluorescence imaging at 0, 3, 6, 9, 12, and 24 hours after intravenous injection of Ang-2 modified PLH1100 in mice; (D, E) In vivo photothermal imaging and temperature changes (980 nm, 0.5 W / cm²) at predetermined time points after treatment with PBS and PLH1100. 2 (F) Relative analysis of lactate levels in tumors; (G) Schematic diagram of the in vivo experimental timeline in BALB / c-nu mice; (H) Tumor volume changes over time in the four treatment groups; (I) Representative MRI images of GBM in the brains of mice in the four treatment groups on day 28; (J) Overall survival rate of tumor-burdened mice; (K, L) Immunofluorescence and positive rate analysis of Ki67 and Tunel in tumor tissues after treatment; Scale bar: 50 μm; (M) Confocal images of in vitro BBB penetration of Ang-2 and Cy5.5 modified PLH1100 by U87 and GL261-hFn14 / luc cells using the Transwell model. Scale bar: 20 μm; (N) H&E staining of major organs 14 days after different treatments. Scale bar: 200 μm; (O) H&E staining of tumor tissues after different treatments; Immunofluorescence of HMGB1 and CRT in tumors after different treatments. Scale bar: 50 μm.

[0042] Figure 7 Evaluation of the synergistic therapeutic effect of PLH1100 combined with mBiTE in C57BL / 6 mice. (A) Schematic diagram of the in vivo experimental timeline showing the experimental timeline of C57BL / 6 mice; (B) Representative allogeneic bioluminescence images of different treatment groups at different time points (n=4); (C) Total tumor flux (p / s) calculated using Living Image software; (D) Overall survival of mice with tumor burden; (EG) Evaluation of Fn14 expression in tumor tissues of different treatment groups; Scale bar: 50 μm; (H) Changes in mouse body weight over time; (I) Flow cytometry gating strategy used to identify immune cells in the tumor microenvironment.

[0043] Figure 8Evaluation of PLH1100's improvement on immunosuppressive tumor microenvironment (TME). (AC) Flow cytometry analysis of mature dendritic cells (CD86+, CD80+, gated by CD45+CD11c+), M1 type TAMs (CD86+, gated by CD45+, F4 / 80+, CD11b+), and CD8+ / CD4+ T cells (gated by CD45+, CD3+) in tumors after different treatments; (DG) Statistical analysis of DCs, M1 type TAMs, CD8+ T cells, and CD4+ T cells in different treatment groups; (H, I) Detection of IFN-γ and TNF-α in different treatment groups.

[0044] Figure 9 Flow cytometry analysis of (A) tumor Treg cells (CD3+CD4+Foxp3+ cell-gated CD45+) and (B) MDSCs (CD11b+Gr-1+ cell-gated CD4+); (C, D) histograms of tumor Treg cells and MDSCs. Detailed Implementation

[0045] All raw materials and equipment used in this invention are known products, obtained by purchasing commercially available products. Thiol-coupled polypeptide (Ang-2-SH) was specifically synthesized by Xi'an Ruixi Biotechnology Co., Ltd. (20 mg, 95% purity); distearate phosphatidylethanolamine-polyethylene glycol-maleimide (DSPE-PEG2000-Maleimide, abbreviated as DSPE-PEG2000-Mal) was purchased from Xi'an Ruixi Biotechnology (product number: R-0039-2k; PEG molecular weight is 2000 Da; specification: 100 mg); lactate oxidase (LOX) was purchased from Yuanye Biotechnology (CAS No.: 9028-72-2), product number: S25769-100u; specification: ≥80 units / mg solid.

[0046] In this invention, "room temperature" refers to 25±5℃, and "overnight" refers to 12±2 hours.

[0047] Example 1: Preparation of the semi-cyanine dye-based molecule NIR-II Hcy1100

[0048] The NIR-ⅡHcy1100 was prepared according to the following synthetic route:

[0049]

[0050] (1) Synthesis steps of compound 1

[0051] 0.25 g (1.48 mmol) of benzo[cd]indol-2(1H)-one and 4.44 mmol of potassium carbonate (K₂CO₃) were dissolved in 8 mL of dimethylformamide (DMF) and stirred at room temperature for 30 min. Then, 0.46 g (2.96 mmol) of iodoethane was added to the solution, and the solution was heated to 90 °C and reacted for 8 h. After cooling to room temperature, the solution was filtered, and the filtrate was collected. The product was purified by silica gel column chromatography (ethyl acetate / hexane = 1:10) to give a yellow solid, compound 1 (0.27 g, 93% yield). 1 H NMR(400MHz,Chloroform-d)δ8.06(dd,J=7.0,0.6Hz,1H),8.01(dd,J=8.1,0.7Hz,1H),7.71(dd,J=8.2,7.0Hz,1H),7.54(d d, J=8.5, 0.6Hz, 1H), 7.47 (dd, J=8.5, 6.9Hz, 1H), 6.93 (dd, J=6.9, 0.6Hz, 1H), 3.99 (q, J=7.2Hz, 2H), 1.38 (t, J=7.2Hz, 3H).

[0052] (2) Synthesis steps of compound 2

[0053] 0.25 g (1.27 mmol) of compound 1 was dissolved in 10 mL of anhydrous tetrahydrofuran (THF) and cooled to 0 °C with continuous stirring. Then, 0.64 mL of a 3 mol / L solution of methyl magnesium chloride (MeMgCl) in tetrahydrofuran was slowly added. After the addition was complete, the reaction mixture was stirred at 60 °C for 2 h. Subsequently, 20 mL of 2 mol / L hydrochloric acid was added, and the tetrahydrofuran was evaporated. The residue was mixed with 10 mL of saturated potassium iodide (KI) solution and allowed to stand for 30 min. After the product precipitated, it was collected by filtration and dried under vacuum without further purification to give a red solid, compound 2 (76% yield). 1 H NMR (400MHz, DMSO-d6) δ8.99(d,J=7.2Hz,1H),8.81(d,J=8.0Hz,1H),8.56(d,J=7.4Hz,1H),8.46(d,J=8.2Hz ,1H),8.18(t,J=7.6Hz,1H),8.02(t,J=7.9Hz,1H),4.73(q,J=7.3Hz,2H),3.25(s,3H),1.56(t,J=7.3Hz,3H).

[0054] (3) Synthesis steps of compound 3

[0055] The method for compound S-5 in the reference (DOI: 10.1002 / anie.201303016) was used to synthesize a colorless liquid, compound 3 (yield 63%). 1 H NMR (400MHz, Chloroform-d) δ9.91 (s, 1H), 2.91 (ddt, J = 8.0, 7.1, 2.3Hz, 2H), 2.54 (tt, J = 7.9, 2.3Hz, 2H), 2.02 (tt, J = 8.4, 6.9Hz, 2H).

[0056] (4) Synthesis steps of compound 6

[0057] 0.57 g (4.13 mmol) of 4-methoxyphenyl-1,2-diamine and 0.42 g (3.72 mmol) of cyclohexane-1,2-dione were dissolved in 10 mL of acetonitrile (CH3CN). The mixture was heated overnight at 90 °C. After cooling to room temperature, the mixture was purified by silica gel column chromatography (ethyl acetate / hexane = 1:10) to give the target product, compound 6 (0.68 g, 85% yield), as a yellow solid. 1 H NMR (400MHz, Chloroform-d) δ7.83 (d, J = 9.2 Hz, 1H), 7.30 (dd, J = 9.1, 2.8 Hz, 1H), 7.25 (s, 1H), 3.93 (s, 3H), 3.18–3.07 (m, 4H), 2.02 (h, J = 3.3Hz, 4H).

