PCR multiplexing techniques by target sequence independence reporter molecules with distinguishable signal strengths

Abstract

The present invention relates to a method for detecting at least two nucleic acid target sequences by at least two target sequence independence reporter molecules in the same detection channel, in which at least two mediator probes are used, the mediator probes comprising at least one probe sequence and one mediator sequence, and at least two target sequence independence reporter molecules of a first type and a second type, each reporter molecule comprising at least one marker having a respective maximum signal strength in the same detection channel, and wherein at least two nucleic acid target sequences are detected by a nucleic acid detection reaction due to their specific signal strengths and / or emission spectra. The invention also relates to a kit for carrying out the method.

Description

Background Art

[0001] As a further development of real-time PCR, precise and sensitive nucleic acid detection methods, especially digital PCR, have revolutionized molecular diagnostics in recent years because they are superior to standard PCR in detecting rare gene targets (Garcia-Murillas et al., 2015; Milbury et al., 2014). In digital PCR (dPCR), the reaction mixture and the nucleic acids (e.g., ctDNA or DNA) it contains are divided into thousands of reaction spaces, thereby separating the target sequences from each other and facilitating their amplification and detection, especially for rare target sequences. A common method here is to drop the reaction mixture with the nucleic acid microfluid to be detected into oil or into a fixed microcavity, so that each unit formed forms a closed reaction space for amplification and detection, such as during PCR. If a nucleic acid target sequence is present in the droplet, it is amplified by PCR (or other amplification methods). Single amplification products are usually detected by sequence-specific fluorescent nucleic acid probes, thereby generating corresponding fluorescent signals. In addition to absolute quantification, dPCR also has the advantage of reducing the influence of inhibitors. Because quantification in digital PCR is performed as an endpoint analysis, another type of data classification can be achieved by assigning “signal clusters” (also called populations) in the data space to specific DNA or cDNA target sequences by fluorescence signal intensity (Quan et al., 2018; Whale et al., 2016).

[0002] A relevant aspect of dPCR is multiplexing, since different nucleic acid target sequences are usually present in a sample at very low concentrations, it is therefore important to detect as many target sequences as possible in a sample. The most common multiplexing approach in dPCR is based on the fact that DNA reporters generate a fluorescent signal for each DNA target sequence in a spectral range that corresponds to the detection range of the detection channel. Thus, a DNA target sequence can be detected on each detection channel on the device side. However, the degree of multiplexing of the device was initially limited by the number of detection channels available. Currently available dPCR devices on the market have 2-6 different fluorescence detection channels, which means that a maximum of 6 target sequences can be analyzed on the device side. The main problem here is that the wavelengths may overlap with a large number of detection channels, resulting in reduced specificity and sensitivity due to the generated crosstalk.

[0003] One way to increase the degree of multiplexing is to use combinatorial approaches, for example by combining Taqman probes and DropOff probes as target sequences for specific reporters. In this case, the combination of signals generated by these probes also leads to a higher degree of multiplexing (Madic et al., 2018; Stilla Technologies; Corné et al., 2021). Since in some cases only single mutations are detected indirectly, the development of these methods is also very complex, the evaluation requirements are very high, and the certification or transfer to new target panels is also correspondingly complex.

[0004] In addition, there are other methods for increasing the degree of multiplexing of digital PCR, which aim to generate additional populations in the data space. A US patent (US9921154B2) from Bio-Rad describes a multiplexed digital PCR analysis with more target sequences than available optical channels, while taking into account other sample-specific aspects. However, the patent does not disclose any new detection features or methods for generating such target sequence populations. According to the current state of knowledge, these methods can only be used in situations where there is essentially a significant multiple occupancy of droplets with different DNA target sequences, or where the signal is generated by target sequence-specific reporters (such as Taqman probes or non-sequence-specific intercalating dyes), however, these methods themselves do not represent innovations to the prior art. It is described that different target sequence-specific probes can use, for example, different fluorophores as labels for this purpose, or can carry multiple fluorophore labels to generate multiple populations in the same detection channel. Since the signal of the probes described herein is suppressed by inefficient FRET quenching in the ground state, the initial signal suppression is relatively low, which is why the signal intensity can only be effectively modeled within a limited range to separate the populations in the data space. Since these labeled probes are also target sequence specific, extensive optimization of their fluorescence properties is very inefficient, as new labeled probes must be synthesized each time and the process must be restarted when moving to other sequences. Similarly, it is very complicated to perform multiple modifications of such target sequence specific probes with fluorophores, which also require modification with additional quenchers to sufficiently suppress the ground state signal to avoid nonspecific signal populations in the data space. The synthesis of such multiple modifications is very complex and usually requires extensive optimization, which is why they are rarely used for target sequence specific reporters, as the process is very inefficient.

[0005] Therefore, the most common variation in this intensity multiplexing is to vary the concentration of different types of target sequence-specific reporters (e.g., Taqman probes) while keeping the fluorescent labeling of each detection channel uniform and simple ( Figure 1Right) (Pecoraro et al., 2016; Whale et al., 2016). This can create additional populations in the data space of the graph. Due to the use of target sequence-specific fluorescent reporters, the signal generation depends directly on the target sequence or the PCR system. Therefore, this direct detection entails the problem of high optimization effort, since strong variance (data points located between different populations) leads to blurring of signal populations and thus to reduced precision (intensity multiplexing). The individual PCR components, especially fluorescent reporters with the same fluorescent label, must be well matched to each other, for example in orthogonal concentration ratios, but this is not always possible in practice. The approach can also be supplemented by combining with other dyes that exhibit additional fluorescent labels, which have emission maxima between different fluorescent detection channels and can therefore be detected equally in multiple fluorescence channels. This can lead to corresponding populations between other clusters in the data space, which become increasingly abstract as the dimensionality of the data space increases due to the additional detection channels. This makes the development of corresponding multiplexed assays and especially their approval very complicated. Another variation of intensity multiplexing uses more complex concentration variations to offset populations in the data space, making them less susceptible to variance (Hughesman et al., 2016).

[0006] In contrast, a method for nucleic acid detection that does not use target sequence-specific reporters is mediated probe PCR, which is based on the separation of nucleic acid detection by target sequence-specific mediated probes from signal generation by target sequence-nonspecific universal reporters, and was patented by the University of Freiburg in 2012 (WO2013079307A1, Faltin et al., 2012). This method is designed for colorimetric multiplexing using standardizable reporters. A signal is recorded for each detection channel, and regardless of its signal intensity, it can only be assigned to one activated universal reporter in a homogeneous reaction. It has been observed that different fluorophores produce different signal intensities and signal profiles under real-time PCR conditions, and the performance characteristics of the corresponding multiplex real-time PCR can be optimized by maximizing the signal generation of target sequence-nonspecific fluorescent universal reporters (Lehnert et al., 2018; Kipf et al., 2022). However, modeling signal intensity in real-time PCR has no practical added value, because signal profiles in the same detection channel cannot be distinguished using this approach. In colorimetric digital multiplexed probe PCR, it has also been shown that maximizing fluorescent signal generation can better separate populations in data space compared to negative controls (Schlenker et al., 2021b).

[0007] In the same period, Seegene Inc. developed a technology that is also based on the separation of DNA sequence detection and signal generation by two detection molecules in real-time PCR. Here, the unlabeled PTO probe binds to the DNA target sequence, is cut and releases fragments, which then form extended duplexes with fluorescently labeled target sequence nonspecific detection molecules (CTO molecules). This process is used to affect the signal generation of different lengths of these detection molecules. This makes it possible, for example, to distinguish multiple target sequences in the same detection channel by reading the signal at a defined predetermined temperature. Another patent also uses readings at different temperatures in real-time PCR in the same detection channel in a method, and can therefore be interpreted as a further development of the above-mentioned Seegene technology (PCT / CN2018 / 084794). Here, the extended reporter molecules are also melted after detection. Unlike the previous patent, the reporter molecules can be used to distinguish different target sequences. Since temperature control during reading cannot be implemented as a standard for dPCR in commercially available devices, it cannot be directly transferred to dPCR.

