A cell line stably expressing TRPA1 ion channel and its construction method and its application in screening of neuropathic pain caused by biodegradable material outflow

Abstract

The present invention provides a cell line stably expressing TRPA1 ion channel and a construction method thereof and an application thereof in screening for neuropathic pain of outflowing substances from degradable materials, and relates to the field of biomedicine technology. The stably expressed cell line model is a cell stably overexpressing TRPA1 ion channel, which can be cryopreserved and revived for a long time and maintain a high expression state, which is conducive to screening for neuropathic pain substances outflowing substances from degradable materials and providing an objective relative value.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to a cell line stably transfecting TRPA1 ion channels, a construction method thereof, and an application thereof in screening for neuropathic pain caused by outflow of degradable materials. Background Art

[0002] TRPA1 (transient receptor potential A1), also known as ANKTM1, is a non-selective cation channel present in various tissues and organs (Story GM, A TRP-like channel expressed innociceptive neurons, is activated by cold temperatures. Cell. 2003). It is mainly expressed in sensory neurons, such as primary sensory neurons in the lungs, skin and brain, and peptidergic neurons, especially neurons in mammalian dorsal root ganglia (DRG), trigeminal ganglia (TG), nodose ganglia (NG) and jugular ganglia. In addition, TRPA1 is also present in some non-neuronal cells and tissues, including vascular endothelial cells and chondrocytes. The activation of TRPA1 is closely related to pain regulation and the regulation of inflammatory substances. TRPA1 is also associated with hypersensitivity and overexcitability in certain non-neuronal areas, and plays an important role in the pathophysiology of asthma, neuropathic pain, chronic itch, migraine, gastrointestinal dysmotility, anxiety and cognitive dysfunction.

[0003] Ordinary plastics cause huge environmental pollution problems after environmental leakage. The degradability of degradable plastics in the natural environment can minimize the impact of such environmental pollution. However, it is inevitable that plasticizers, chain extenders, etc. are used in the production process of degradable materials. It is currently unknown whether the migration of related substances will cause neuropathic pain. Existing pain screening is mainly based on animal methods, and there are few methods to screen for neuropathic pain for various migratable components in degradable materials.

[0004] US Patent US20150052624A1 constructs a rat pain model by editing pain-related genes in rats. However, the modeling process is time-consuming and the individual differences between models are large, which cannot well meet the purpose of screening various removable components in degradable materials for neuropathic pain. Therefore, there is an urgent need for an in vitro alternative test solution that can quickly and accurately screen for neuropathic pain. Summary of the invention

[0005] In order to solve the above problems, the present invention provides a cell line stably transfecting TRPA1 ion channel and a construction method thereof, and an application of the cell line in screening for neuropathic pain caused by the migration of degradable materials.

[0006] On the one hand, the present invention provides a stable cell line model based on TRPA1 ion channel for screening neuropathic pain caused by the migration of degradable materials.

[0007] Specifically, the coding gene of the TRPA1 ion channel is integrated into the host cell chromosome through lentiviral transfection to achieve stable overexpression.

[0008] Preferably, the TRPA1 is a human sequence with a relative molecular mass of about 127KDa.

[0009] Further preferably, the NCBI number of the TRPA1 sequence is: NP_015628.2.

[0010] In certain specific embodiments of the present invention, the NCBI number of the coding sequence of TRPA1 is: NM_007332.3.

[0011] Specifically, the lentiviral expression vector includes but is not limited to: pLVX, pLenti Cas9 or pCSLenti.

[0012] In certain specific embodiments of the present invention, the above-mentioned lentiviral expression vector is purchased from Heyuan Biotechnology.

[0013] In certain specific embodiments of the present invention, the lentiviral expression vector is pCSLenti.

[0014] Specifically, the target cells include but are not limited to: HEK293, SH-SY5Y or HaCaT.

[0015] Preferably, the target cell is HEK293.

[0016] On the other hand, the present invention provides a method for preparing the above-mentioned stable cell line model.

[0017] Specifically, the method for constructing the stable cell line model comprises the following steps:

[0018] (1) Cell culture;

[0019] (2) Plasmid vector construction;

[0020] (3) Virus encapsulation and collection;

[0021] (4) Testing of lentiviral titer;

[0022] (5) Screening of stable transgenic strains;

[0023] (6) Functional verification of stable transfected cells.

[0024] Specifically, in step (2), the plasmid vector includes a TRPA1 coding sequence.

[0025] Preferably, the TRPA1 coding sequence is a human sequence with the NCBI number: NM_007332.3.

[0026] Specifically, the plasmid vector carries both an EGFP tag and a Flag tag.