[0058] (5) Synthesis steps of compound 7

[0059] 0.72 g (3.36 mmol) of compound 6 was dissolved in 10 mL of toluene and cooled to 0 °C. Then, 5 molar amounts of sodium borohydride (NaBH4) were slowly added. After the addition was complete, 15 mL of glacial acetic acid was slowly added to the reaction mixture over 1 hour, and the mixture was stirred at 0 °C for another 1 hour. Subsequently, the mixture was heated to 120 °C and reacted for 8 hours. After cooling, the reaction was terminated by adding 1 mol / L hydrochloric acid, and the mixture was extracted with ethyl acetate. The organic layer was collected and dried over anhydrous sodium sulfate (Na2SO4). The resulting solid was filtered and washed with ethyl acetate. The filtrate was collected and concentrated under reduced pressure. The residue was purified by silica gel column chromatography (ethyl acetate: petroleum ether = 1:20) to give the target product, compound 7 (0.42 g, 45.6% yield), as a yellow solid. 1H NMR(400MHz,Chloroform-d)δ6.49(d,J=8.5Hz,1H),6.21(d,J=2.7Hz,1H),6.17(d,J=8.4Hz,1H),3.74(s,3H),3.47–3.26(m,3H),3.15 (ddd,J=29.1,14.7,7.1Hz,3H),1.85(q,J=8.8Hz,2H),1.60(s,2H),1.55–1.44(m,2H),1.41–1.30(m,2H),1.14(dt,J=12.3,7.1Hz,6H).

[0060] (6) Synthesis steps of compound 8

[0061] The method for compound 2 in reference (10.1002 / anie.202211409) was used to synthesize compound 8 (52% yield), which is a yellow solid. 1 H NMR(400MHz,Chloroform-d)δ11.52(s,1H),9.45(s,1H),6.49(s,1H),6.02(s,1H),3.52–3.13(m,6H),1 .98(q,J=5.6Hz,1H),1.87–1.61(m,3H),1.55–1.31(m,4H),1.20(t,J=7.2Hz,3H),1.11(t,J=7.0Hz,3H).

[0062] (7) Synthesis steps of compound 9

[0063] Following the same synthetic steps as compound 4, compound 9 (yield 48%) was synthesized as a yellow solid. 1 H NMR(400MHz,Chloroform-d)δ9.93(s,1H),6.60(d,J=2.1Hz,1H),6.40(s,1H),6.27(s,1H),3.54–3.35(m,3H),3.31–3.12(m,3H),2.72 (t,J=2.1Hz,4H),1.96–1.78(m,2H),1.54(td,J=9.7,9.2,2.8Hz,2H),1.46–1.33(m,2H),1.21(t,J=7.1Hz,3H),1.14(t,J=7.0Hz,3H).

[0064] (8) Synthesis steps of NIR Hcy1100

[0065] Following the synthesis steps of NIR Hcy800, a green solid, NIR Hcy1100, was synthesized (yield 56%).1 HNMR (400MHz, DMSO-d6) δ8.34(d,J=7.4Hz,1H),8.11(d,J=13.3Hz,1H),7.98(t,J=4.1Hz,2H),7.82(t,J=7. 7Hz,1H),7.54–7.42(m,2H),7.16(s,1H),7.11(d,J=7.0Hz,1H),6.91(s,1H),6.24(d,J=13.3Hz,1H),4.16(q ,J=7.0Hz,2H),3.84(dq,J=14.0,7.0Hz,1H),3.78–3.47(m,4H),3.36(d,J=7.4Hz,1H),3.04(s,4H),2.02(s ,1H),1.82(s,1H),1.73–1.55(m,3H),1.50–1.39(m,3H),1.30(td,J=7.1,5.0Hz,6H),1.13(t,J=6.9Hz,3H). 13 CNMR(101MHz,CDCl3)δ164.58,152.81,148.00,144.33,141.43,136.03,134.66,13 2.70,130.72,130.31,130.17,129.30,128.75,127.63,125.98,125.93,119.08,118 .66,105.08,103.89,96.90,57.77,53.56,52.33,44.84,40.61,38.30,29.76,27.7 3,27.52,25.49,25.38,23.25,21.19,13.42,12.40,10.19,0.07.MS(ESI)calcd.For C 37 H 40 N3O + [M + ],542.3166; found 542.3166.

[0066] Example 2: Preparation of PLH1100 nanoparticles, a hemicyanine photosensitizer

[0067] Angiopep-2 (Ang-2) is a 19-amino acid ligand (TFFYGGSRGKRNNFKTEEY, SEQ ID No. 1) that binds to low-density lipoprotein receptor-associated protein-1 (LRP1) and is widely used to target LRP1 at the blood-brain barrier (BBB) ​​for brain delivery.

[0068] First, 3 mg Ang-2-SH, 1 mg DSPE-PEG2000-Mal, and 4 mL PBS were incubated overnight at 37°C under nitrogen. The resulting solution was then dialyzed and freeze-dried to obtain DSPE-PEG2000-Ang-2. Next, 1.0 mg NIR-II Hcy1100 prepared in Example 1, 2.0 mg DSPE-PEG2000, and 1.0 mg DSPE-PEG2000-Ang-2 were completely dissolved in 0.5 mL chloroform and immediately dried under vacuum to obtain a mixture. The mixture was mixed with 2 mL deionized water, stirred, and sonicated for 2 minutes. The mixture was heated in a 70°C water bath for 30 minutes to promote self-assembly. After cooling to room temperature, 2 mg lactate oxidase (LOX) was added and stirred for 2 hours. LOX was loaded via electrostatic interactions to form a suspension containing PLH1100 nanoparticles.

[0069] The resulting suspension was ultrafiltered for 20 minutes at 3700 rpm through a membrane with a molecular weight cutoff of 100,000 Da. Finally, the solution was filtered through a 0.22-micron Millex-GP filter for later use.

[0070] The following section describes the preparation of comparative samples.

[0071] Comparative Example 1: Preparation of the semi-cyanine dye-based molecule NIR HCy800

[0072] The NIR HCy800 was prepared according to the following synthetic route:

[0073]

[0074] (1) Synthesis steps of compound 4

[0075] 1.1 g (7.23 mmol) of 2-hydroxy-4-methoxybenzaldehyde, 2.51 g (14.46 mmol) of compound 3 prepared in Example 1, and 7.07 g (21.69 mmol) of cesium carbonate (Cs₂CO₃) were dissolved in dimethylformamide (DMF). The reaction mixture was stirred at room temperature for 48 hours. The precipitated solid was filtered and washed with ethyl acetate. The product was then purified by silica gel column chromatography (ethyl acetate / hexane = 1:10) to give a yellow solid, compound 4 (1.53 g, yield 65.6%). 1 HNMR(400MHz,Chloroform-d)δ9.96(s,1H),7.11(d,J=8.4Hz,1H),6.76(d,J=2.5 Hz,1H),6.72(dd,J=8.4,2.4Hz,1H),6.69(s,1H),3.85(s,3H),2.81–2.72(m,4H).