[0008] Hahn-Schickard has already worked on increasing the multiplexing degree of PCR by generating virtual fluorescence channels through photobleaching (WO2016087637A1) (Schuler et al., 2016). In order to combine this approach with the advantages of separating signal generation and detection in digital-mediated probe PCR, a step is added to the digital-mediated probe PCR using various universal reporter types labeled with different fluorophores, where these fluorophores are bleached (bleached) by light emitted by LED light and read in the same fluorescence detection channel. Depending on the selected fluorophore, a decrease in signal intensity due to bleaching can be observed, allowing the separation of populations in the data space of the graph and the generation of additional so-called virtual channels (Schlenker et al., 2021a). However, since the bleaching technique requires additional equipment and process steps that are not available in currently commercially available equipment, it cannot be implemented in existing dPCR platforms due to technical and regulatory barriers. However, in this approach, the fluorophores selected as universal reporter molecules do not yet generate different fluorescence signal intensities before the bleaching step, which enables the populations in the data space of the graph to be evenly separated if each reaction contains more than one target sequence. The universal reporter used does not have the necessary fluorophore and quencher configuration, and does not allow for single-color recognition. Due to the high scatter of the fluorescence signal intensity of the reporter label, a single fluorescent signal population with a higher "variance" cannot be clearly distinguished from a second signal population in the data space. In particular, the technique cannot clearly assess whether the multiplexed reaction is one or two populations, and therefore does not offer the possibility of direct multiplexing in the same detection channel by non-specific reporters of the target sequence (Schlenker et al., 2021a).

[0009] Purpose of the Invention

[0010] There is still a lack in the prior art of a method for regulating the signal intensity of target sequence-independent reporter molecules (produced by, for example, different fluorophores and / or quenchers) so that multiple distinguishable signal clusters are generated in the same detection channel or in corresponding areas of a multidimensional data space in a single reaction, thereby utilizing the advantages of indirect signal generation in terms of measurement accuracy and robustness to circumvent the problems of colorimetric multiplexing or target sequence-specific intensity multiplexing in previously described digital PCR. So far, only monochrome multiplexing of nonspecific reporter molecules in digital amplification by target sequences has been described, thereby achieving a higher degree of multiplexing by introducing additional process steps (e.g., bleaching). This complicates the process or evaluation, reduces accuracy, leads to additional optimization work, and complicates, for example, the approval process. Therefore, the object of the present invention is to increase the number of detectable nucleic acid target sequences in a detection reaction so that it exceeds the number of detection channels at the device end. Summary of the invention

[0011] The invention solves this object by the means of the dependent claims and the independent claim.

[0012] Therefore, in one aspect, the present invention relates to a method for specifically detecting at least two nucleic acid target sequences by at least two target sequence-independent reporter molecules in the same detection channel, comprising the following steps:

[0013] a. providing at least a first nucleic acid target sequence and a second nucleic acid target sequence,

[0014] b. providing at least a first intermediate probe and a second intermediate probe, each intermediate probe comprising an oligonucleotide,

[0015] wherein the oligonucleotide of the first mediator probe comprises a mediator sequence and a probe sequence, wherein the mediator sequence has an affinity for a first type of target sequence-independent reporter molecule, and the probe sequence exhibits an affinity for a first nucleic acid target sequence,

[0016] wherein the oligonucleotide of the second mediator probe comprises a mediator sequence and a probe sequence, wherein the mediator sequence has an affinity for a second type of target sequence-independent reporter molecule, and the probe sequence exhibits an affinity for a second nucleic acid target sequence,

[0017] wherein at least the first intermediary probe and the second intermediary probe are free of labels, or preferably free of signal generating labels,

[0018] c. providing at least two target sequence-independent reporter molecules of at least a first type and a second type, each molecule comprising at least one label having a measurable signal in the same detection channel, and a nucleic acid sequence having a specific affinity for at least one intermediary sequence,

[0019] wherein each type of at least two target sequence-independent reporter molecules is characterized by a respective at least one label such that it has a signal intensity that is preferably unique to the respective type of target sequence-independent reporter molecule and distinguishable from the signal intensities of the labels of all other target sequence-independent reporter molecule types and can be directly assigned to the respective nucleic acid target sequence,

[0020] d. performing a nucleic acid detection reaction, wherein when the probe sequence of at least the first mediator probe binds to at least the first nucleic acid target sequence, at least one mediator sequence of at least the first mediator probe is released,

[0021] wherein at least one released mediator sequence is bound to at least one target sequence-independent reporter molecule of a first type, wherein a signal is generated by at least one label, said signal being characterized by its signal intensity and / or emission spectrum for a first nucleic acid target sequence assigned to a respective target sequence-independent reporter molecule to which at least one probe sequence of at least one first mediator probe has bound,

[0022] And optionally, wherein at least one mediator sequence of at least one second mediator probe is released when its probe sequence binds to at least one second nucleic acid target sequence, wherein at least one released mediator sequence binds to at least one second type of target sequence-independent reporter molecule, wherein at least one label produces a signal, the signal intensity and / or emission spectrum of which is characteristic for the second nucleic acid target sequence assigned to the respective target sequence-independent reporter molecule to which at least one probe sequence of at least one second mediator probe has bound,

[0023] e. Detecting the signal generated in step d., including detecting the signal in the detection channel and / or analyzing the signal, signal intensity and / or emission spectrum of the signal and / or the signal cluster generated thereby in the data space, preferably, wherein the signals of non-specific reporter molecules of different target sequences can also be distinguished by their signal intensities in corresponding areas of the same detection channel or data space.

[0024] In an embodiment, the first mediator probe thus comprises an oligonucleotide, the first mediator probe itself comprises a mediator sequence, and a probe sequence. Thus, in an embodiment, the second mediator probe further comprises an oligonucleotide, the second mediator probe itself comprises a mediator sequence, and a probe sequence. Preferably, the mediator sequence of the first mediator probe is different from the mediator sequence of the second mediator probe. Preferably, the probe sequence of the first mediator probe is different from the probe sequence of the second mediator probe.

[0025] In other words, in an embodiment of the method according to the invention, the mediator sequence of the first mediator probe is different from the mediator sequence of the second mediator probe, and the probe sequence of the first mediator probe is different from the probe sequence of the second mediator probe. Therefore, preferably, the probe sequence of the second mediator probe also has an affinity for a "second" nucleic acid target sequence, which is different from the "first" nucleic acid target sequence (for example, in its nucleic acid sequence), and the probe sequence of the first mediator probe has an affinity for this "first" nucleic acid target sequence. The same applies to further (third, fourth, etc.) mediator probes that are optionally present and optionally used.

[0026] In an embodiment, step c. includes providing at least two target sequence-independent reporter molecules of at least a first type and a second type, each reporter molecule including at least one label having a respective measurable signal in the same detection channel and / or having a respective signal intensity maximum in the same detection channel, and a nucleic acid sequence each having a specific affinity for at least one intermediary sequence.

[0027] According to the invention, the "first" nucleic acid target sequence and the "second" nucleic acid target sequence preferably differ in their nucleic acid sequence and / or their epigenetic modifications. The same applies to further (third, fourth, etc.) nucleic acid target sequences that are optionally present and optionally detectable.

