SNP molecular markers related to flowering time of upland cotton and their application

Abstract

The present invention discloses a SNP molecular marker related to the flowering period of upland cotton and its application, belonging to the field of cotton molecular breeding. The present invention obtains the SNP molecular marker located in the reference genome version of upland cotton by using the whole genome association analysis method. Gossypium hirsutum The D06:26425614 position of the D06 chromosome nucleotide sequence of (AD1)'TM‑1'genome CRI_v1 is located at position 101 of the nucleotide sequence shown in SEQ ID No.1. The base of this SNP molecular marker has a G / A polymorphism, which leads to a change in the flowering time of upland cotton. The SNP molecular marker significantly associated with the flowering period of upland cotton discovered in the present invention can be used in molecular assisted breeding of early-maturing traits of upland cotton, which is of great significance for improving the flowering period of upland cotton through molecular breeding and improving the comprehensive economic benefits of cotton.

Description

Technical Field

[0001] The invention belongs to the field of cotton molecular breeding, and in particular relates to SNP molecular markers related to flowering time of upland cotton and applications thereof. Background Art

[0002] Cotton is one of the most important fiber crops in the world, providing the main fiber raw material for the global textile industry. In Xinjiang, the main cotton producing area, the temperature difference between spring and summer and spring and autumn is large, the temperature rises slowly in spring, drops quickly in autumn, and the dry frost period is also early, which will lead to a decrease in cotton yield and quality. In order to solve these problems, breeding early-maturing cotton (short-season cotton) with a shorter growth period can shorten the cotton planting cycle and is one of the best solutions to these problems.

[0003] my country has experienced several important periods in the genetic improvement of cotton precocity. In the early 20th century, the introduction of early-maturing upland cotton varieties provided genetic resources for the genetic improvement of cotton precocity. Systematic breeding in the mid-20th century further shortened the growth period of upland cotton and improved the fiber quality of early-maturing cotton. By the 1970s, hybrid breeding focused on improving the yield, quality and resistance of early-maturing cotton. At the end of the 20th century, molecular-assisted breeding used molecular biological methods to study the genetic basis of early-maturing cotton. However, these breeding methods still face some problems, such as long cycles, large resource inputs, difficulty in obtaining breakthrough traits, and dependence on the experience of breeders. Flowering time (TOF) is a complex quantitative trait and an important indicator for measuring the length of the crop growth period. Therefore, the identification of the genetic loci of flowering time in upland cotton will help the breeding and utilization of excellent genes for flowering period and the screening and creation of excellent germplasm. This will help to quickly select early-maturing cotton and overcome the difficulties in cotton production in Xinjiang. Therefore, the development of effective molecular markers / candidate genes related to the flowering period of upland cotton is of great significance for improving the flowering period of upland cotton through molecular breeding and improving the comprehensive economic benefits of cotton.

[0004] When the inventors of the present invention were conducting genetic positioning of the flowering period of upland cotton, they noticed that the flowering time of wild upland cotton strains was higher than that of cultivated upland cotton, indicating that early-maturing genes of upland cotton had been selected during the breeding process of upland cotton. Combining wild upland cotton strains to find the selected early-maturing genes is fast and reliable. Summary of the invention

[0005] The technical problem to be solved by the present invention is to explore SNP molecular markers related to the flowering period of upland cotton.

[0006] The present invention utilized a natural population consisting of 391 wild upland cotton lines and 39 cultivated upland cotton lines, and used the genome-wide association study (GWAS) technology to discover SNP molecular markers associated with the flowering period of upland cotton, which can significantly shorten the flowering time of upland cotton.

[0007] Specifically, the SNP molecular marker related to the flowering period of upland cotton provided by the present invention is located at the 26425614th position of the D06 chromosome nucleotide sequence of the upland cotton reference genome version Gossypium hirsutum (AD1) 'TM-1' genome CRI_v1, which is located at the 101st position of the nucleotide sequence shown in SEQ ID No.1. The base of this SNP site has a G / A polymorphism, which leads to a change in the flowering period of upland cotton.

[0008] The present invention also provides any of the following applications of the above-mentioned SNP molecular marker:

[0009] (1) Identify and select early-maturing upland cotton varieties or lines;

[0010] (2) Molecular assisted breeding for early maturity of upland cotton;

[0011] (3) Improve upland cotton germplasm resources;

[0012] (4) Detect and predict the flowering time of upland cotton.

[0013] The present invention also provides an application of a substance for detecting the genotype of the SNP molecular marker in molecular assisted breeding of flowering period traits of upland cotton.