[0076] (2) Synthesis steps of NIR HCy800

[0077] 0.50 g (2.20 mmol) of compound 4 was dissolved in 0.025–0.05 M anhydrous acetic anhydride (Ac₂O), and 1.2 molar amounts of compound 2 prepared in Example 1 and 3.5 molar amounts of sodium acetate (AcONa) were added. The mixture was stirred at 100 °C for 2 hours. The reaction mixture was concentrated under reduced pressure to obtain a crude product, which was then further purified by silica gel column chromatography (dichloromethane / methanol = 20:1) to give NIR Hcy800 (0.56 g, yield 47.4%). 1 H NMR (400MHz, DMSO-d6) δ8.80(d,J=7.4Hz,1H),8.62(d,J=14.3Hz,1H),8.39(d,J=8.1Hz, 1H),8.05(t,J=7.7Hz,1H),7.94(d,J=8.2Hz,1H),7.81(d,J=7.3Hz,1H),7.73(dd,J=8.2, 7.4Hz,1H),7.63–7.56(m,2H),7.38(d,J=2.5Hz,1H),7.05(dd,J=8.6,2.5Hz,1H),6.68( d,J=14.3Hz,1H),4.51(q,J=7.1Hz,2H),3.95(s,3H),3.00(s,4H),1.42(t,J=7.1Hz,3H). 13 CNMR(101MHz,DMSO-d6)δ165.23,165.01,162.98,158.75,157.73,156.73,154.46,152.77,140.19,138.13,133.57,131.79,130.98 ,130.21,129.76,129.67,125.69,124.46,117.18,114.86,113.41,109.81,102.12,56.79,55.39,24.80,14.66.MS(ESI)calcd.For C 28 H 24 NO2 + [M + ],406.1802;found 406.2.

[0078] Comparative Example 2: Preparation of the hemicyanine dye-based molecule NIR HCy970

[0079] The NIR HCy970 was prepared according to the following synthetic route:

[0080]

[0081] (1) Synthesis steps of compound 5

[0082] Following the same synthetic procedure as compound 4, compound 5 (1.35 g, yield 56.3%) was synthesized as a red solid. 1 HNMR(400MHz,Chloroform-d)δ9.99(s,1H),7.00–6.95(m,1H),6.57(d,J=2.3Hz,1H ), 6.43 (s, 2H), 3.38 (q, J = 7.1Hz, 4H), 2.71 (d, J = 1.7Hz, 4H), 1.20 (t, J = 7.1Hz, 6H).

[0083] (2) Synthesis steps of NIR HCy970

[0084] Following the synthesis steps of Comparative Example 1 NIR Hcy800, a red solid, NIR Hcy970 (0.25 g, yield 34.9%), was synthesized. 1 H NMR (400MHz, DMSO-d6) δ8.54(d,J=7.4Hz,1H),8.34(d,J=13.5Hz,1H),8.13(d,J=8.0Hz, 1H),7.91(t,J=7.7Hz,1H),7.86(s,1H),7.63(d,J=8.2Hz,1H),7.56(dt,J=8.3,3.6Hz,2 H),7.37(d,J=7.1Hz,1H),7.03(d,J=13.6Hz,2H),6.33(d,J=13.6Hz,1H),3.58(q,J=7.1 Hz, 4H), 3.44 (q, J = 7.0Hz, 2H), 2.97 (s, 4H), 1.34 (t, J = 7.1Hz, 3H), 1.22 (t, J = 7.0Hz, 6H). 13 C NMR (101MHz, DMSO) δ168.21,156.77,152.82,151.52,141.12,137.19,134.39,133.48,130.84,130.66,130.43,130.16,129.97,126.7 6,121.94,115.30,114.07,108.67,105.55,97.36,56.49,45.12,38.60,25.53,25.01,21.54,19.04,13.98,13.08.MS(ESI)calcd.For C 31 H 31 N2O + [M+ ],447.2431;found 447.2.

[0085] Comparative Example 3: Preparation of PH1100 Nanoparticles

[0086] The preparation of PLH1100 nanoparticles in Example 2 is similar to that of PH1100, except that lactate oxidase (LOX) is not added. Nanoparticles that are not adsorbed by LOX after being encapsulated by micelles are prepared.

[0087] The following experimental examples demonstrate the beneficial effects of the present invention.

[0088] Experimental Example 1: Determination of the photothermal properties of semi-cyanine dye-based molecules

[0089] In this invention, three semicyanine dye-based molecules, NIR Hcy800, NIR Hcy970, and NIR Hcy1100, were prepared. Density functional theory (DFT) calculations and electrostatic potential analysis were performed to test the electronic excitation and photophysical property changes of the three semicyanine dye-based molecules.

[0090] Optimized geometry, HOMO, LUMO, and molecular electrostatic potential (MEP) plots are shown below. Figure 1 As shown in AC, according to DFT calculations, NIR Hcy1100 exhibits a smaller HOMO-LUMO band gap of 1.80 eV, while NIR Hcy800 and NIR Hcy970 show HOMO-LUMO band gaps of 2.05 eV and 1.95 eV, respectively. Furthermore, these three different electron donors also alter the intrinsic electrostatic potential. NIR Hcy1100 has the lowest extremum of 74.08 kcal / mol, while NIR Hcy800 and NIR Hcy970 have 80.09 kcal / mol and 77.02 kcal / mol, respectively. In summary, the introduction of the electron-rich terminal group 1,4-diethyl-decahydroquinoline not only endows Hcy with coplanarity and a larger π-conjugated DA structure, but also promotes intramolecular charge transfer and reduces the HOMO-LUMO band gap.

[0091] In addition, the photophysical properties of the three compounds were tested. Figure 1(D) This study observed that the 1,4-diethyl-decahydroquinoline group promoted a redshift in the absorption and emission spectra, exhibiting a maximum absorption wavelength exceeding 1000 nm and a strongest emission wavelength of 1100 nm (NIR-II Hcy1100). In contrast, methoxy and N,N-diethyl substituted molecules showed optimal emission wavelengths of 800 nm (NIR Hcy800) and 970 nm (NIR Hcy970), respectively. However, both of these molecules exhibited narrower absorption spectra, with negligible fluorescence absorption at 900 nm. In summary, compared to methoxy (NIR Hcy800) and N,N-diethyl substituted (NIR Hcy970), the 1,4-diethyl-decahydroquinoline substituted (NIR-II Hcy1100) Hcy exhibits superior photophysical properties, making it an ideal organic photosensitizer for GBM PTI.

[0092] The experimental results above show that, compared to NIR Hcy800 and NIR Hcy970, NIR-II Hcy1100 has the smallest HOMO-LUMO band gap and a larger π-conjugated DA structure, exhibiting superior photophysical properties, with a maximum absorption wavelength exceeding 1000 nm and a strongest emission wavelength of 1100 nm. Therefore, this invention selects NIR-II Hcy1100 as the small molecule for constructing a semi-cyanine photosensitizer.

[0093] Experimental Example 2: Structural characterization, performance determination, and therapeutic effects of hemicyanine photosensitizers on GBM model mice.

[0094] 1. Experimental Methods

[0095] (1) Cell culture and animals

[0096] HEK-293T cells and human and mouse glioblastoma (GBM) cell lines (U87 and GL261) were purchased from ATCC and cultured in DMEM medium containing 10% fetal bovine serum and 1.0 mmol / L penicillin-streptomycin combination, and in a humidified incubator at 37°C with 5% CO2. Following the methods described in the references (DOI: 10.1016 / j.canlet.2024.216760; 10.1080 / 2162402X.2022.2127508; 10.1038 / s41467-023-39683-z; 10.1007 / s00262-024-03757-8), GL261 cells expressing human Fn14 and luciferase (GL261-hFn14 / luc) were established for subsequent experiments.

[0097] In addition, 6-8 week old female BALB / c-nu mice and C57BL / 6 mice were purchased from GemPharmatech and fed under pathogen-free conditions according to a typical 12-hour light-12-hour dark cycle.

[0098] (2) Detection of in vitro photothermal efficiency and detection of intracellular ROS generation using BES-H2O2-Ac

[0099] Place PLH1100 in a 1.5 mL test tube and apply a 980 nm laser (0.5 W / cm²). 2 Irradiation was performed for 10 minutes to assess photothermal performance. Temperature changes were monitored and recorded using an infrared thermal imager. To assess photothermal stability, four heating and cooling cycles were repeated, and temperature data were collected in each cycle. PBS was used as a control under the same conditions to ensure accurate comparison.