[0028] In a preferred embodiment of the method according to the present invention, the target sequence independence reporter molecule in the form of a labeled oligonucleotide is assigned to the nucleic acid target sequence. These reporter molecules are activated by releasing another oligonucleotide as the part of the nucleic acid detection reaction, thereby generating a signal. Different types of reporter molecules are modified with different labels (such as fluorophores and / or quenchers and / or different numbers of fluorophores and quenchers) respectively, and have different DNA sequences, which indirectly enable the assignment to the target sequence. In the same detection channel, different target sequence independence reporter molecule types produce signals of different signal intensities due to their different labels. Therefore, based on different signal intensities, the signals of different reporter molecule types with different labels can also be distinguished in the same detection channel or corresponding span data space (spanned by the different detection channels in the axis or pure mathematical comparison / analysis and / or algorithm analysis in the multidimensional representation), and the target sequence can be assigned. According to the present invention, the signal of at least two different reporter molecule complexes can be preferably detected in the corresponding region of the same detection channel or data space. The fact that these reporter molecules are independent of the target sequence enables the first development of reporter molecules with particularly good signal intensity in the same detection channel. Since these reporter molecules are independent of the target sequence, they can also have a suitable label configuration, thereby realizing effective signal modeling. For example, their signal can be suppressed in the initial state by contact quenching, so that they show greater differences in signal generation in the activated state or have multiple labels with fluorophores and / or quenchers. This allows the user to increase the number of detectable target sequences in the reaction to more than the number of detection channels without having to purchase additional equipment, expand the equipment or implement further complex process steps, which represents a huge added value and ensures high cost efficiency. Existing laboratory processes can be retained and already certified equipment can continue to be used without re-implementation and, if necessary, re-certification. In addition, this allows these target sequence-independent reporter molecules to be effectively optimized, as they can then be used for further target sequences without having to be developed and optimized from scratch with respect to target sequence dependence. Therefore, the present invention achieves a simplified and efficient process optimization of standard detection of different target sequences and reduces the required effort and costs.

[0029] According to the method of the present invention, accurate, efficient (direct) monochrome multiplexing can be achieved by target sequence non-specific reporter molecules. Therefore, it is possible to achieve effective target sequence independence optimization of the reporter molecules, thereby improving the separation of signal populations in the same detection channel or corresponding area of ​​the data space. This enables accurate detection of additional nucleic acid target sequences that exceed the number of detection channels of the device. This is possible because the use of target sequence independence reporter molecules significantly simplifies and improves the symmetrical multiple labeling of the same detection channel with fluorophores and quenchers and / or labeling with different fluorophore labels in a suitable configuration and / or fluorescence signal generation modeling, such as by contact quenching, compared to target sequence-specific reporter molecules.

[0030] This is accomplished using target sequence independent reporters (e.g. universal reporters), which are labeled oligonucleotides, each of which can be (indirectly) assigned to a nucleic acid target sequence to be detected and activated by binding to further oligonucleotides released as part of a nucleic acid detection reaction (e.g. PCR or digital PCR). In order to distinguish signals representing / indicating the presence of different nucleic acid target sequences in the same detection channel or in corresponding areas of the data space (graphical representation of detected signals), at least two target sequences to be detected are respectively assigned to two different types of target sequence non-specific reporters, which generate signals with different signal intensities in the same detection channel.

[0031] The advantage of the method according to the present invention is that multiple target nucleic acid sequences can be detected simultaneously in the same detection channel of a (PCR) device (for example, a channel for detecting red fluorescent signals). Simultaneous detection in a single detection channel can be achieved by using different target sequence non-specific reporter molecules, each non-specific reporter molecule contains a label that produces different signals with similar fluorescence emission spectra, and can be detected simultaneously in the same fluorescence detection channel of a device (for example, a digital PCR device), and can still be distinguished from each other. Utilizing this feature, the present invention can achieve monochrome multiplexing, that is, detecting multiple targets in a single ("monochrome") fluorescence detection channel (with a specific wavelength range).

[0032] In some digital PCR methods of the prior art, two labeled probes are used to detect the first or second target sequence in an emulsion droplet, each labeled probe being separated in one droplet, each labeled probe producing a homogeneous signal that can be distinguished from non-specific amplification. In the method according to the invention, no labeled probe is used, which has the advantage that the labeled reporter molecule can be optimized to a greater extent than is possible with the known methods of the prior art, because the reporter molecule according to the invention can then be used for further determinations. In addition, the reporter molecule according to the invention can preferably adopt only one configuration in which contact quenching occurs. This preferred property preferably enables or supports (direct) monochrome multiplexing in the form of the invention.

[0033] Another advantage of the method according to the present invention is that the desired detection characteristics can be precisely adjusted by selecting the respective reporter molecules used that are independent of the target sequence to be detected. The connecting part between the reporter molecules with the desired characteristics (such as fluorescence intensity and / or color) is a mediator probe, which comprises a probe sequence and a mediator sequence, and the connecting part is easy to produce and design. In order to individualize the target nucleic acid to be detected, only two different sequence components of the mediator probe need to be provided. These components can then be combined with target sequence non-specific reporter molecules that match the mediator sequence. This independence allows the required specific contact quenching to be set, so that multiple distinguishable reporter molecule signals can be detected in the same detection channel. In addition, the optimization of the signal can be performed once independently of a large number of target sequences. In addition, the method according to the present invention saves resources because the reporter molecule group can be reused for any number of nucleic acid target sequences, making the initial one-time development of combinable reporter molecule signals very labor-saving and cost-effective.

[0034] Furthermore, the method according to the invention enables direct detection of nucleic acid target sequences, since this can be directly assigned to a data population (signal population in evaluation / analysis) and does not require combination.

[0035] One possibility to generate different signal intensities by differential labeling of the reporter molecules is, for example, due to the physical molecular properties of the label, which are amplified by contact quenching after activation of the reporter molecule nonspecific to the target sequence:

[0036] Thus, in an embodiment, the at least one label of the target sequence independent reporter is at least one fluorophore and / or at least one quencher.

[0037] Another essential property of these target sequence non-specific reporters for the efficient generation of precisely distinguishable signal populations is the selection of labeling configurations that allow the generation of signals in such a way that their signal intensities are sufficiently robust, stable and therefore precise enough to remain distinguishable during the readout without the need for further processing steps (e.g. bleaching). It was shown that this is possible, for example, by using configurations that correspond to the basic architecture of universal reporters or by modifying them accordingly in a standardized manner. Target sequence non-specific reporters can be modeled in a suitable way so that different signal intensities can be precisely tuned in the detection channel (Lehnert et al., 2018).

[0038] Thus, in embodiments, different target-independent reporter types differ in the signal intensity and / or emission spectrum of at least one of their labels.

[0039] In an embodiment, at least one label of the target sequence independent reporter comprises at least two fluorophores and / or two quenchers having the same or different emission spectra and / or the same or different signal intensities.

[0040] In some embodiments, the difference between the first type of reporter molecule and at least the second type of reporter molecule is the number of labels or the number of fluorophores and / or quenchers. Therefore, different types of target sequence-independent reporter molecules can be distinguished by the signal intensity and / or intensity of the fluorescence released when they are activated. To this end, different types of target sequence-independent reporter molecules can contain different numbers and / or different fluorophores (with different emission spectra / colors and / or intensities) and / or quenchers or any combination thereof.

[0041] In a preferred embodiment in which the label comprises at least one fluorophore, the fluorescent signal of the at least one fluorophore is preferably suppressed by contact quenching until the reporter molecule is activated. Thus, preferably, the unactivated reporter molecule does not release a signal. Activation preferably occurs by binding of the mediator sequence to the corresponding target sequence-independent reporter molecule and / or in a nucleic acid detection reaction, subsequent extension of the mediator sequence that has been bound to the target sequence-independent reporter molecule by a polymerase.

[0042] Therefore, in an embodiment, at least one label of a target sequence-independent reporter molecule comprises at least one fluorophore and at least one quencher, wherein contact quenching preferably occurs between the at least one fluorophore and the at least one quencher as long as no intermediary sequence is bound to the corresponding target sequence-independent reporter molecule, or as long as the bound intermediary sequence is not extended during the nucleic acid detection reaction.