[0014] Furthermore, the present invention also provides a method for detecting flowering time of upland cotton using the SNP molecular marker, the method comprising the following steps:

[0015] (1) Extracting genomic DNA of the sample to be tested from leaves of upland cotton;

[0016] (2) Using genomic DNA as a template, PCR amplification is performed on the target sequence in the genomic DNA of the sample to be tested;

[0017] (3) The amplified samples were tested using a fluorescence detection platform, and the flowering time of upland cotton was determined based on the polymorphism of the SNP molecular markers reflected by the obtained fluorescence signals;

[0018] (4) When the SNP molecular marker genotype is AA, the flowering time of upland cotton is longer; when the SNP molecular marker genotype is AG, it has a shorter flowering time; and when the SNP molecular marker genotype is GG, it has a medium flowering time.

[0019] Compared with the prior art, the present invention has the following beneficial effects:

[0020] The SNP molecular markers mined by the present invention that are significantly associated with the flowering period of upland cotton can be used in molecular assisted breeding of flowering period traits of upland cotton, which is of great significance for improving the flowering period of upland cotton through molecular breeding and improving the comprehensive economic benefits of cotton. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 Identification map of molecular marker D06:26425614 located on chromosome D06 of upland cotton, which is related to flowering time. DETAILED DESCRIPTION

[0022] The experimental methods in the following examples are conventional methods unless otherwise specified. The experimental materials used in the following examples are purchased from commercial channels unless otherwise specified.

[0023] Example 1 Screening of SNP molecular markers related to flowering period of upland cotton

[0024] 1. Construction of natural groups

[0025] 391 wild lines of upland cotton and 39 cultivated varieties of upland cotton preserved in the Sanya wild cotton nursery of the Cotton Research Institute of the Chinese Academy of Agricultural Sciences.

[0026] 2. Flowering period survey

[0027] The natural populations were divided into 1 ), 2018-2019 (E 2 ) was planted at the Yacheng Experimental Base in Sanya, Hainan, 2017-2018 (E 3 ) was planted in Xishuangbanna, with a randomized block design, single-row plot, 5-meter row length, 1-meter row spacing, 25-cm plant spacing, three biological replicates, and conventional experimental field management. The flowering cotton plant was defined as the first bud of the first fruit branch of each plant. The flowering period was defined as the date when the number of flowering cotton plants in each row accounted for more than 50% of the number of plants in each row to the sowing date. The flowering period of all samples in the natural population was counted.

[0028] 3. Whole genome resequencing for SNP typing

[0029] Extract DNA from young cotton leaves from natural populations and send it to the company for whole genome resequencing to obtain raw data (Zhang et al. 2019. Genotyping-by-sequencing of Gossypium hirsutumFirst, we used fastq software to filter and obtain high-quality clean data, and then used BWA software to align the clean data to the upland cotton reference genome. Gossypium hirsutum (AD1) 'TM-1' genome CRI_v1 (https: / / www.cottongen.org / species / Gossypium_hirsutum / CRI-TM1)(Yang, et al., Extensive intraspecific gene order and gene structural variations inupland cotton cultivars. 2019, Nature Communications, 10: 2989). GATK software was used to detect SNPs in each sample, and after filtering, 1745069 high-quality SNPs were obtained (MAF>0.05, missing_rate<0.2).

[0030] 4. Genome-wide association analysis of flowering period traits in upland cotton

[0031] Using EMMAX software, genome-wide association analysis was performed on the blup values ​​of 432 upland cotton flowering period phenotypic data for three years and 1745069 high-quality SNPs (MAF>0.05, missing <0.2) genotyping data. 10 ( P )>7 were significant loci, and D06_26425614 was identified on chromosome D06 to be significantly associated with the blup value of flowering period of upland cotton (Table 1).

[0032] Table 1 SNP molecular markers significantly associated with flowering time of upland cotton

[0033]

[0034] The upstream and downstream sequences of SNP site D06_26425614 are as follows (SEQ ID No. 1):

[0035] TTTGACCAGGACAAGGTAATCGCAAAATGAACCATAGGGTTTAACAAGGGAAGAGGGACCTAAGGGCTACCTTGGACGGATAGTCCGGCGAGAAGTAGTGY AGGACATGGTTCGTAGGAATGATCTGCTAATTTAAAATGTCTAAAAGCATTCAAAGTTTAGACTAGAAAGAACGTTAAAGAGGAAAAAATCTTAAGGTTA

[0036] For specific results, see Figure 1 , Figure 1 This is the identification result of molecular marker D06:26425614 on chromosome D06 of upland cotton related to flowering period. Specifically, through genome-wide association analysis of 430 upland cotton samples, a genetic locus D06:26425614 significantly associated with the flowering period (Time to Flowering, TOF) of upland cotton was found on chromosome D06. This locus is also associated with the height of the node of the first fruiting branch. When this locus is A / A, the flowering period of upland cotton is the longest, when it is G / A, the flowering period is medium, and when it is G / G, the flowering period is short.