[0100] To detect intracellular ROS production, U87 and GL261 cells were first seeded in 24-well plates at a density of 5 × 10^4 cells per well and allowed to attach during a 24-hour incubation period. Then, the cells were treated with 5 μg / mL PLH1100 and 10 μM lactate for 2 hours. Subsequently, the cells were stained with BES-H2O2-Ac for 30 minutes, washed three times with PBS, and then observed under a confocal microscope.

[0101] (3) MTT cytotoxicity assessment

[0102] First, the cells were placed at 5 × 10⁶ cells per dish. ^6 Cells were seeded at a density of 100 mm in 100 mm cell culture dishes and incubated in a cell culture incubator with complete medium for 24 hours. After incubation, cells were harvested and divided into different groups into 1.5 mL test tubes. The medium was then replaced with 1 mL of DMEM containing different concentrations of PLH1100 (0, 1, 2, 3, 4, 5, 6, 7, 8 μg / mL). Next, the cells were subjected to laser treatment (980 nm, 0.5 W / cm²). 2 (10 minutes). After 24 hours, add 500 μL of MTT (1×) to each well and incubate for another 4 hours. Then, remove the culture medium and add 500 μL of DMSO to each tube to dissolve the formed formazan crystals. Measure the absorbance at 570 nm and 630 nm using a microplate reader. Calculate the relative cell viability using the following formula:

[0103]

[0104] (4) Annexin V-FITC & PI assessment of cytotoxicity

[0105] U87 and GL261 cells were spaced at 3 × 10⁻⁶ cells per well.^5 Cells were seeded at a density of [number] cells per well in 6-well plates and incubated for 24 hours to allow for cell attachment. Subsequently, cells were subjected to different treatment conditions: PBS group, PBS + light group, 5 μg / mL PLH1100 + dark group, and 5 μg / mL PLH1100 + light group. The light-treated groups were exposed to 980 nm light for 10 minutes, while the dark-treated groups were not exposed to light under the same conditions. After treatment, cells were washed three times with PBS and then stained in 1× binding buffer using the Annexin V-FITC & PI apoptosis detection kit. Flow cytometry was used to analyze the stained cells to detect the level of apoptosis under different conditions.

[0106] (5) Photothermal conversion efficiency

[0107] Photothermal conversion efficiency (η) is measured as follows:

[0108]

[0109] Where h represents the heat transfer coefficient, s is the surface area of ​​the container, and the product of h and s can be calculated using the following formula (2). Qdis represents the heat dissipated by the solvent and the container. I is the incident power, and A980 is the absorbance at 980 nm.

[0110]

[0111] Where m and c represent the mass and specific heat capacity of the solution, respectively. τs can be determined by formula (3):

[0112]

[0113] Where t is the real-time temperature during cooling, and θ is a dimensionless parameter whose value can be obtained by formula (4).

[0114]

[0115] (6) Establishment of tumor models

[0116] For the GBM mouse model, anesthetized BALB / c-nu and C57BL / 6 mice were stereotactically injected with 1×10^5 U87 cells or GL261-hFn14 / luc cells into the right frontal lobe of the brain (2 mm from the sagittal suture, 1 mm from the anterior fontanelle, and 3 mm deep).

[0117] (7) Assessment of blood-brain barrier permeability and lactate oxidation in vivo

[0118] First, this study assessed the in vitro blood-brain barrier permeability using a Transwell model. For in vivo assessment, 7 days after tumor model establishment, U87 tumor-burdened BALB / c-nu mice were injected via tail vein with Cy5.5-labeled PLH1100 (10 mg / kg). Mice were sacrificed at 3, 6, 9, 12, and 24 hours post-injection, and the brain and other major organs were harvested. Blood-brain barrier permeability and in vivo biodistribution were assessed by detecting fluorescence signals. Subsequently, tumor and normal brain tissue collected at different time points were homogenized in ice-cold PBS for 4 minutes. The homogenate was centrifuged at 15,000 rpm for 15 minutes, and the supernatant was transferred to 96-well plates to determine lactate levels. Additionally, another group of mice was used to assess the blood-brain barrier permeability of PLH1100 using NIR-II imaging.

[0119] (8) In vivo photothermal therapy and photothermal imaging

[0120] U87 tumor-bearing BALB / c-nu mice were randomly divided into 4 groups (n=4 per group) and received different treatments: control group, PBS + light, PLH1100 + dark, and PLH1100 + light (PLH1100 dose was 10 mg / kg in the corresponding groups). 980 nm light treatment (0.5 W / cm²) was also administered. 2 The treatment began 12 hours after drug administration and was repeated four times, each time for 5 minutes. Photothermal imaging was performed 12 hours after drug administration in both the PBS+light and PLH1100+light therapy groups, recording at 0, 3, and 6 minutes after irradiation. GBM growth was recorded every 7 days by MRI imaging, with mouse death serving as the endpoint of the experiment. In the parallel groups, mice were sacrificed 3 days after the last irradiation, and tumors and major organs (heart, liver, spleen, lung, and kidney) were removed for immunofluorescence and H&E staining.

[0121] (9) Statistical Analysis

[0122] Image J software was used to process and analyze images and fluorescence intensities. Data were analyzed using GraphPad Prism version 9.0, and results are expressed as mean ± standard deviation (SD), n≥3. Statistical significance between two independent groups was determined by unpaired two-tailed Student's t-test, and one-way ANOVA was used for comparisons among multiple groups. Survival data were assessed using the Kaplan-Meier method and compared using the log-rank test. *p<0.05, **p<0.01, ***p<0.001.

[0123] 2. Experimental Results

[0124] (1) Structural characterization and photothermal properties of PLH1100 nanoparticles

[0125] result( Figure 2The data shows that the self-assembly process of PLH1100 nanoparticles is achieved by red-shifting the maximum absorption peak from 730 nm to 800 nm. Figure 2 A), and a fluorescence emission peak appears at approximately 1150 nm (A). Figure 3 A) Successful synthesis was confirmed. Transmission electron microscopy (TEM) and dynamic light scattering (DLS) measurements showed that the PLH1100 nanocomposite was a uniform sphere with an average diameter of 206 nm. Figure 2 B, C). Furthermore, the presence or absence of LOX (PLH1100) or not (designated PH1100) affects the potential of the nanoparticles, with average potentials of -31.0 mV and -40.2 mV, respectively, while the potential of free LOX is approximately 12.0 mV, indicating successful binding of LOX to the nanoparticles. Figure 2 D). This study used UV-Vis spectrophotometry to determine the concentrations of NIR-II Hcy1100 and LOX. The results showed that the concentration of NIR-II Hcy1100 in PLH1100 was 404.5 μg / mL, while the concentration of LOX was 375.8 μg / mL. Figure 3 (B, C). To assess the stability of PLH1100 in a physiological environment, its hydrodynamic dimensions were characterized in PBS for 7 days. Figure 3 As shown in Figure E, no significant size change was observed, indicating that the nanocomposite possesses good stability. Furthermore, the PLH1100 nanoparticles also exhibited significant absorption intensity under 980 nm light, providing an ideal biological window for effective photothermal therapy of deep brain tumors.