[0043] This enables, for example, the detection of additional DNA target sequences as part of digital DNA amplification and fluorescence-based detection in a suitable device without further technical assistance or changes in the concentration of the reporter molecule with a fluorescent label. This allows, for example, to produce results similar to those of digital mediated probe PCR (MP-PCR) combined with photobleaching without the need for a bleaching process (e.g. by LED or thermal bleaching), which significantly reduces the experimental workload, simplifies the experiment and enables its implementation in existing equipment. Therefore, compared with digital mediated probe PCR (MP-PCR) or other prior art methods, the method according to the invention represents an extremely high added value, because it is directly compatible with existing platforms and can significantly simplify the possible diagnostic approval of a specific detection method. The method according to the invention provides an additional new degree of freedom in the development of detection, wherein the synthesis process of the corresponding target sequence-specific probes does not have to be complicated. In addition, since additional nucleic acid sequences can be included in each reaction, the sensitivity of the detection according to the invention can be significantly improved. Another advantage is that a set of suitable target sequence non-specific reporter molecules always produces a population in a similar area of ​​the data space, so that conclusions about the activation of the reporter molecule can be drawn independently of the target sequence in the detection reaction, so that the same set can be used with different nucleic acid target sequence panels without time-consuming optimization.

[0044] In an embodiment of the method according to the invention, the analysis of the signal, the signal intensity and / or the emission spectrum of the signal under step e. comprises displaying and / or analyzing the detected signal according to the signal intensity and / or the detection channel and / or the emission spectrum in the data space spanned by the evaluated detection channels.

[0045] In the context of the present invention, the data space is preferably generated by a plot, diagram or graph of different detection channels or by a purely mathematical and / or algorithmic and / or computer-based evaluation, comparison or juxtaposition of different detection channels, wherein the respective fluorescence signals of the target sequence non-specific reporter molecules used generate data points in this 1-n dimensional data space (depending on the number of detection channels required for the evaluation), which can be grouped into clusters (groups, sets).

[0046] In the context of the present invention, the data space is preferably the space spanned by the X-axis and the Y-axis (two-dimensional drawing) in a drawing, a chart or a graph, and optionally in the case of a three-dimensional graph, the space additionally spanned by the Z-axis, or in the case of a correspondingly higher-dimensional space, the space spanned by another axis, and in which the data to be displayed (the data of the detected signals) are represented. In an embodiment in which the detection channels used for the process are displayed on the axes of the graph, for example the signal detected in the red detection channel on the X-axis and the signal detected in the green detection channel on the Y-axis, the data space may also be referred to as "spanned by the detection channels". Preferably, the detected signals displayed in the data space can be clearly assigned to the target sequence, and the detected signals can preferably be displayed in the form of different signal populations. If multiple signals specific to different target sequences are detected in the same detection channel, this is preferably also possible.

[0047] In an embodiment, the reporter molecules used simultaneously in the PCR reaction are different from each other, and the difference is that the type of fluorophore (e.g., color, emission spectrum and / or intensity) and / or the type of quencher and / or the number of labels on different reporter molecules are different. In an embodiment of monochrome multiplexing according to the present invention, at least two target nucleic acids in the same detection channel are indirectly detected by reporter molecules with different or distinguishable signals. In an embodiment where more than two target nucleic acids are to be detected, if necessary, the signal to be generated for detecting the target nucleic acid can be distributed between multiple detection channels (and labels of different types of reporter molecules can be selected accordingly), wherein preferably, at least two target nucleic acids in the same detection channel are indirectly detected by reporter molecules with different or distinguishable signals.

[0048] In embodiments, at least a first and a second nucleic acid target sequence, or even at least a first, second, and third, or even a fourth, fifth, sixth, seventh, eighth, ninth, tenth, eleventh, twelfth, thirteenth, fourteenth, fifteenth, sixteenth, seventeenth, eighteenth, nineteenth, twentieth, twenty-first or even more target sequences can be detected or their presence detected.

[0049] Depending on the number of nucleic acid target sequences to be detected, at least a first, second, third, fourth, fifth, sixth, seventh, eighth, ninth, tenth, eleventh, twelfth, thirteenth, fourteenth, fifteenth, sixteenth, seventeenth, eighteenth, nineteenth, twentieth, twenty-first or even more intermediate probes are provided, each intermediate probe comprising an oligonucleotide, and each oligonucleotide comprising a intermediate sequence and a probe sequence.

[0050] Therefore, depending on the number of nucleic acid target sequences to be detected, a first, second, third, fourth, fifth, sixth, seventh, eighth, ninth, tenth, eleventh, twelfth, thirteenth, fourteenth, fifteenth, sixteenth, seventeenth, eighteenth, nineteenth, twentieth, twenty-first or even more types of target sequence-independent reporter molecules are provided and used in the methods or kits according to the present invention described herein.

[0051] Those skilled in the art will understand how to combine the target sequence-independent reporter molecules according to the present invention and the types of their labels to achieve the detection of the desired target sequence according to the present invention.

[0052] In an embodiment, the label of at least one target sequence independent reporter molecule includes at least two complementary opposing nucleobases, each having at least one label, or at least two opposing bases offset by one base position from a complementary base pair, each having at least one label.

[0053] The present invention can detect multiple target nucleic acids simultaneously (multiplexing), wherein the number of target nucleic acids detected simultaneously can be greater than the number of detection channels available in the detection device. This is because the reporter molecules used in each case include labels, and although the signals of multiple different reporter molecules are detected simultaneously in the same detection channel, the signals generated by these labels can be distinguished from each other and can be represented as different (non-overlapping) signal groups in two-dimensional or three-dimensional data space in the analysis. In an embodiment, this makes it possible to distinguish the signals indicating the presence of different target nucleic acids, although detected in the same detection channel, and in a specific embodiment, it can also be distinguished from background noise.

[0054] In an embodiment of the method according to the invention, in steps d.-e., n different nucleic acid target sequences are detected indirectly by n different target sequence-independent reporter molecule types, wherein the detection of the signal generated in step d. occurs in k detection channels,

[0055] where n>k and n≥2, and

[0056] Wherein at least two different target sequence-independent reporter molecule types are detected in step e. in the same detection channel and / or are represented in the same region of the data space in the representation under step e..

[0057] By using the method according to the present invention, in embodiments data classification can be performed in a higher dimensional data space (>3 dimensions, with more than three detection channels). In embodiments, the method according to the present invention allows the number of distinguishable target sequences in digital PCR to be at least twice the number of available detection channels, provided that this is not itself hindered by technical limitations on the device side, such as possible crosstalk between different detection channels (mutual interference of fluorescence signals; incorrect association of a fluorescence signal with the signal of another fluorophore due to erroneous detection of fluorescence from an adjacent detection channel).

[0058] In embodiments, the signal of the label of the reporter molecule is suppressed, deleted or quenched until the mediator sequence binds to the reporter molecule and is preferably extended by a polymerase as part of a nucleic acid amplification reaction. In embodiments, spatial separation, such as spatial separation of at least one fluorophore and at least one quencher, is achieved by a polymerase so that a signal is generated and can be detected.

[0059] In an embodiment of the method according to the invention, the signal of the label of the target sequence-independent reporter molecule is generated by cleavage and / or separation of the target sequence-independent reporter molecule and / or by spatial separation of at least one fluorophore and at least one quencher.

[0060] In an embodiment, at least one target sequence-independent reporter molecule is an oligonucleotide or an oligonucleotide complex.

[0061] In an embodiment of the method according to the present invention, the nucleic acid detection reaction in step d. comprises a DNA and / or cDNA amplification procedure.

[0062] In an embodiment of the method according to the present invention, the nucleic acid detection reaction under step d. is PCR, RT-PCR, RPA or LAMP, wherein, during the DNA amplification process, the mediator sequence of the mediator probe bound to the target nucleic acid is released by the enzymatic activity of the biological molecule, and then the biological molecule binds to the target sequence-independent reporter molecule to generate a signal.

[0063] In an embodiment, the detection under step e. is performed as part of digital amplification and / or signal generation.

