A colorectal cancer molecular marker and a detection method and application thereof

Abstract

The application belongs to the technical field of cell molecules, and particularly relates to a colorectal cancer molecular marker as well as a detection method and application thereof. The application provides a colorectal cancer molecular marker circETFA(2,3,4), a nucleotide sequence of which is shown as SEQ ID NO:1, which can be used for detection and prognosis of colorectal cancer. Primers for detecting the expression amount of circETFA(2,3,4) are shown as SEQ ID NO:2 and 3, and have high specificity, high sensitivity and stable results. The application further provides an shRNA sequence of circETFA(2,3,4), positive and negative sense chain sequences of which are shown as SEQ ID NO:4 and 5, which can be used for knocking down the expression of circETFA(2,3,4) in colorectal cancer cells, can inhibit the malignant proliferation of colorectal cancer cells, and is used for preparation of colorectal cancer drugs.

Description

Technical Field

[0001] This invention belongs to the field of cell and molecular biotechnology, specifically relating to a molecular marker for colorectal cancer, its detection method, and its application. Background Technology

[0002] Colorectal cancer, one of the most common malignant tumors in the world, has a high incidence and mortality rate, posing a serious threat to people's health. Currently, the main treatments for colorectal cancer are surgery, radiotherapy, and chemotherapy. Although significant progress has been made in colorectal cancer research in recent decades, its incidence continues to show a clear upward trend. Recurrence accompanied by malignant proliferation remains one of the main factors leading to poor prognosis, greatly impacting patients' survival rate and quality of life.

[0003] In recent years, with the continuous development of biological technology, more and more researchers have begun to explore the relationship between various small biological molecules and tumors. circRNA, as a non-coding RNA, is widely present in the nucleus, cytoplasm, and exosomes of various eukaryotic cells. Its expression is stable and it is not easily degraded, enabling it to participate in the development of various diseases. Therefore, screening differentially expressed circRNAs as biomarkers for diseases can better understand the mechanisms of disease development and provide strong evidence for improving disease diagnosis and prognosis. Short hairpin RNA (shRNA) is a hairpin structure composed of two short inverted repeat sequences and an intermediate stem-loop sequence. It can specifically degrade target genes through the mediation of exogenous or endogenous double-stranded RNA, leading to gene silencing. shRNA is a highly specific and efficient gene blocking technology, and with the continuous development of technology, it has gradually become a powerful tool in cell biology. However, if the design is not reasonable, off-target effects can easily occur.

[0004] Primer design is crucial for detecting and verifying the presence and expression level of circRNA. Inappropriate primer design and low specificity can directly lead to inaccurate detection results. Summary of the Invention

[0005] In view of the current state of the above-mentioned technologies, one of the technical problems to be solved by the present invention is to provide a molecular marker for colorectal cancer, which can be used to diagnose colorectal cancer simply, quickly and efficiently.

[0006] Another technical problem to be solved by the present invention is to provide a rapid, accurate and efficient method for detecting the expression level of circETFA(2,3,4), a molecular marker of colorectal cancer.

[0007] Another technical problem to be solved by the present invention is to provide a shRNA sequence of circETFA(2,3,4), which can be used to simply and efficiently reduce the expression level of circETFA(2,3,4) in colorectal cancer cells. The CCK-8 assay has shown that the shRNA of circETFA(2,3,4) in colorectal cancer cells can inhibit their malignant proliferation.

[0008] To achieve the above objectives, the present invention adopts the following technical solution:

[0009] This invention provides a molecular marker for colorectal cancer, circETFA(2,3,4), the sequence of which is shown in SEQ ID NO: 1.

[0010] An application of the aforementioned colorectal cancer molecular marker is used in the preparation of products for colorectal cancer detection and prognosis.

[0011] Furthermore, the product is a colorectal cancer detection chip or a colorectal cancer auxiliary diagnostic kit.

[0012] The present invention also provides a method for detecting the expression level of the colorectal cancer molecular marker, comprising the following steps:

[0013] (1) Collect colorectal cancer samples;

[0014] (2) RNA was extracted and reverse transcribed;

[0015] (3) Real-time quantitative PCR detection;

[0016] (4) The expression levels of colorectal cancer molecular markers were calculated using the 2-ΔΔCT method.

[0017] Furthermore, in step (3), the upstream and downstream primers used for real-time quantitative PCR detection are shown in SEQ ID NO: 2 and SEQ ID NO: 3, respectively.