[0126] In vitro, the photothermal effect of PLH1100 under 980nm laser irradiation was recorded using an infrared camera. For example... Figure 2 As shown in E and F, 0.5 W / cm 2 Irradiation with a 980 nm laser for 10 minutes resulted in rapid temperature rise in PBS solutions of different concentrations (0, 5, 10, 15, 30 μg / mL). Different laser exposure powers (0.1, 0.3, 0.5, 0.7 W / cm²) were also recorded. 2 Temperature change of 10 μg / mL PLH1100 over 10 minutes ( Figure 3 F). The results show that the photothermal capability of PLH1100 is positively correlated with concentration, laser exposure power, and time. Furthermore, Figure 2 G demonstrates the effect of a 15 μg / mL PLH1100 aqueous solution on a 980 nm laser (0.5 W / cm²). 2 The photothermal heating and cooling curves under (θ) are shown. The linear fit of cooling time to ln(θ) is as follows: Figure 2 As shown in H, the photothermal conversion efficiency of PLH1100 is calculated to be 58.7%. Figure 2 In step I, the photothermal stability of 15 μg / mL PLH1100 was also examined. After four laser on / off cycles, the temperature did not decrease significantly, reaching a consistent maximum temperature of approximately 66 °C, indicating its excellent photothermal stability.

[0127] (2) Catalytic activity and cytotoxicity of PLH1100 for lactate

[0128] Lactic acid accumulation in the tumor microenvironment negatively impacts immunotherapy, while reducing lactic acid production from tumor cell metabolism aids in tumor elimination. To verify the catalytic activity and bioactivity of PLH1100 against lactic acid, this study immersed dialysis membranes containing PLH1100 in a lactic acid solution and incubated them in a shaker at 37°C. Residual lactic acid concentration in the dialysate was measured periodically. Figure 4 As shown in Figure A, the lactic acid concentration in the dialysate gradually decreased, similar to the free LOX group, indicating that PLH1100 does not affect the catalytic activity of LOX. Next, the reaction product H2O2 was investigated to further confirm the catalytic process of PLH1100. With increasing lactic acid concentration, the generated H2O2 exhibited a similar concentration-dependent pattern, while a decrease in dissolved oxygen was observed. Figure 4 B) indicates that this degradation reaction requires oxygen. Furthermore, the release of NIR-II Hcy1100 was tested by high-performance liquid chromatography (HPLC). Figure 4 (C,D). PLH1100 was dispersed in 5 mM lactic acid solution and NIR-II Hcy1100 was separated and detected by ultrafiltration centrifugation every 20 minutes at 37 °C. From 20 to 100 minutes, a chromatographic peak at 800 nm was detected, which gradually increased and maintained the same retention time as NIR-II Hcy1100, indicating that acidic conditions and catalytic processes may have destroyed the structure of the nanodots, releasing NIR-II Hcy1100.

[0129] Cytotoxicity testing such as Figure 4 As shown in Figure E, when the PLH1100 concentration was 5 μg / mL, under 980 nm laser irradiation (0.5 W / cm², 10 min), the late necrosis rate of GL261 cells was close to 40% (PI+, Annexin V+), while in the dark, the cell necrosis rate was only 5%. Figure 4 E, F). Similar results were confirmed in the human GBM cell line (U87). Figure 4J). This indicates that PLH1100 has a potent antitumor effect under light conditions. Then, cytotoxicity was tested by adding lactate to explore the killing effect of endogenous H2O2 on cancer cells. In this study, with increasing PLH1100 concentration, it showed strong cytotoxicity against GL261 cells in the presence of exogenous lactate (10 mM), while tumor cells exposed to lactate alone did not show significant cell death. Figure 4 G,H). Similar results were also observed in U87 cells ( Figure 4 K). Furthermore, this study used BES-H2O2-Ac (a specific H2O2 probe) to detect the generation of H2O2. For example... Figure 4 I and Figure 4 As shown in Figure L, strong fluorescence signals were observed in tumor cells incubated with lactate after the addition of free LOX or PLH1100, while no fluorescence signal was detected in the PLH1100 treatment group without lactate. This indicates that, at the in vitro cellular level, PLH1100 can oxidize lactate similarly to LOX and promote the production of intracellular H2O2, thereby enhancing its cytotoxicity.

[0130] (3) Examination of the effect of PLH1100 on in vitro induction of immunogenic cell death

[0131] Photothermal effects and H2O2 also contribute to activating tumor immunogenicity and enhancing immune responses by promoting the release and expression of DAMPs (including HMGB1, ATP, and CRT) from dying cells; these are representative biomarkers of ICDs. Specifically, PLH1100-induced HMGB1 and ATP release, as well as CRT expression, were detected by immunofluorescence staining, flow cytometry, and chemiluminescence. Figure 5 As shown in AC, after 6 hours of 980nm laser irradiation, GL261 and U87 cells treated with PLH1100 showed significant release of HMGB1, and the extracellular fluorescence intensity in the light-treated group was significantly higher than that in the control and dark groups. Similarly, CRT expression and ATP release significantly increased after light treatment. Figure 5 These results further demonstrate that the photothermal effect of PLH1100, as well as its consumption of lactate, can not only effectively kill tumor cells but also significantly promote ICD.

[0132] (4) Therapeutic effect of hemicyanine photosensitizers on GBM model mice

[0133] This study used the Transwell model to evaluate the ability of PLH1100 to cross the BBB in vitro. Figure 6As shown in Figure M, the red fluorescence detected in U87 and GL261-hFn14 / luc cells in the lower intracranial cavity indicates that PLH1100, after Ang-2 modification, can effectively penetrate the BBB. Subsequently, this study evaluated the dynamic distribution of PLH1100 in BALB / c-nu mice carrying orthotopic U87 tumors. The results showed that PLH1100 accumulated in intracranial tumors 3 hours after administration, reaching peak fluorescence intensity at 12 hours, and then gradually decreased. During the monitoring period, the liver was the main organ for PLH1100 accumulation, with the highest fluorescence intensity at 9 hours, followed by the lungs and kidneys. Figure 6 (A, B). NIR-II fluorescence imaging offers superior penetration into deep tissues, low background noise, and high resolution. Since the emission spectrum of NIR-II Hcy1100 exceeds 1100 nm, this study employed NIR-II imaging to assess the dynamic distribution of PLH1100 in intracranial tumors. Figure 6 As shown in Figure C, its imaging characteristics are consistent with those of Cy5.5-labeled nanoparticles. Tumor imaging was observed 3 hours after administration, and peak fluorescence intensity was reached at 12 hours. Furthermore, in vivo photothermal effect measurements showed that under 980 nm laser irradiation (0.5 W / cm²), 2 In the treatment group, the intracranial temperature gradually increased over time, reaching 55°C within 6 minutes, which met the requirements of mild photothermal therapy, while the temperature in the control group did not increase significantly. Figure 6 D, E). Furthermore, this study also assessed the safety and biocompatibility of PLH1100 14 days after administration by H&E staining of major organ sections from mice. Results showed that, compared with the control group, no significant pathological structural damage was observed in the major organs of the treatment group (D, E). Figure 6 In summary, this study demonstrates that the PLH1100 constructed in this study can effectively reach the target tumor and exhibits excellent photothermal properties in vivo, while also possessing reliable safety.