[0027] Specifically, in step (4), the lentivirus titer test method includes: fluorescence counting method, qPCR, RT-PCR, flow cytometry or enzyme-linked immunosorbent assay kit.

[0028] Preferably, the lentivirus titer test method is: RT-PCR.

[0029] Specifically, in step (5), the stable transfectant screening is drug screening, and the drug includes: puromycin.

[0030] Specifically, in step (6), the functional verification of the stable transfected strain includes the following steps:

[0031] 1) Extract membrane proteins and detect expression levels;

[0032] 2) Perform phenyltin trichloride and / or tributyltin chloride cytotoxicity screening.

[0033] More specifically, in step 1), the method for detecting the expression level includes: immunoblotting test, enzyme-linked immunosorbent assay, flow cytometry or immunohistochemistry.

[0034] In a specific embodiment of the model of the present invention, in step 1), the method for detecting the expression level is an immunoblotting test.

[0035] In another aspect, the present invention provides the use of the above-mentioned stable cell line model in the screening of neuropathic pain caused by the migration of degradable materials.

[0036] Compared with the prior art, the present invention has the following advantages:

[0037] This method is the first to construct a stable cell line model based on the TRPA1 ion channel for screening of neuropathic pain caused by the migration of degradable materials. It can not only screen for neuropathic pain through in vitro tests, but also further evaluate the biosafety of green and environmentally friendly degradable materials. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figure 1This is the map of pcSLenti-EF1-EGFP-P2A-Puro-CMV-TRPA1-3xFLAG-WPRE constructed in Example 1.

[0039] Figure 2 Screening of fluorescent images for stably transfected cell lines.

[0040] Figure 3 This is the WB test result of membrane protein. DETAILED DESCRIPTION

[0041] The present invention will be further described in detail below in conjunction with specific examples. The following examples are not intended to limit the present invention, but are only intended to illustrate the present invention. The experimental methods used in the following examples are generally conventional, unless otherwise specified, and the materials, reagents, etc. used in the following examples are commercially available, unless otherwise specified.

[0042] The DMEM medium, fetal bovine serum, and carbon-adsorbed fetal bovine serum used in this experiment were purchased from Gibco (Thermo Fisher Scientific Inc.). The trypsin and phenol red-free trypsin used for cell digestion were purchased from Gibco (Thermo Fisher Scientific Inc.).

[0043] Reagents: JT010 (Meijaden, catalog number HY-111132), TRPA1-IN-2 (Meijaden, catalog number HY-153711), puromycin hydrochloride (Sangon Biotech, catalog number 58-58-2), Rhod-2 (Yisheng Biotechnology Co., Ltd., catalog number 40776ES50), label antibody purchased from Abcam, membrane protein extraction kit purchased from Beyotime, jetPRIME® purchased from Bopurun, tributyltin chloride purchased from Sigma-Aldrich, phthalate purchased from Sigma-Aldrich.

[0044] The complete culture medium used in this experiment was DMEM complete culture medium containing 10% fetal bovine serum (v / v), 2 mM L-glutamine, and double antibodies (100 U / mL penicillin and 100 μg / mL streptomycin).

[0045] Example 1

[0046] 1. Lentivirus Construction

[0047] The TRPA1 gene sequence (NCBI reference sequence database: NM_007332.3) was cloned by PCR using human cDNA template, and a fragment with an XbaI restriction site at the front and an EcoRI restriction site at the back was obtained. The fragment was then ligated to the plasmid pcSLenti-EF1-EGFP-P2A-Puro-CMV-MCS-3xFLAG-WPRE (Heyuan Bio) by double restriction digestion technology and ligated overnight using T4 ligase to form pcSLenti-EF1-EGFP-P2A-Puro-CMV-TRPA1-3xFLAG-WPRE (see the map). Figure 1 .

[0048] 2. Virus encapsulation and collection

[0049] One day before transfection, seed HEK293 cells into a 100 mm dish and control the density of HEK293 cells during transfection to be 70-80%. One hour before transfection, remove the cell culture dish, remove the original cell culture medium, add 10 mL of Opti-MEM medium, and put the cells back into the incubator.

[0050] Prepare transfection complex: Dissolve 16μg of pcSLenti-EF1-EGFP-P2A-Puro-CMV-TRPA1-3xFLAG-WPRE and pCMV-VSVG (Heyuan Biotechnology) in Opti-MEM medium with a total volume of 500μL, mix gently, and let stand for 5 minutes; dissolve the transfection reagent in Opti-MEM medium with a total volume of 500μL, mix gently, and let stand for 5 minutes; add the transfection reagent dilution dropwise to the plasmid dilution, mix gently while adding, and let stand at room temperature for 20 minutes to allow DNA and transfection reagent to fully combine to form a stable transfection complex. Take out the cell culture plate, add the prepared DNA transfection reagent complex (32μg dissolved in 500μL) to the cell culture plate, and return it to the 37°C, 5% CO2 incubator. After 6 hours, aspirate the culture medium, wash once with PBS, and add 10mL of fresh complete culture medium for culture.