[0064] In an embodiment of the method according to the invention, the target sequence-independent reporter is a universal reporter and / or a modular reporter complex and the at least one (respectively) released mediator sequence is a component of a mediator probe PCR or a mediator displacement LAMP.

[0065] In embodiments, the nucleic acid target sequence is derived from another biological molecule converted into DNA sequence information.

[0066] In some embodiments, the presence and / or amount of an RNA sequence (an embodiment of a biomolecule) in a sample can be determined by transcribing the RNA sequence into cDNA via a reverse transcription reaction. In embodiments, the cDNA can be amplified as part of a method according to the invention and detected indirectly via a target sequence-independent reporter molecule.

[0067] In an embodiment of the method according to the invention, the at least one label comprises a label selected from electrochemically active labels and / or magnetic labels.

[0068] In an embodiment of the method according to the invention, the signal is read out at different temperatures.

[0069] In some preferred embodiments, the mediator probe comprises an oligonucleotide and a sequence-specific probe portion that binds to the target sequence and is protected at the 3' end. This protection at the 3' end can be a blocking group (protecting group), such as a chemical blocking or protecting group, which in some embodiments comprises a chain of three carbon atoms. The protection of the mediator probe at the 3' end preferably prevents (non-specific) extension of the sequence chain by the polymerase during the amplification reaction. According to the present invention, in an embodiment, the mediator probe may include any protective or blocking group suitable for preventing (non-specific) extension of the mediator probe sequence chain by the polymerase during the amplification reaction. In some embodiments, the mediator probe is protected from (non-specific) polymerase extension by means other than the blocking group (protecting group) at the 3' end.

[0070] In other embodiments, the mediator probe does not comprise a blocking group (protecting group) at the 3' end and is not protected from (non-specific) polymerase extension.

[0071] In an embodiment, the mediator probe protected at the 3' end may comprise a "C3 spacer". Such a C3 spacer may be a chemical blocking group, which in some embodiments comprises a chain of three carbon atoms. Thus, the "C3 spacer" preferably prevents (non-specific) polymerase extension of the mediator probe sequence chain. Those skilled in the art are familiar with typical and embodiment-dependent suitable blocking groups (protecting groups). Furthermore, based on the disclosure of the present invention, those skilled in the art will know how to select suitable blocking groups (protecting groups) as a routine adjustment of the invention described herein.

[0072] Preferably, the method according to the present invention is therefore capable of direct endpoint detection of n targets in k detection channels, where n>k and n≥2. Compared to the prior art, the signal according to the present invention is not generated by a fluorescent probe, but by a target sequence-independent reporter molecule, which can also be described as a population-specific reporter molecule, which preferably has a unique difference in the intensity range. This ensures greater flexibility in the experimental design process and allows the use of reporter molecules that use contact quenching for initial signal suppression. In addition, it allows the control of signal generation, thereby generating a more easily distinguishable and more robust fluorescent signal, which is particularly suitable for endpoint detection. A preferred embodiment of the present invention is based on a universal reporter molecule structure and is combined with a mediator probe for target sequence detection. One of the basic principles of the method according to the present invention is preferably to detect n target nucleic acid sequences by activating n target-specific mediator probe types of n reporter molecule types, wherein each reporter molecule type is labeled with a unique fluorophore with determined optical properties ( Figure 1 ). In the example of a duplex reaction, two fluorophores will be chosen that emit fluorescence in the same wavelength range, but with different intensities within the detection range. During dPCR amplification, the bound unlabeled mediator probe is cleaved by the polymerase and releases the mediator sequence. The mediator activates the reporter type, which then produces a fluorescent signal. The sum of all droplets or compartments with a signal for a particular reporter type forms a population in a certain region of the data space, corresponding to a unique fluorescent label. Those reporter types labeled with higher quantum yield fluorophores will produce a positive population with higher fluorescence intensity ( Figure 1 Bottom: High intensity is shown as larger circles), while those molecules with lower quantum yield in the detection area will produce a positive population with lower fluorescence intensity ( Figure 1 Top: low intensities are shown as smaller circles). Based on their position in the data space, the formed populations can be assigned to specific target DNA sequences to be detected in the sample. When two targets are present in one compartment, assuming an additive effect of the fluorescence intensities, this will lead to the formation of a third population with higher signal intensity. In further embodiments, similar signaling effects can be observed, for example, by using two different types of quenchers or two similar fluorophore labels on the reporter molecules in a dual reporter-dPCR reaction. In the example of a quadruple reporter dPCR assay performed in two detection channels, the presence of multiple targets in one compartment leads to the formation of orthogonal populations. This means that by using four different reporter types, theoretically up to sixteen different populations (e.g. Figure 5). Without being bound by theory, it can be assumed that the distribution of target nucleic acids in digital assays follows Poisson statistics. Therefore, the generation of double and multiple positive populations may depend on the concentration of target nucleic acids, as well as possible competition effects caused by detecting loci sharing the same primer pair. Compared with the high-order multiplexing methods of the prior art, the advantage of the present method is that the concentration of target sequence independent reporter molecules can be kept constant in different assays. This provides greater freedom for assay design and can efficiently optimize the fluorescent signal population. In SNP detection, another advantage of combining the mediator probe with the target sequence independent reporter molecule comes into play. During the extension process, the preferably bound mediator probe is highly specifically cleaved by the polymerase, wherein the mediator portion is cleaved from the probe portion. The cleavage site is preferably located between the first nucleotide and the second nucleotide of the probe portion of the mediator probe. Only when the cleavage is performed correctly can the released mediator fully bind to the mediator binding site on the specific target sequence independent reporter molecule type, thereby initiating signal generation. If the correct cleavage does not occur, the existing 3' protrusion will preferably hinder the extension process at the target sequence independent reporter molecule and no signal will be generated. Therefore, in the case of SNP detection, the first nucleotide may be preferably located at the 5' end of the target-specific probe portion of the mediator probe, rather than at the SNP position, to activate a specific target sequence-independent reporter molecule type.

[0073] In another aspect, the present invention relates to a kit comprising:

[0074] - at least one target sequence-independent reporter molecule of a first type comprising at least one label,

[0075] - optionally, at least one second type of target sequence-independent reporter molecule comprising at least one label, said label preferably emitting a signal in the same detection channel or corresponding region of the data space as the at least one first type of target sequence-independent reporter molecule;

[0076] - Optionally, at least one first intermediary probe, whose intermediary sequence has affinity for at least one first type of target-independent reporter molecule and whose oligonucleotide sequence exhibits affinity for a first nucleic acid target sequence;

[0077] - Optionally, at least one second intermediary probe, the intermediary sequence of which has an affinity for at least one second type of target-independent reporter molecule and the oligonucleotide sequence of which exhibits an affinity for a second nucleic acid target sequence;

[0078] - optionally, at least one buffer;

[0079] -optionally, a polymerase;

[0080] -optionally, reverse transcriptase;

[0081] - Optionally, at least one PCR primer.

[0082] In one embodiment, the kit according to the invention is suitable or configured for carrying out the method according to the invention.

[0083] In an embodiment, the kit according to the present invention may include more than two different types of target sequence-independent reporter molecules, and optionally also include more than first and second mediator probes, wherein the mediator sequence of the mediator probe has affinity for the first or second or further type of respective target sequence-independent reporter molecules, and its oligonucleotide sequence correspondingly has affinity for the first or second or further nucleic acid target sequence, respectively, thereby specifically detecting more than two different nucleic acid target sequences.

[0084] Embodiments described for one aspect of the invention may also be embodiments of any other aspect of the invention. Thus, embodiments described for the method of the invention may also be embodiments of the kit of the invention. In addition, any embodiment described herein may also include features of any other embodiment of the invention. Various aspects of the invention are unified in, benefit from, are based on and / or are related to the common and surprising discovery of the unexpected beneficial effect of the method, namely, simultaneous PCR detection of multiple target sequences through target sequence independence reporter molecule optimization. DETAILED DESCRIPTION

[0085] The term "target sequence-independent reporter molecule" describes a molecule or complex of at least one DNA oligonucleotide used to generate a signal during PCR in the presence of a DNA target sequence. Preferably, the target sequence-independent reporter molecule comprises at least one label and at least one quencher.