[0134] Furthermore, this study evaluated the therapeutic efficacy of PLH1100 and its activation of ICD effects in BALB / c-nu mice carrying orthotopic U87 tumors. Detailed treatment protocols are as follows: Figure 6 As shown in G. Seven days after establishing the orthotopic U87 model, each mouse received a single dose of PLH1100 (10 mg / kg), followed by 980 nm laser treatment 12 hours later. Each laser irradiation lasted 6 minutes, repeated 4 times. MRI was used to monitor tumor growth. Figure 6 As shown in Figure H, the tumor volume increase was greater in the control group, PBS+light group, and PLH1100+dark group than in the PLH1100+light treatment group over time. On days 21 and 28, the mean tumor volume in the PLH1100+light group was significantly smaller than that in the other three groups (p<0.01). Figure 6Figure 1 shows representative MRI results on day 28. Correspondingly, mice in the PLH1100+ light therapy group had longer survival times than the other three groups. Figure 6 J). Further histopathological analysis ( Figure 6 K,L; Figure 6 The results showed that the PLH1100+ phototherapy group had a lower Ki67 positivity rate, a higher Tunel positivity rate, and significant tumor cell apoptosis, indicating that the photothermal effect slowed tumor proliferation and induced tumor cell death to some extent. Importantly, this study also evaluated induced DAMPs, such as HMGB1 and CRT. Figure 6 As shown in Figure O, PLH1100+ phototherapy significantly promoted the release of nuclear HMGB1 and the expression of extracellular CRT, which helps activate antigen-presenting cells and enhance the body's tumor immune response. Finally, this study evaluated the relative lactate content within the tumor (…). Figure 6 F). Compared with the control group and the light-irradiated group, the relative lactate content within the tumor was reduced in the PLH1100 treatment group. Furthermore, the lactate content in the PLH1100 + light-irradiated group was lower than that in the PLH1100 + dark group, indicating that the photothermal effect further promoted LOX release. These results demonstrate that PLH1100 in this study not only inhibits tumor growth in vivo but also effectively reduces lactate levels and improves the acidic environment within the tumor.

[0135] The experimental results above show that the semicyanide photosensitizer PLH1100 has excellent brain targeting, tumor enrichment, photostability and biocompatibility, as well as excellent photothermal conversion efficiency (58.7%) and NIR-II tumor imaging capability. It can effectively reduce lactate levels and improve the acidic environment within the tumor.

[0136] Experimental Example 3: Synergistic therapeutic effect of hemicyanine photosensitizers combined with bispecific T-cell connectives

[0137] 1. Preparation and expression of bispecific T cell adaptors

[0138] Studies have shown that Fn14 can be an ideal target for GBM immunotherapy. Previously, a study (DOI: 10.1080 / 2162402x.2021.1983306) reported an Fn14×hCD3 BiTE (referred to as hBiTE) that mediates human T cell targeting of the U87 cell line. To further evaluate the synergistic anti-tumor efficacy of PTIs activating the ICD and BiTE, this study expressed an Fn14×CD3 mBiTE (referred to as mBiTE) that mediates mouse T cell killing of GL261-hFn14 / luc (a mouse GBM cell line expressing human Fn14 protein and luciferase).

[0139] Following the description in the literature (DOI: 10.1080 / 2162402x.2021.1983306), hBiTE was constructed and expressed. The CD3 sequence targeting human CD3 antigen in hBiTE (named hCD3) was replaced with the CD3 sequence targeting mouse CD3 antigen (named mCD3) to construct and express mBiTE. The recombinant cDNA encoding mBiTE was subcloned into a eukaryotic expression vector with a C-terminal His tag for purification. HEK-293T cells were transfected with these vectors and cultured in FreeStyle serum-free medium (Thermo Fisher Scientific) at 37°C and 5% CO2. After 7 days, the supernatant was collected, and the recombinant mBiTE was purified using a Ni-NTA affinity column and further refined using a Superdex 200 Increase 10 / 300GL column (GE). The purity and size of the purified mBiTE were confirmed by SDS-PAGE and Coomassie Brilliant Blue staining. The anti-Fn14 scFv sequence, including the VL and VH regions, is derived from the monoclonal antibody P4A8 (patent EP2294089A2), which has been verified to effectively bind to Fn14 on glioma cells. The anti-CD3 scFv sequence in the mBiTE construction is derived from mouse CD3ε (clone OKT3). The specific sequence is as follows:

[0140] Anti-mCD3 scFv sequence (SEQ ID No. 2):

[0141] GGAGGCGGTGGCAGCGAGGTGCAGCTGGTGGAGTCTGGGGGAGGCTTGGTGCAGCCTGGAAAGTCCCTGAAACTCTCCTGTGAGGCCTCTGGATTCACCTTCAGCGGCTATGGCATGCACTGGGTCCGCCAGGCTCCAGGGAGGGGGCTGGAGTCGGTCGCATAC ATTACTAGTAGTAGTATTAATATCAAATATGCTGACGCTGTGAAAGGCCGGTTCACCGTCTCCAGAGACAATGCCAAGAACTTACTGTTTCTACAAATGAACATTCTCAAGTCTGAGGACACAGCCATGTACTACTGTGCAAGATTCGACTGGGACAAAAATTACTGGGGCCAAGGAACCATGGTCACCGTCTCCTCAGGTGGCGGAGGCAGCGGTGGCGGAGGCAGTGGAGGCGGTGGCAGCGACATCCAGATGACCCAGTCTCCATCATCACTGCCTGCCTCCCTGGGAGACAGAGTCACTATCAATTGTCAGGCCAGTCAGGACATTAGCAATTATTTAAACTGGTACCAGCAGAAACCAGGGAAAGCTCCTAAGCTCCTGATCTATTATACAAATAAATTGGCAGATGGAGTCCCATCAAGGTTCAGTGGCAGTGGTTCTGGGAGAGATTCTTCTTTCACTATCAGCAGCCTGGAATCCGAAGATATTGGATCTTATTACTGTCAACAGTATTATAACTATCCGTGGACGTTCGGACCTGGCACCAAGCTGGAAATCAAACGG。

[0142] Anti-Fn14 scFv sequence (SEQ ID No. 3):

[0143] CAGGTCCAGCTGGTGCAGTCTGGGGCTGAGGTGAAGAAGCCTGGGGCCTCAGTGAAGGTTTCCTGCAAGGGTTCCGGCTACACATTCACTGATTATGGCATGCACTGGGTGCGGCAGGCCCCTGGACAAGGGCTAGAGTGGATGGGAGTTATTAGTACTTACAATGGTTATACAAACTACAACCAGAAGTTTAAGGGCAGAGTCACAATGACTGTAGACAAATCCACGAGCACAGCCTATATGGAACTTCGGAGCTTGAGATCTGACGATACGGCCGTGTATTACTGTGCAAGAGCCTACTATGGCAACCTTTACTATGCTATGGACTACTGGGGTCAAGGAACCCTGGTCACCGTCTCCTCAGACATTGTGCTGACACAGTCTCCTGCTTCCCTGGCTGTATCTCTGGGGCAGAGGGCCACCATCTCATGCAGGGCCAGCAAAAGTGTCAGTACATCTAGCTATAGTTATATGCACTGGTACCAACAGAAACCAGGACAGCCACCCAAACTCCTCATCAAATATGCATCCAACCTAGAATCTGGGGTCCCTGCCAGGTTCAGTGGCAGTGGGTCTGGGACAGACTTCTCCCTCAACATCCATCCCATGGAGGAGGACGATACCGCAATGTATTTCTGTCAGCACAGTAGGGAGCTTCCATTCACGTTCGGCGGAGGGACAAAGTTGGAAATAAAA。

[0144] G4S linker sequence (SEQ ID No. 4):

[0145] GGCGGAGGGGGTTCCGGTGGTGGCGGATCTGGAGGTGGCGGCAGC。

[0146] 2. Experimental methods

[0147] (1) Cell culture and animals

[0148] Refer to the cell culture and animals in Experimental Example 2.

[0149] (2) T cell isolation

[0150] Human peripheral blood mononuclear cells (PBMCs) were obtained from healthy donors by gradient centrifugation (800×g, 15 min). To activate T cells, T cells were treated with 200 ng / mL anti-CD3 monoclonal antibody (OKT3, BioLegend), 100 ng / mL anti-CD28 monoclonal antibody (CD28.2, BioLegend), and 100 U / mL recombinant human interleukin-2 (IL-2, LifeScience) for 48 h. Mouse PBMCs were mechanically isolated from the spleen and activated with IL-2 and 8 μg / mL concanavalin A (Millipore Sigma).