[0051] 48 hours after transfection, the virus was collected for the first time, the culture medium was collected into a 50mL centrifuge tube, and the cells were replaced with fresh complete culture medium. 72 hours after transfection, the virus was collected for the second time, the culture medium was collected into a 50mL centrifuge tube, and the cells were discarded. Centrifuge at 3500rpm in an ordinary centrifuge for 10 minutes. After centrifugation, the supernatant was poured into a new 50mL centrifuge tube, and the supernatant was filtered into an ultracentrifuge tube using a 0.45μm filter membrane. The supernatant was divided into 12 ultracentrifuge tubes, and centrifuged at 30,000rpm at 4°C for 2 hours. After centrifugation, white virus precipitates can be observed on one side of the tube wall. In the safety cabinet, open the centrifuge tube, discard the supernatant, turn the centrifuge tube upside down on sterilized absorbent paper, and discard the supernatant that has not been removed cleanly.

[0052] Add 80μL-120μL of Dulbecco's phosphate buffer to each tube according to the amount of precipitation, seal the tube with sealing film, and dissolve the precipitation at 4℃ overnight. Collect the virus to the last tube by tube collection method, and then collect it twice with 100μL of Dulbecco's phosphate buffer, collect all into 1.5mL EP tubes, package the virus as required, and store in a -80℃ refrigerator.

[0053] HEK293 cells were digested and 1×10 5 Cells were inoculated into each well of a 24-well plate. Viruses were added after the cells adhered to the wall. The medium was changed after 12-20 hours, and the medium containing the virus was removed. Fluorescence was recorded 72 hours after infection, and the cells were then collected to extract genomic DNA and perform quantitative PCR experiments to determine the titer.

[0054] 3. Testing of lentiviral titer:

[0055] RT-PCR was performed using an ABI7500 instrument, and the SYBR Premix Ex Taq used in the experiment was purchased from TAKARA.

[0056] Primer sequences:

[0057] SEQ ID NO.1: CMV-F: CGCAAATGGGCGGTAGGCGTG;

[0058] SEQ ID NO. 2: WPRE-R: CATAGCGTAAAAGGAGCAACA.

[0059] 1) Configure the reaction system according to Table 1:

[0060] Table 1

[0061]

[0062] 2) Set the program to two-step Real-Time quantification:

[0063] Pre-denaturation at 95°C for 15 seconds, followed by denaturation at 95°C for 5 seconds, annealing and extension at 60°C for 34 seconds, for a total of 40 cycles. The absorbance was read at each extension stage.

[0064] 3) Make a melting curve:

[0065] After PCR, denature at 95℃ for 1 minute. Then cool to 55℃ to allow DNA double strands to fully combine. From 55℃ to 95℃, increase by 0.5℃ each step, maintain for 30s, and read the absorbance value at the same time.

[0066] The average titer of the final test in Example 1 was 3.22×10 7 TU / mL.

[0067] Example 2 Screening of HEK293 cells stably expressing TRPA1

[0068] HEK293 cells were seeded into 6-well plates at a confluence of 30%, and HEK293 cells were diluted to 1×10 5 Cell suspension of 100 cells / mL is ready for plating.

[0069] Each 6-well plate was plated with 2 mL, i.e. 2 × 10 5 / plate, 12-20 hours later, virus infection: add jetPRIME® transfection reagent, 4 μL transfection reagent per well.

[0070] Change the medium 12-20 hours after infection: discard the medium and add 2 mL of fresh medium to each well. After 72 hours, add puromycin at a final concentration of 2 μg / mL. Change the medium with fresh medium containing puromycin at a final concentration of 2 μg / mL every 2 days.

[0071] After 2 μg / mL puromycin drug screening, take fluorescent photos (e.g. Figure 2 As shown), cells were collected by centrifugation, membrane proteins were extracted using the Bio-Tech membrane protein extraction kit, and the membrane protein expression level was verified using antibodies (label antibody, primary antibody dilution concentration was 1:1000, overnight incubation) Figure 3 as shown).