[0086] In an embodiment, the target sequence independent reporter molecule comprises one or more media binding sites. Therefore, the target sequence independent reporter molecule can comprise at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 40 or even 50 media binding sites. In a preferred embodiment, the target sequence independent reporter molecule comprises 1 to 10 media binding sites. The (activated) media or media sequence bound to the media binding site can cause the activation or degradation, digestion, (solution) cutting or release of one or more labels when extended by (PCR) polymerase, and the label is, for example, from a quencher and / or fluorophore of one or more preferably upstream (towards the 5' end) modifiers located / positioned on the reporter molecule.

[0087] In the context of the present invention, mediator nucleic acid sequences may be referred to as "mediator probes" or "mediator probes". This always refers to a nucleic acid probe that transmits a signal between a target nucleic acid homologous to the mediator probe and a target sequence-independent reporter molecule. During a nucleic acid amplification reaction (e.g., a PCR or digital PCR reaction), a polymerase migrating forward on the target nucleic acid can cut or digest the mediator probe bound to the target nucleic acid. The mediator sequence, or simply "mediator", is then released and can bind to the mediator binding site of the target sequence-independent reporter molecule. If the polymerase now also binds to the reporter molecule during the PCR process and starts to extend the bound mediator sequence, the label is preferably activated, for example, the quencher is preferably separated from the fluorophore, thereby generating a signal and / or achieving a signal change. In other words, a "mediator" or "mediator sequence" in this article refers to a nucleic acid oligonucleotide that can be extended by a polymerase along a target sequence-independent reporter molecule. "Mediator probe" describes a nucleic acid oligonucleotide, preferably a DNA oligonucleotide, which establishes a connection between the target sequence and a target sequence-independent reporter molecule by binding to the target sequence in the presence of the DNA target sequence during PCR, and is cleaved by the exonuclease activity of the polymerase to release the mediator sequence, which then binds to a related target sequence-independent reporter molecule for which it has affinity.

[0088] In the context of the present invention, the affinity of a nucleic acid target sequence describes the physical attraction that two homologous nucleic acid sequences have to each other, which can cause them to bind or hybridize to each other. In a preferred embodiment, for the affinity or successful hybridization of two homologous nucleic acid sequences to each other, there is complete homology between two nucleic acid sequences of a specific length, such as between a probe sequence and a target nucleic acid sequence. In other embodiments, homologous sequences may comprise at least one mismatch with respect to each other.

[0089] In the context of the present invention, the data space is preferably generated by a drawing, chart or graph of different detection channels or a purely mathematical, algorithmic and / or computer-based evaluation, comparison or juxtaposition, wherein the respective fluorescence signals of the target sequence-independent reporter molecules used generate data points in this 1-n dimensional data space (depending on the number of detection channels required for the evaluation), which can be grouped into clusters (groups, sets). Therefore, in an embodiment, a "data space" can be a space generated or "spanned" in a drawing, diagram or graph, preferably generated or "spanned" by the X-axis and the Y-axis (two-dimensional drawing), and optionally - in the case of a three-dimensional graph - also generated or "spanned" by the Z-axis, or in higher dimensions also generated or "spanned" by another axis, and wherein the data to be displayed are represented. In an embodiment, the signals detected in the corresponding detection channels are displayed on the axes of the graph or drawing - for example, the signal of the red detection channel is displayed on the X-axis, the signal of the green detection channel is displayed on the Y-axis, and the signal of the blue detection channel is displayed on the Z-axis of the drawing - the data space can also be described as "spanned by the detection channels". In a further embodiment, the data space is generated by a purely algorithmic and / or computer-based evaluation, comparison and / or juxtaposition of different detection channels and / or signals detected therein, and is preferably "spanned" by the analyzed detection channels.

[0090] By using the method according to the present invention, in embodiments, data classification can be performed in a high-dimensional data space (>3 dimensions, with more than three detection channels). In embodiments, the method of the present invention can at least double the number of distinguishable target sequences in digital PCR compared to the available detection channels, provided that this is not itself limited by technical limitations of the equipment (e.g., possible crosstalk between different detection channels).

[0091] In the context of the present invention, "label" can include one or more fluorophores and / or one or more quenchers. Therefore, in the context of the present invention, the reporter molecule can carry or include one or more fluorophores and / or quenchers. The proximity of the fluorophore to the quencher will prevent the detection of its fluorescence. In an embodiment, the proximity of the reporter molecule-quencher is destroyed, for example, by releasing one or more fluorophores and / or quenchers, wherein in an embodiment, this is achieved by partial degradation of the reporter molecule, for example, at the 5' end, by hydrolysis of the 5'-to-3' exonuclease activity of the PCR polymerase used for the amplification reaction. Therefore, unquenched fluorescence emission can be achieved, which can be detected after excitation with a laser. In a preferred embodiment, the target sequence independence reporter molecule comprises at least one fluorophore and at least one quencher (so they are preferably "paired"), wherein the quencher preferably suppresses the fluorophore signal until the mediator sequence is combined with the reporter molecule and preferably extended by the polymerase as a part of the nucleic acid amplification reaction. In an embodiment, spatial separation, for example, the polymerase achieves the combination of at least one fluorophore and at least one quencher, thereby generating a signal and being detectable. In embodiments where multiple quencher-fluorophore pairs are present in the target sequence-independent reporter molecule, these pairs may also be arranged in different positions relative to each other. The target sequence-independent reporter molecule may comprise one or more labels, for example, there may be at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 labels, or exactly 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or even 25 labels. In some embodiments, the target sequence-independent reporter molecule comprises 1, 2, 3, or up to 5 labels. In other embodiments, the target sequence-independent reporter molecule comprises 1, 2, 3, 4, 5, or even more than 5 labels.

[0092] For the purposes of the present invention, a "C3 spacer" is preferably a chemical blocking group (protecting group), which preferably comprises a chain of three carbon atoms. The blocking group (protecting group) is preferably used to prevent (non-specific) polymerases from extending the chain. The person skilled in the art is familiar with typical and - depending on the embodiment - suitable C3 spacers / blocking groups (protecting groups), and the person skilled in the art knows how to select a suitable C3 spacer / blocking group (protecting group) as a routine adjustment of the invention described herein based on the disclosure of the present invention.

[0093] According to the present invention, the signal generating label is preferably a fluorophore or other dye capable of generating a detectable signal. In some embodiments, the signal generating label is an electroactive or magnetic label. In the context of some embodiments, the terms "signal generating label" and "label" are equivalent or interchangeable.

[0094] In the context of the present invention, biomolecules preferably include nucleic acids.

[0095] The term "nucleic acid" refers to a nucleic acid molecule, including but not limited to DNA, ssDNA, dsDNA, RNA, mRNA, tRNA, lncRNA, ncRNA, microRNA, siRNA, rRNA, sgRNA, piRNA, rmRNA, snRNA, snoRNA, scaRNA, gRNA or viral RNA. The nucleic acid sequence herein refers to a continuous arrangement of nucleotides, wherein the nucleotides are represented by their nucleobases, guanine (G), adenine (A), cytosine (C) and thymine (T) in DNA and uracil (U) in RNA. The nucleic acid sequence herein can also refer to a sequence of continuous letters or nucleobases (consisting of G, A, C and T or U), which represents the actual sequence of continuous nucleic acids in a DNA or RNA chain. The nucleic acid sequence can be identified and characterized in a biochemical and bioinformatic manner using DNA or RNA sequencing, or specifically detected by complementary nucleic acid probes (e.g., by mediator probes in the embodiments herein), for example as part of a PCR, real-time PCR or digital PCR detection reaction. Sequence analysis can also include comparing the obtained nucleic acid sequence or its specific detection signal with the detection signal of one or more reference nucleic acid sequences and / or housekeeping genes. The term nucleotide can be abbreviated as "nt". The term base pair (two nucleobases bound to each other by hydrogen bonds) can be abbreviated as "bp".