[0151] (3) Evaluation methods for in vitro synergistic therapy

[0152] U87 and GL261-hFn14 / luc tumor cells were seeded into 24-well plates (1 × 10^5 cells per well) and incubated for 24 hours to allow attachment. Subsequently, the cells were subjected to different treatment conditions: PLH1100 + light, PLH1100 + light + hBiTE / mBiTE, PLH1100 + light + human T cells (hT cells) / mouse T cells (mT cells), hBiTE / mBiTE + hT cells / mT cells, and PLH1100 + light + hBiTE / mBiTE + hT cells / mT cells. The concentration of PLH1100 used was 5 μg / mL, and the light exposure time was 10 minutes (980 nm, 0.5 W / cm²). 2 Following irradiation, 0.1 μg / mL BiTE and / or effector cells (human / mouse T cells) were added to the respective groups, with an effector cell to tumor cell ratio of 8:1. Tumor cell viability was subsequently assessed using the MTT assay. T cell proliferation was assessed by detecting the CytoTell™ Red signal intensity 24 hours post-treatment.

[0153] (4) In vivo synergistic therapy assessment method

[0154] GL261-hFn14 / luc tumor-bearing C57BL / 6 mice were randomly divided into 5 groups (n=4 per group) and received different treatments: PBS + light, PLOX, PLH1100 + light, mBiTE, and PLH1100 + light + mBiTE. The dose, 980nm light intensity, frequency, and duration of PLH1100 were consistent with the in vitro synergistic therapy evaluation method. Three days after the last irradiation, Fn14×CD3 mBiTE (10 ng) was dissolved in 5 μl of X-vivo medium and injected every 2 days for a total of 3 times using a stereotactic apparatus. Tumor growth was monitored every 7 days using an IVIS system, and mouse body weight was recorded every 2 days. Mouse death was considered the endpoint of the experiment. In the parallel group, mice were sacrificed 7 days after synergistic therapy, and tumors were collected for flow cytometry analysis of the tumor microenvironment.

[0155] (5) Statistical Analysis

[0156] Refer to the statistical analysis method in Experiment Example 2.

[0157] 3. Experimental Results

[0158] (1) In vitro assessment of the synergistic therapeutic effect of Fn14×CD3 mBiTE and PLH1100

[0159] Figure 6 G and H show a schematic diagram of the mBiTE construction and an SDS-PAGE protein quantification map. The results indicate that the molecular weight of mBiTE is between 55-70 kDa, similar to hBiTE, confirming the successful construction and purification of mBiTE. In immune-mediated killing assessment, mBiTE (0.1 μg / mL) showed excellent performance, achieving an average cell kill rate of 55% at an effector cell to target cell ratio of 8:1 and a killing time of 4 hours. Figure 5 L). Subsequent evaluations at different concentration gradients showed that mBiTE's EC50 50 It is 0.064 μg / mL ( Figure 5 M).

[0160] Under similar conditions, synergistic treatment strategies were also evaluated. First, this study assessed the effect of PLH1100 PTI on killing GL261-hFn14 / luc. (As...) Figure 6As shown in I and J, after laser irradiation, the photothermal effect altered the morphology of tumor cells and led to partial cell death. The killing effect of adding mBiTE and / or mouse T cells (mT cells) at 4, 8, and 12 hours after laser irradiation was then examined. The results showed that the treatment group with only mBiTE or mT cells did not significantly increase the killing effect on GL261-hFn14 / luc. However, the treatment group with both mBiTE and mT cells added after laser irradiation showed a significant killing effect, stronger than the treatment group with only mBiTE or mT cells added. Furthermore, in human immune cell cytotoxicity assays, the synergistic treatment group with added hBiTE and hT cells showed a more significant killing effect on U87 cells after laser irradiation, outperforming the other four treatment groups. Figure 5 N,O). Finally, considering that both photothermal effects and mBiTE-mediated mT cell activity are accompanied by the release of DAMPs and inflammatory factors, which contribute to lymphocyte proliferation, this study used CytoTell. TM Red monitored the proliferation of mT cells. For example... Figure 6 As shown in K, after 24 hours of co-culture killing, the signal intensity of mT cells in the co-treatment group decreased by 34.2%, which was higher than that in the non-co-treatment group (24.7% and 10.5%, respectively). This further indicates that the mT cells in the co-treatment group were more activated and underwent more proliferation. Similarly, the signal intensity of hT cells in the co-treatment group was also significantly reduced compared to other treatment groups. Figure 5 P).

[0161] In summary, the photothermal effect induced by PLH1100 can inhibit tumor cell growth in vitro, trigger an effective immune proliferative response, and has a significant synergistic effect with Fn14-targeted BiTE in the treatment of GBM.

[0162] (2) Synergistic treatment of PTI+Fn14×CD3 mBiTE strategy in C57BL / 6 mouse orthotopic GBM model

[0163] Figure 7 A shows the detailed treatment regimen for C57BL / 6 mice; the PLH1100 dosage and laser irradiation protocol were the same as in previous experiments. Figure 7As shown in B and C, among the single-treatment groups (PBS+Light, PLOX, PLH1100+Light, mBiTE), mBiTE exhibited the best therapeutic effect, with treated mice showing slower tumor growth and relatively longer survival. Furthermore, the PTI method with PLH1100+Light more effectively delayed intracranial tumor growth in mice than the PBS+Light and PLOX treatment groups. Importantly, the combination therapy of PTI+Fn14×CD3 mBiTE significantly inhibited tumor growth compared to single-treatment. The PLH1100+Light strategy in this study enhanced the tumor-killing ability of mBiTE, extending the survival time of treated mice to nearly 90 days. Figure 7 D). To validate the monitoring results, this study used immunofluorescence and Western blotting to detect Fn14 expression in GL261-hFn14 / luc cells. Figure 7 EG). The results showed that the PTI+Fn14×CD3 mBiTE strategy significantly inhibited Fn14 expression; the expression level was lowest in the PLH1100+Light+mBiTE treatment group, followed by the mBiTE and PLH1100+Light treatment groups, with the mBiTE treatment group showing a lower level than the PLH1100+Light group. This indicates that Fn14×CD3mBiTE in this study is effective in killing GL261-hFn14 / luc tumors, and its efficacy further enhances the immune activation effect induced by PLH1100. During the treatment period, the body weight changes of mice in each group were continuously monitored, and no significant differences were observed. Figure 7 In summary, these results demonstrate that the PTI+Fn14×CD3 mBiTE strategy is indeed feasible and effective in treating intracranial in situ GBM models in immunocompetent mice.

[0164] (3) Regulation and improvement of the immunosuppressive tumor microenvironment (TME) by PLH1100

[0165] PLH1100 not only improved the acidic environment within the tumor but also promoted the expression and release of damage-associated molecular patterns (DAMPs). This may activate tumor-associated immune cells such as lymphocytes and enhance the anti-tumor efficacy of mBiTE. Therefore, this study systematically evaluated changes in TME after different treatments using flow cytometry sorting strategies. Figure 7 I). Dendritic cells (DCs) play a crucial role in initiating immune responses, and their maturity was assessed using flow cytometry in this study. Figure 8As shown in A and D, compared with the PBS+Light group, the percentage of mature DCs (CD45+CD11c+CD80+CD86+) in the PLOX, PLH1100+Light, mBiTE and PLH1100+Light+mBiTE groups increased by approximately 11%, 18%, 15% and 33%, respectively.