[0072] Experimental Example 1 Functional verification of HEK293 cells stably expressing TRPA1

[0073] Perform phenyltin trichloride cytotoxicity screening, the specific steps are as follows:

[0074] HEK293 cells stably expressing TRPA1 were cultured in a 96-well plate with complete medium containing 2 µg / mL puromycin. 4 HEK293 cells stably expressing TRPA1 were prepared, and the culture medium volume in each well was the same, 100 μL. The wells were divided into a zeroing group, a negative group, and an experimental group. Different concentrations of phenyltin trichloride (contaminants to be screened) were added to the wells of the experimental group; no contaminants to be screened were added to the negative group; and there were no cells in the zeroing group. After 24 hours of treatment, the culture medium was discarded, the cells were washed three times with PBS, 10 μL of CCK-8 reagent was added, and the absorbance was tested at 450 nm after incubation at room temperature (37°C) for 1.5 hours, and the cytotoxicity IC50 value was calculated. The results are shown in Table 2.

[0075] Table 2

[0076]

[0077] The above results indicate that the HEK293 cells stably expressing TRPA1 constructed in Example 2 are more sensitive than untransfected cells in the cytotoxicity screening of degradable material outflows that cause neuropathic pain, and are more sensitive to low-dose exposure.

[0078] Experimental Example 2: Cell line model for neuropathic pain screening of biodegradable material outflow

[0079] HEK293 cells stably expressing TRPA1 were cultured in a 96-well plate with complete medium containing 2 µg / mL puromycin. 4 HEK293 cells stably expressing TRPA1 were added, and the culture medium volume of each well was 100μL. Each well was divided into a zero adjustment group, a negative group, an activator group, an inhibitor group, and a test group. Only the culture medium was added to the negative group; there were no cells in the zero adjustment group. JT010 was added to the activator group, TRPA1-IN-2 was added to the inhibitor group, and phenyltin trichloride and tributyltin chloride were added to the test groups. After 30 minutes of treatment, the culture medium was discarded, HBSS (without calcium and magnesium ions) was washed three times, 100μL Rhod-2 reagent was added, and the fluorescence intensity was detected after incubation at room temperature (37°C) for 30 minutes. The excitation light was 549nm and the emission light was 578nm. The results are shown in Table 3.

[0080] Table 3

[0081]

[0082] When the inhibitor is used, the fluorescence intensity decreases; when the agonist is used, the fluorescence intensity increases, indicating that the TRAP1 ion channel in the HEK293 cells stably expressing TRPA1 constructed in the present application can function normally.

[0083] When the cells were treated with the degradable outflow phenyltin trichloride or phenyltin trichloride, the fluorescence intensity was significantly higher than that of the group using the agonist, indicating that the HEK293 cells stably expressing TRPA1 constructed by the present invention can be used for neuropathic pain screening of degradable material outflows and have good sensitivity.

[0084] Finally, it should be noted that the above content is only used to illustrate the technical solution of the present invention, rather than to limit the scope of protection of the present invention. Simple modifications or equivalent substitutions of the technical solution of the present invention by ordinary technicians in this field do not deviate from the essence and scope of the technical solution of the present invention.

Claims

1. Application of a stable cell line model based on TRPA1 ion channel for screening of neuropathic pain caused by the migration of degradable materials in screening of neuropathic pain caused by the migration of degradable materials, characterized in that: The coding gene of the TRPA1 ion channel is integrated into the host cell chromosome through lentiviral transfection to achieve stable overexpression. The TRPA1 coding sequence is a human sequence with an NCBI number of NM_007332.

3. The expression vector of the lentivirus is pCSLenti. The host cell is HEK293. The degradable material outgrowth is phenyltin trichloride and / or tributyltin chloride.

2. The use according to claim 1, characterized in that: The method for constructing the stable cell line model comprises the following steps: (1) Cell culture; (2) Construction of a plasmid vector, wherein the plasmid vector includes a TRPA1 coding sequence, wherein the TRPA1 coding sequence is a human sequence, and the NCBI number is: NM_007332.3; (3) Virus encapsulation and collection; (4) Testing of lentiviral titer; (5) Screening of stable transgenic strains; (6) Functional verification of stable transfected cells.

3. The use according to claim 2, characterized in that: In step (2), the plasmid vector carries both an EGFP tag and a Flag tag.

4. The use according to claim 2, characterized in that: In step (4), the lentivirus titer testing method includes: fluorescence counting method, qPCR, RT-PCR, flow cytometry or enzyme-linked immunosorbent assay kit.

5. The use according to claim 2, characterized in that: In step (5), the stable strain screening is drug screening, and the drug includes: puromycin.

6. The use according to claim 2, characterized in that: In step (6), the functional verification of the stable transfected strain includes the following steps: 1) Extract membrane proteins and detect expression levels; 2) Perform phenyltin trichloride and / or tributyltin chloride cytotoxicity screening.

7. The use according to claim 6, characterized in that: In step 1), the methods for detecting the expression level include: immunoblotting, enzyme-linked immunosorbent assay, flow cytometry or immunohistochemistry.

Images