[0096] In the context of the present invention, a "target sequence" (also referred to herein as a "target") describes any nucleic acid sequence of interest to be detected by the method of the present invention. The target sequence may preferably be a DNA, cDNA, cfDNA or RNA sequence. The target sequence may be a portion of a target DNA or the entire nucleic acid sequence. The intermediary probe preferably comprises a sequence that is completely or partially complementary to the nucleic acid sequence of the target sequence or a portion thereof. In some embodiments, the intermediary probe sequence is 100%, 99%, 95%, 90% or 80% complementary to the target sequence. In some embodiments, the intermediary probe can tolerate one or more mismatches with the target sequence and still bind to it. In other embodiments, the intermediary probe binds to the target sequence only when it is 100% complementary to the target sequence.

[0097] The term "nucleic acid amplification reaction" refers to any process comprising an enzymatic reaction capable of amplifying nucleic acids. Preferred embodiments of the present invention relate to polymerase chain reaction (PCR). "Polymerase chain reaction" ("PCR") is a gold standard method for rapidly producing millions to billions of copies (complete copies or partial copies) of a given DNA sample, capable of amplifying very small DNA samples to sufficiently large amounts. PCR amplifies specific regions of the DNA chain (DNA target sequence) based on the positions to which the primers used bind, thereby initiating the amplification reaction. Almost all PCR applications use a thermostable DNA polymerase, such as Taq polymerase.

[0098] In digital PCR (dPCR), the reaction mixture and the nucleic acids (e.g., ctDNA or DNA) contained therein are divided into thousands of reaction spaces, thereby separating target sequences from each other and facilitating their amplification and detection, especially rare target sequences. A common method here is to drop the reaction mixture with the nucleic acid microfluid to be detected into oil or into a fixed microcavity, whereby each unit formed forms a closed reaction space for amplification and detection, such as during PCR. If the nucleic acid target sequence is present in the droplet, it is amplified by PCR (or other amplification methods). Individual amplicons are typically detected by sequence-specific fluorescent nucleic acid probes, where corresponding fluorescent signals are generated. In addition to absolute quantification, dPCR has the advantage of reducing the effects of inhibitors. Since quantification in digital PCR is performed as an endpoint analysis, "signal clusters" (also called populations) in the data space can be assigned to specific DNA or cDNA target sequences by the intensity of the fluorescent signal, thereby achieving another type of data classification (Quan et al., 2018; Whale et al., 2016).

[0099] "Multiplexing" generally means detecting multiple target sequences simultaneously in one reaction without further dividing the reaction mixture to detect multiple target sequences. In "multiplex PCR", multiple separate PCR reactions for different DNA sequences or genes are combined under the same conditions to form a single reaction mixture. By allowing multiple sequences to be analyzed simultaneously, information can be obtained from a single PCR reaction that would otherwise require multiple times the reagents and more time to perform. Therefore, multiplexing reduces the cost and time required to perform PCR because fewer reagents are used for each experiment, experiments can be performed faster, and results can be analyzed faster. Since by dividing the reaction mixture, the target sequence to be detected may be divided into a single detection reaction in which the sequence will not be detected, multiple detection is more sensitive and is a very promising detection method, especially in tumor diagnosis. Since pipetting errors can also be minimized in a single reaction compared to multiple reactions, the use of multiple PCR can also improve accuracy compared to a single assay.

[0100] Quantitative PCR ("qPCR") or "real-time PCR" is a specific form of PCR and is a standard method for detecting and quantifying specific target sequences or quantifying gene expression levels in a sample in real time. In qPCR, fluorescently labeled probes or nucleic acids (e.g., mediator probes) are hybridized in a PCR reaction and, in embodiments, once they bind to a complementary sequence (e.g., a target sequence), are cleaved or digested by a PCR polymerase during primer extension, wherein, in embodiments, the presence and amplification of the target sequence are monitored in real time after or during each PCR cycle. Real-time PCR allows the progress of an ongoing amplification reaction to be monitored as the amplification reaction occurs (i.e., in real time). Therefore, data is collected throughout the PCR reaction, rather than at the endpoint as in conventional PCR. Measuring reaction kinetics in the early stages of PCR has significant advantages over conventional PCR detection. In embodiments of real-time PCR, the reaction is characterized by the time when target amplification is first detected in the cycle, rather than the amount of target accumulated after a fixed number of cycles as in conventional PCR. The higher the starting copy number of the nucleic acid target, the more likely it is that a significant increase in fluorescence will be observed. Real-time PCR can be analyzed by optical signals, which are used to detect specific PCR products (target sequences) using specific fluorescent dyes or fluorophores. Therefore, the increase in DNA products during PCR results in an increase in the fluorescence intensity measured in each cycle. By using markers of different colors, fluorescent probes can be used in multiple assays to monitor multiple target sequences.

[0101] While real-time qPCR relies on the relative amount of target nucleic acid determined in each amplification cycle, "digital PCR" allows the absolute amount of target nucleic acid to be determined based on Poisson statistics, which is used to calculate the amount of target nucleic acid after endpoint PCR amplification. The pre-amplification steps between digital PCR and qPCR are generally comparable or similar. However, in qPCR, it is best to pool all nucleic acid molecules together before amplification and analysis, while in digital PCR, it is best to divide the nucleic acid molecules into separate partitions (such as emulsion droplets, wells or gel beads) as much as possible, allowing PCR to be performed as a single reaction in each partition (in the case of emulsion droplets, the reaction is also commonly referred to as droplet PCR or digital droplet PCR) and allowing each partition to be analyzed separately. In digital PCR, nucleic acid molecules are randomly divided into separate partitions according to a Poisson distribution. When analyzing digital PCR, Poisson statistics are then applied to determine the average number of nucleic acid molecules per partition (none, one or more). Poisson statistical analysis of the number of positive and negative reactions provides accurate absolute quantification of the target sequence.

[0102] Recombinase polymerase amplification ("RPA") is a method for amplifying DNA and is a variant of isothermal DNA amplification. RPA is typically performed using a recombinase (single-strand binding protein) and a strand-displacing DNA polymerase, where the recombinase increases primer binding. If a strand-displacing polymerase is used, the reaction can be performed at 37 to 42°C or even at room temperature. By adding a reverse transcriptase to the RPA reaction, reverse transcription can be performed. In different variants of RPA, the resulting DNA can optionally be additionally quantified in the RPA reaction (similar to qPCR) and / or multiple DNA sequences can be amplified in parallel in a multiplex procedure.

[0103] The term “loop-mediated isothermal amplification” or “LAMP” refers to a method for amplifying DNA, where LAMP is also a variant of isothermal DNA amplification. Isothermal amplification reactions are usually performed at a constant temperature. This property distinguishes LAMP from PCR, in which the reaction is performed through a series of alternating temperature steps or cycles. Strand-displacing DNA polymerases are usually used in LAMP. In a LAMP reaction, for example, four to six primers can bind to six to eight DNA sequences, which requires special primer design. In a LAMP reaction, reverse transcription can be performed by adding a reverse transcriptase. In addition, the DNA produced in a LAMP reaction can be quantified. In a multiplex LAMP reaction, multiple DNA sequences can also be detected in parallel.