[0037] Example 2 Method for selecting SNP molecular markers during flowering period of upland cotton

[0038] Using the SNP molecular marker D06_26425614 obtained in Example 1 to perform molecular marker selection in a breeding population related to upland cotton, the following steps are included:

[0039] 1. Extract young leaf DNA from 430 upland cotton materials of the natural population of the present invention and perform genotyping;

[0040] 2. This natural group was in 2017-2018 (E 1 ) were planted at the Yacheng experimental base in Sanya, Hainan, and the flowering period was investigated.

[0041] 3. The phenotypic and genotypic data of flowering period of upland cotton in three environments of the 430 materials were analyzed (Table 2). The results showed that in each environment, the flowering rate of upland cotton with genotype AA was significantly higher than that of materials with genotype GG, confirming that D06_26425614 is a stable SNP molecular marker site significantly associated with the flowering period of upland cotton, which can assist in the screening of flowering period traits of upland cotton and has universality.

[0042] Table 2 E 1 Comparison results of flowering period of different genotypes in different environments

[0043]

[0044] Note: Lowercase letters indicate significant differences at the 0.05 level, and variance analysis was performed using t.test.

[0045] Example 3 Molecular marker selection method for flowering period of upland cotton

[0046] Using the SNP molecular marker D06_26425614 obtained in Example 1 to perform molecular marker selection in a breeding population related to upland cotton, the following steps are included:

[0047] 1. Extract young leaf DNA from 430 upland cotton materials of the natural population of the present invention and perform genotyping;

[0048] 2. This natural group was established in 2018-2019 (E 2 ) were planted at the Yacheng experimental base in Sanya, Hainan, and the flowering period was investigated.

[0049] 3. The phenotypic and genotypic data of flowering period of upland cotton in three environments of the 430 materials were analyzed (Table 3). The results showed that in each environment, the flowering rate of upland cotton with genotype AA was significantly higher than that of materials with genotype GG, confirming that D06_26425614 is a stable SNP molecular marker site significantly associated with the flowering period of upland cotton, which can assist in the screening of flowering period traits of upland cotton and has universality.

[0050] Table 3 E 2 Comparison results of flowering period of different genotypes in different environments

[0051]

[0052] Note: Lowercase letters indicate significant differences at the 0.05 level, and variance analysis was performed using t.test.

[0053] Example 4 Molecular marker selection method for flowering period of upland cotton

[0054] Using the SNP molecular marker D06_26425614 obtained in Example 1 to perform molecular marker selection in a breeding population related to upland cotton, the following steps are included:

[0055] 1. Extract young leaf DNA from 430 upland cotton materials of the natural population of the present invention and perform genotyping;

[0056] 2. This natural group was in 2017-2018 (E 3 ) were planted in Xishuangbanna, Yunnan Province, and the flowering period was investigated.

[0057] 3. The phenotypic and genotypic data of flowering period of upland cotton in three environments of the 430 materials were analyzed (Table 4). The results showed that in each environment, the flowering rate of upland cotton with genotype AA was significantly higher than that of materials with genotype GG, confirming that D06_26425614 is a stable SNP site significantly associated with the flowering period of upland cotton, which can assist in the screening of flowering period traits of upland cotton and has universality.

[0058] Table 4 E 3 Comparison results of flowering period of different genotypes in different environments

[0059]

[0060] Note: Lowercase letters indicate significant differences at the 0.05 level, and variance analysis was performed using t.test.

[0061] Of course, the above description is not a limitation of the present invention, and the present invention is not limited to the above examples. Any changes, modifications, additions or substitutions made by ordinary technicians in this technical field within the essential scope of the present invention should fall within the protection scope of the present invention.

Claims

1. Use of a reagent for detecting the genotype of a SNP molecular marker associated with flowering time of upland cotton in molecular assisted breeding of flowering period traits of upland cotton, characterized in that: The SNP molecular marker is located in the reference genome version of upland cotton Gossypium hirsutum The 26425614th position of the nucleotide sequence of chromosome D06 of AD1 'TM-1' genome CRI_v1 is located at position 101 of the nucleotide sequence shown in SEQID No.

1. The base of this SNP molecular marker has a G / A polymorphism, which leads to a change in the flowering time of upland cotton; When the SNP molecular marker genotype is AA, the flowering time of upland cotton is longer, when the SNP molecular marker genotype is AG, it has a shorter flowering time, and when the SNP molecular marker genotype is GG, it has a medium flowering time.

Images