[0018] The present invention also provides an shRNA of the colorectal cancer molecular marker, the sense strand and antisense strand of which are shown in SEQ ID NO:4 and SEQ ID NO:5, respectively.

[0019] One application of the shRNA is for the preparation of a product that knocks down circETFA(2,3,4) expression in colorectal cancer cells.

[0020] Furthermore, the shRNA can inhibit the malignant proliferation of colorectal cancer cells and can be used in the preparation of drugs for treating colorectal cancer.

[0021] The present invention also provides a drug for treating colorectal cancer, comprising the shRNA.

[0022] Compared with the prior art, the present invention has the following effects:

[0023] 1. The primers provided by this invention for detecting the expression level of circETFA(2,3,4) have high specificity, strong repeatability, and stable results, providing a foundation for biological research on hsa_circ_0003620.

[0024] 2. The circETFA(2,3,4) provided by this invention can be used as a biomarker for colorectal cancer detection, providing a basis for the detection and prognosis of colorectal cancer.

[0025] 3. The method for detecting the molecular expression level of circETFA(2,3,4) in this invention uses real-time quantitative PCR detection, which can simultaneously detect the target circRNA and the internal reference gene without the need for additional probes. This method is simple and efficient.

[0026] 4. The circETFA(2,3,4) shRNA provided by this invention has the characteristics of high specificity, rapid action, and high efficiency.

[0027] 5. The shRNA of circETFA(2,3,4) provided by this invention can specifically inhibit the malignant proliferation of colorectal cancer cells, and has broad application prospects in the preparation of drugs for colorectal cancer and the prognosis of colorectal cancer. Attached Figure Description

[0028] Figure 1 The melting curve of the real-time quantitative PCR in the example demonstrates the specificity of the primers.

[0029] Figure 2 The relative expression levels of circETFA(2,3,4) detected in normal and cancerous colorectal tissues in the examples are shown.

[0030] Figure 3 The images show partial sequencing results of the amplified products in the examples.

[0031] Figure 4 The expression levels of circETFA(2,3,4) were detected by real-time quantitative PCR in the examples.

[0032] Figure 5 In this example, the CCK-8 assay was used to detect the proliferative activity of colorectal cancer cells. Detailed Implementation

[0033] Example 1

[0034] A molecular marker for colorectal cancer, circETFA(2,3,4), has the nucleotide sequence shown in SEQ ID NO: 1.

[0035] The colorectal cancer molecular marker circETFA(2,3,4) can be used for the detection and prognosis of colorectal cancer.

[0036] Furthermore, it can be applied to the preparation of chips for colorectal cancer detection or colorectal cancer auxiliary diagnostic kits.

[0037] A method for detecting the expression level of circETFA(2,3,4), a molecular marker for colorectal cancer, is disclosed. Real-time quantitative PCR primers for circETFA(2,3,4) are designed, and the expression level of circETFA(2,3,4) is obtained using real-time quantitative PCR. The specific steps include:

[0038] (1) Collection of colorectal cancer samples:

[0039] The 30 pairs of colorectal cancer and normal colorectal tissues used in this embodiment were obtained from Shanghai Xinchao Biotechnology Co., Ltd. The samples were stored in liquid nitrogen for future use. All research subjects gave informed consent to participate in this experiment, and the process was reviewed and approved by the hospital's ethics committee.

[0040] (2) RNA extraction and reverse transcription:

[0041] (a) Add grinding beads and an appropriate amount of trizol solution to the collected tissue sample and grind thoroughly at low temperature using a grinder;

[0042] (b) Add 100 μL of chloroform to every 500 μL of trizol solution, shake vigorously for 30 seconds, and let stand at room temperature for 5 minutes.

[0043] (c) Centrifuge at 12,000 rpm for 15 minutes at 4°C, and transfer the upper aqueous phase to a new centrifuge tube;

[0044] (d) Add an equal volume of isopropanol, mix gently, and precipitate at -20°C for 20 minutes;

[0045] (e) Centrifuge at 12000 rpm for 15 minutes at 4℃, and discard the supernatant;

[0046] (f) Add 700 μl of 75% ethanol, centrifuge at 7500 rpm for 5 minutes, discard the supernatant, and air dry in a clean bench.