[0166] Furthermore, this study evaluated the polarization of tumor-associated macrophages from the M2 phenotype (CD45+CD11b+F4 / 80+CD206+) to the M1 phenotype (CD45+CD11b+F4 / 80+CD86+), as M1 macrophages can inhibit and destroy tumor cells through phagocytosis or cytokine-mediated cell death. Figure 8 As shown in B and E, compared with the PBS+Light group, the M1 cell population in the single-treatment groups (PLOX, PLH1100+Light, mBiTE) increased by 9%, 6%, and 3%, respectively; however, the combination therapy group showed a significant increase of 17%. These results consistently indicate that combination therapy is more effective than single therapy in promoting DC maturation and M1 polarization.

[0167] Following these cascade events, activated cytotoxic CD8+ T lymphocytes (CTLs) and CD4+ helper T cells play crucial roles in cellular and humoral immunity during cancer immunotherapy. Therefore, this study analyzed the infiltration of CTLs in GBM in different treatment groups. Figure 8 (C, F, G). Following PLH1100+Light+mBiTE treatment, the infiltration of CTLs in the tumor significantly increased, rising from a mean of 30.6% in the PBS+Light group to 54.3%. In contrast, the mean CTL infiltration levels in the PLOX, PLH1100+Light, and mBiTE treatment groups were 41%, 32.4%, and 43.3%, respectively. Figure 8 C, F). Similarly, this study found that the synergistic treatment of PTI + Fn14×CD3 mBiTE increased the infiltration of CD4+ T cells in the tumor compared with the PBS + Light group (C, F). Figure 8 C, G).

[0168] In addition, this study also examined immune-response cytokines in tumors, including interferon-γ (IFN-γ) and tumor necrosis factor-α (TNF-α), such as Figure 8 As shown in Figures H and I, the PTI+Fn14×CD3 mBiTE group had the highest level of inflammation. Furthermore, regulatory T cells (Tregs) and myeloid-derived suppressor cells (MDSCs), as major components of tumor immunosuppression, are key obstacles to anti-cancer immunity. Recent studies have indicated that abnormal lactate metabolism in the tumor microenvironment (TME) is associated with enhanced activity of intratumoral Tregs and MDSCs. Figure 9 As shown in AD, the PTI+Fn14×CD3 mBiTE synergistic strategy in this study significantly reduced Treg cells and MDSCs within the tumor, indicated by the immune markers CD45+CD3+CD4+Foxp3+ and CD45+CD11b+Gr-1+, respectively. Overall, the PTI+Fn14×CD3 mBiTE strategy in this study successfully activated the immunosuppressive TME of GBM and demonstrated excellent synergistic antitumor response.

[0169] The experimental results above show that when the concentration of PLH1100 is 5 μg / mL, under an illumination intensity of 980 nm and a light intensity of 0.5 W / cm², the effect is satisfactory. 2 Ten minutes after irradiation, the combination with 0.1 μg / mL mBiTE exhibited a synergistic effect. Specifically, during the polarization of tumor-associated macrophages from the M2 phenotype (CD45+CD11b+F4 / 80+CD206+) to the M1 phenotype (CD45+CD11b+F4 / 80+CD86+), the M1 cell population in the combination therapy group increased by 17%, greater than the sum of PLH1100+Light (6%) and mBiTE (3%) in the single therapy group. This confirms that the combination of PLH1100 and Fn14×CD3mBiTE has a significant synergistic effect in PTI treatment of GBM at 980 nm light intensity.

[0170] In summary, this invention provides a hemicyanine photosensitizer, its preparation method, and its applications. This invention developed a hemicyanine dye-based molecule with a D-π-A structure through donor substitution engineering, which exhibits excellent spectral properties. The PLH1100 nanoassembly, further constructed based on this hemicyanine dye-based molecule, possesses excellent brain targeting, tumor enrichment, photostability, and biocompatibility, as well as outstanding photothermal conversion efficiency and NIR-II tumor imaging capabilities, making it suitable for photothermal immunotherapy of glioblastoma. Furthermore, this invention also discovered that PLH1100 can significantly enhance the efficacy of a bispecific T-cell connector targeting Fn14. The combined use of PLH1100 and the bispecific T-cell connector in photothermal immunotherapy demonstrates a synergistic effect, opening up new avenues for the clinical treatment of glioblastoma and possessing significant clinical application potential.

Claims

1. A semi-cyanine dye-based molecule, characterized in that, Its structure is shown in Equation I: Formula I Among them, R1 is selected from hydrogen, C 1-3 Alkyl group, R2 is selected from hydrogen, C 1-3 alkyl.

2. The hemicyanine dye-based molecule according to claim 1, characterized in that, Its structure is shown below: 。 3. A nanoparticle, characterized in that, It is a product obtained by reacting the hemicyanine dye-based molecules, liposomes, ligand-modified liposomes and biocatalysts described in claim 1 or 2 as raw materials.

4. The nanoparticles according to claim 3, characterized in that, The biocatalyst is lactate oxidase; The ligand is a ligand that targets low-density lipoprotein receptor-associated protein-1; the method for preparing the ligand-modified liposomes includes the following steps: reacting a thiolated ligand with a maleimide-containing liposome to obtain ligand-modified liposomes.

5. The nanoparticles according to claim 3, characterized in that, The amino acid sequence of the ligand is shown in SEQ ID No. 1; the method for preparing the ligand-modified liposomes includes the following steps: reacting the thiolated ligand with maleimide-containing liposomes to obtain ligand-modified liposomes.

6. The nanoparticles according to claim 5, characterized in that, The liposomes are DSPE-PEG2000.

7. A method for preparing the nanoparticles according to any one of claims 3-6, characterized in that, The method includes the following steps: heating and reacting hemicyanine dye-based molecules, liposomes, and ligand-modified liposomes to obtain a mixture, and reacting the mixture with a biocatalyst to obtain nanoparticles.

8. The method according to claim 7, characterized in that, The mass ratio of the hemicyanine dye-based molecule, liposome, ligand-modified liposome, and biocatalyst is 1:1-3:0.5-2:1-3; the solvent for the heating reaction is an inorganic solvent; the temperature of the heating reaction is 60-80°C and the time is 20-40 minutes; the temperature of the second reaction is 10-40°C and the time is 1-3 hours.

9. Use of the hemicyanine dye-based molecule of claim 1 or 2 or the nanoparticle of any one of claims 3-6 in the preparation of photosensitizers.

10. The use according to claim 9, characterized in that, The photosensitizer is a drug for the prevention and / or treatment of glioblastoma.

11. A combination drug, characterized in that, It contains nanoparticles as described in any one of claims 3-6 and a bispecific T-cell connector for simultaneous or separate administration in unit formulations of the same or different specifications, as well as a pharmaceutically acceptable carrier. The mass ratio of the nanoparticles to the bispecific T-cell connector is 4-6:0.05-0.

15.

12. The combination drug according to claim 11, characterized in that, The bispecific T-cell connector is a bispecific T-cell connector that targets Fn14; The mass ratio of the nanoparticles to the bispecific T-cell connector is 5:0.

1.

13. Use of the combination of the drug and the luminescent device as described in claim 11 or 12 in the preparation of an apparatus for treating glioblastoma.

14. The use according to claim 13, characterized in that, The wavelength of the light source in the light-emitting device is 950-1000nm, the irradiance is 0.3-0.7 W / cm², and the irradiation time is 5-15 minutes.

15. The use according to claim 14, characterized in that, The light source in the light-emitting device has a wavelength of 980 nm, an irradiance of 0.5 W / cm², and an irradiation time of 10 minutes.

Images