[0047] (g) Add an appropriate amount of enzyme-free water to dissolve the RNA, and use a nucleic acid micro-detector to determine the RNA concentration and purity;

[0048] (h) Reverse transcription to obtain cDNA, the specific steps are as follows:

[0049] Add the following reagents to the enzyme-free PCR centrifuge tube:

[0050] 5x Evo M-MLV RT MasterMix: 4 μl, RNA: 1 μg, add RNase-free ddH2O to 20 μl;

[0051] Reverse transcribe according to the following reaction procedure:

[0052] Set the following parameters on the PCR instrument: Step 1: 37℃ for 15 min; Step 2: 85℃ for 5 s; Step 3: 4℃ for 1 min.

[0053] Dilute the cDNA at a ratio of 1:5 and then store it in a freezer at -20 degrees Celsius.

[0054] (3) Real-time quantitative PCR detection:

[0055] Follow the real-time quantitative PCR procedure below:

[0056]

[0057] Add the following reagents to the enzyme-free PCR centrifuge tube:

[0058] SYBR Green MasterMix: 10 μL, upstream primer: 1 μL, downstream primer: 1 μL, cDNA: 2 μL, add ddH2O to 20 μL. The upstream primer is AAGGCCTACTTCCAGAGGAAC (SEQ ID NO: 2); the downstream primer is TGGGTGCTAGGGAATCATTTG (SEQ ID NO: 3).

[0059] (4) The expression levels of colorectal cancer molecular markers were calculated using the 2-ΔΔCT method;

[0060] (5) Results Analysis:

[0061] First, melting curve analysis showed that the circETFA(2,3,4) primers had good specificity.

[0062] The primers exhibited specificity as determined by melting curve analysis. The results showed a single peak in the melting curve, indicating that the primers of this invention possess good specificity and demonstrate good stability and reliability in detecting the expression levels of circETFA(2,3,4). Figure 1 (As shown).

[0063] Secondly, the expression levels of circETFA(2,3,4) were calculated using the 2-ΔΔCT method. The results showed that the expression levels of circETFA(2,3,4) were higher in most colorectal cancer tissues than in normal colorectal tissues (e.g., Figure 2 (As shown).

[0064] Finally, the amplified products were sequenced, and the sequencing results clearly showed the circularization site AGGC, further confirming the presence of circETFA(2,3,4) (e.g. Figure 3 (As shown).

[0065] In conclusion, the colorectal cancer molecular marker circETFA(2,3,4) can be applied in the detection and prognosis of colorectal cancer.

[0066] Example 2

[0067] In this embodiment, the shRNA of circETFA(2,3,4) was synthesized using the sequence characteristics of the colorectal cancer molecular marker circETFA(2,3,4).

[0068] (1) Synthesize circETFA(2,3,4) shRNA:

[0069] Based on the design principles of shRNA, sequences containing circularization sites of circular RNA, with a fragment length of 18–25 bp and a GC content of approximately 40%–50%, were selected as candidate target sequences for shRNA. These sequences were then compared with human genome sequences in a database to ensure no overlap with other genes. The shRNA sequence designed in this invention is as follows:

[0070] Chain of Justice (SEQ ID NO: 4):

[0071] 5'-CCGGTTCGGAAAGGCCTCATTGCTAGGATCCTAGCAATGAGGCCT TTCCGAATTTTTG-3'

[0072] Antisense chain (SEQ ID NO: 5):

[0073] 5'-AATTCAAAAATTCGGAAAGGCCTCATTGCTAGGATCCTAGCAATGA GGCCTTTCCGAA-3

[0074] The above shRNA sequence was sent to Nanjing Qingke Company for chemical synthesis, and then constructed into the pLKO.1 vector plasmid through annealing and ligation.

[0075] (2) Transfection of colorectal cancer cells with shRNA:

[0076] Colorectal cancer cells HCT116 were seeded in 6-well cell culture plates. When the cell confluence density was about 60%, transfection was performed. shRNA and negative control (NC) plasmid were transfected into the colorectal cancer cells using lipo2000 transfection reagent. The culture medium was changed after 6-8 hours.

[0077] (3) Detection of circETFA(2,3,4) expression levels in colorectal cancer cells:

[0078] The method used differs from the method in Example 1 for detecting the expression level of the colorectal cancer molecular marker circETFA(2,3,4), only in that:

[0079] In this embodiment, transfected colorectal cancer cells are collected, and cells are lysed rather than tissues are lysed to extract total RNA from the cells.

[0080] The expression levels of circETFA(2,3,4) were calculated using the 2-ΔΔCT method, and the results are as follows: Figure 4 As shown, the knockdown efficiency of circETFA(2,3,4) shRNA in colorectal cancer cells reaches 80%. Therefore, the shRNA sequence provided by this invention can effectively inhibit the expression of circETFA(2,3,4) in colorectal cancer cells.

[0081] (4) CCK-8 experiment:

[0082] CCK-8 assays demonstrated that shRNA from circETFA(2,3,4) in colorectal cancer cells can inhibit their malignant proliferation, and this can be used in the preparation of drugs for colorectal cancer. The specific process is as follows:

[0083] (a) Colorectal cancer cells transfected with shRNA and negative control (NC) plasmids were digested with trypsin, centrifuged at 1000 rpm for 3 minutes, mixed with DMEM complete medium by pipetting, and made into single-cell suspensions. Cell counts were performed, and 1000 cells / 100 μl of cell suspension was prepared. 100 μl of cell suspension was seeded into 96-well cell culture plates, with 3 replicates per group. Cell viability was detected at 0 h, 24 h, 48 h, 72 h, and 96 h.

[0084] (b) Add 10 μl of CCK-8 reagent to each well, incubate at 37°C for 1.5 hours, and then read the absorbance at 450 nm using a microplate reader.

[0085] (c) Calculation:

[0086] (1) Cell viability (%) = (Absorbance value of treated group - Blank value) / (Absorbance value of untreated group - Blank value) × 100%

[0087] (2) Growth curve = (absorbance value at specified time point - blank value) / (absorbance value immediately after cell inoculation - blank value), based on which the cell growth curve at different time points is plotted. The CCK-8 experiment showed that after transfection with the shRNA plasmid, the number of colorectal cancer cells in the shRNA group was 0.49 times that of the control group at 48 hours. Figure 5 As shown. Therefore, the circETFA(2,3,4) shRNA provided by this invention can inhibit cell proliferation in colorectal cancer cells, providing theoretical guidance for its application in colorectal cancer.

[0088] In conclusion, the shRNA of circETFA(2,3,4) can be used for the preparation of drugs for colorectal cancer.

[0089] sequence list

[0090] SEQ ID NO: 1

[0091] GCCTCATTGCTACGATTTCAGAGTACCCTGGTAATAGCTGAGCATGCAAATGATTCCCTAGCACCCATTACTTTAAATACCATTACTGCAGCCACACGCCTTGGAGGTGAAGTGTCCTGCTTAGTAGCTGGAACCAAATGTGACAAGGTGGCACAA GATCTCTGTAAAGTAGCAGGCATAGCAAAAGTTCTGGTGGCTCAGCATGATGTGTACAAAGGCCTACTTCCAGAGGAACTGACACCATTGATTTTGGCAACTCAGAAGCAGTTCAATTACACACACATCTGTGCTGGAGCATCTGCCTTCGGAAAG

[0092] SEQ ID NO: 2

[0093] AAGGCCTACTTCCAGAGGAAC

[0094] SEQ ID NO: 3

[0095] TGGGTGCTAGGGAATCATTTG

[0096] SEQ ID NO: 4

[0097] CCGGTTCGGAAAGGCCTCATTGCTAGGATCCTAGCAATGAGGCCTTTCCGAATTTTTG

[0098] SEQ ID NO:5

[0099] AATTCAAAAATTCGGAAAGGCCTCATTGCTAGGATCCTAGCAATGAGGCCTTTCCGAA。

Claims

1. The application of a product for detecting molecular markers of colorectal cancer in the preparation of products for colorectal cancer detection and prognosis assessment, characterized in that: The colorectal cancer molecular marker is circETFA(2,3,4), the sequence of which is shown in SEQ ID NO:

1.

2. The application according to claim 1, characterized in that, The product is a colorectal cancer detection chip or a colorectal cancer auxiliary diagnostic kit.

3. An shRNA for colorectal cancer molecular markers, characterized in that: The sense and antisense strands of the shRNA are shown in SEQ ID NO: 4 and SEQ ID NO: 5, respectively. The colorectal cancer molecular marker is circETFA(2,3,4), the sequence of which is shown in SEQ ID NO:

1.

4. The use of the shRNA according to claim 3 in the preparation of a drug for treating colorectal cancer, characterized in that: The shRNA was able to knock down the expression of circETFA(2,3,4) in colorectal cancer cells.

5. The application according to claim 4, characterized in that: The shRNA can inhibit the malignant proliferation of colorectal cancer cells and can be used in the preparation of drugs for the treatment of colorectal cancer.

6. A drug for treating colorectal cancer, characterized in that: It contains the shRNA as described in claim 3.

Images