[0104] In the context of the present invention, "signal change" describes a change in fluorescent signal. The signal change is preferably a significant, distinguishable and / or characteristic change in the fluorescent signal, which is clearly distinguishable or distinguishable from a potential baseline or background signal or baseline or background noise. It is known to those skilled in the art that under certain experimental conditions of fluorescence detection, nonspecific fluorescent base signals or baselines or background noise may occur due to fluorophores. Therefore, in the context of the present invention, signal changes preferably describe significant, distinguishable and / or characteristic changes in fluorescent signals, rather than fluorescent bases or background signals or baselines or background noise. In a preferred embodiment, this signal change can mean an increase in fluorescence intensity, in other words, an increase in fluorescent signal. In some embodiments, signal changes are a reduction in fluorescent signal. The increase in fluorescent signal is preferably due to an increase in the number of target sequence amplifications by an amplification reaction, thereby increasing the activation of the associated signal complex. Therefore, the number of (de)cuts, digestions and / or separations generated by the corresponding signal oligonucleotide from the binding site on its associated base chain increases, so that at least one fluorophore is released and / or separated from its quencher (i.e., the distance between the quencher and the fluorophore increases, so that the fluorescent signal is no longer quenched by the quencher). Thus, an increase (increase in number) of released and / or unquenched fluorophores results in an increase in the fluorescent signal, which is specific and indicative of the target sequence. Thus, the more target sequences are present in the PCR reaction and bound by the intermediary probe, the more the fluorescent signal increases. Preferably, the fluorescent signal is proportional or approximately proportional to the amount of the corresponding target sequence that is specific / characteristic of the fluorophore signal (e.g., its color). Since in digital or "droplet" PCR, there is preferably only one target sequence per reaction space (e.g., partition, emulsion droplet), the signal increases with the number of target sequence amplifications per reaction space until a signal steady state is reached, which is predetermined by the maximum fluorescence intensity of the reporter molecule used for the corresponding detection. In a preferred embodiment, ideally, at the beginning of amplification, each reaction space (e.g., separation, emulsion droplet) has a uniform distribution of at most 1 target sequence, so that, in the case of similar amplification efficiency and maximum fluorescence intensity of the detection molecule in all reaction spaces (including the target sequence), a specific signal for detecting the same target sequence with comparable height / intensity / intensity in different reaction spaces is generated during the readout process by digital or "droplet" PCR, which preferably indicates the presence and / or quantity of target sequence amplicons present in each reaction space. In an embodiment, the intensity / intensity of each label (preferably for the target sequence) and the maximum signal intensity / intensity that can be achieved may depend on the number of labels and / or the type of label (e.g., the type of fluorophore and / or quencher) for each signaling oligonucleotide and signaling complex.

[0105] A "fluorophore" (or fluorescent dye, similar to a chromophore) is a fluorescent chemical compound that can re-emit light when stimulated by light. Fluorophores used as labels in the design of the labeled probes of the present invention include, but are not limited to, rhodamine and its derivatives (e.g., Texas Red), fluorescein and its derivatives (e.g., 5-bromomethylfluorescein, Lucifer Yellow, IAEDANS, 7-Me2N-coumarin-4-acetate, 7-OH-4-CH3-coumarin-3-acetate, monobromobismalane, pyrene trisulfonate (e.g., Cascade Blue and monobromotrimethylaminobismalane), 7-NH2-4CH3-25-coumarin-3-acetate (AMCA), FAM, TET, CAL Fluor Gold 540, JOE, VIC, Quasar 570, CAL Fluor Orange 560, Cy3, NED, Oyster 556, TMR, CAL Fluor Red 590, HEX, ROX, LC Red 610, CAL Fluor Red 610, Texas Red, LC Red 610, CAL Fluor Red 610, LC Red 640, CAL Fluor Red 635, Cy5, LC Red670, Quasar 670, Oyster 645, LC Red 705, Cy5.5, BODIPY FL, Rhodamine Green, Oregon Green 30 488, Oregon Green 514, Cal Gold, BODIPY R6Gj, Yakima Yellow, Cal Orange, BODIPY TMR-X, JOE, HEX, Quasar-570 / Cy3, TAMRA, Rhodamine Red-X, Redmond Red, BODIPY 581 / 591, Cy3.5, Cal Red / Texas Red, BODIPY TR-X, BODIPY 630 / 665-X, Quasar-670 / Cy5, Pulsar-650, Dy490, Atto-488, Atto532, Atto-Rho-6G, Dy590, Atto -Rho101, Cy5, Dy-636, Atto-647N, Cy5.5, Dy682, Atto-680, BMN-488, BMN-505, BMN-536, BMN-562.

[0106] "Quenching is any process that reduces the fluorescence intensity of a given substance. Quenching is The FRET (Fluorescence Resonance Energy Transfer) assay is the basis for either static or contact quenching assays or a combination of both. FRET is a dynamic quenching mechanism because the energy transfer occurs when the donor is in an excited state. Contact quenching requires close proximity in the form of physical contact between the donor and the quencher. A quencher is a molecule that quenches the fluorescence emitted by a fluorophore when the fluorophore is excited by the light source of a PCR cycler or detection device. The quenchers used as labels in the design of the labeled signal oligonucleotides and / or base chains of the present invention include, but are not limited to, DDQ-I, Iowa Black, Iowa Black FQ, QSY-9, BHQ-1, QSY-7, BHQ-2, DDQ-II, 22Eclipse, Iowa Black RQ, QSY-21, BHQ-3Dabcyl, QSY-35, BHQ-0, Elle quenchers, BMN-Q1, BMN-Q2, BMN-Q60, BMN-Q-535, BMN-Q590, BMN-Q620, BMN-Q650. Those skilled in the art know suitable reporter quencher pairs and know which ones to choose for specific applications.

[0107] Example

[0108] The present invention is further described by the following examples. These examples are not intended to limit the scope of the present invention, but rather represent preferred embodiments of various aspects of the present invention and are provided to illustrate the invention described herein.

[0109] method

[0110] In the following embodiments, PCR amplification is performed in the form of digital PCR. Digital PCR refers to a PCR amplification reaction in which a single nucleic acid molecule is preferably divided into separate partitions (e.g., emulsion droplets, wells, or gel beads), wherein PCR occurs as a separate reaction in each partition (in the case of emulsion droplets, the reaction is also often referred to as droplet PCR or digital droplet PCR), and each partition is enabled to be analyzed separately. The analysis is preferably performed by fluorescence analysis of each separate partition (e.g., by laser excitation of a fluorophore and detection of the fluorescence emitted). If the target sequence is located in a partition and detected by a method according to the present invention, it is preferably indicated by a specific fluorescent signal.

[0111] The Naica system from Stilla Technologies was used for the examples listed. In the first step, droplets were generated and heat treated using a geode. The dPCR protocol used was 5 minutes at 95°C, followed by 45 cycles of 15 seconds at 95°C and 60 seconds at 58°C. A Prism 3 reader and CrystalMiner software (version 3.1.6.3) developed for this purpose were used to analyze droplets in Examples 1-8, and a Prism 6 reader was used in Example 9.

[0112] For Examples 1-8, a single concentrated MultiPlex qPCR 50 nM Alexa Fluor 488 was used as background fluorophore. In duplex and quadruplex reactions, 0.5 μM forward primer and 0.25 μM reverse primer, 1.2 μM mediator probe and 0.6 μM target sequence independent reporter were used for the corresponding target sequence. For sixplex reactions, the concentration of target sequence independent reporter was reduced to 0.4 μM. For Example 9, a single concentration of Multiplex PCR MIX 10X and used 1.2 μM mediator probe and 0.4 μM target sequence independent reporter for each target sequence, and a total of 2 μM forward primer and 1 μM reverse primer.

[0113] In Example 10, the process can be similar to Example 9, wherein the ZUR-mediated probe used in Example 9 will be adapted to further target sequences.

[0114] In order to prevent nonspecific extension of the related oligonucleotide sequence, the 3' end of the oligonucleotide sequence is preferably modified using chemical protecting groups. These are, for example, chains containing three carbon atoms (C3 spacers) that chemically link and prevent the polymerase from extending the oligonucleotide sequence during the PCR reaction.

[0115] sequence:

[0116] Table 1: Primers

[0117] SEQ ID name Sequence (5'-3') 1 KRAS_Forward GGCCTGCTGAAAATGACT 2 KRAS_Reverse ACAAAATGATTCTGAATTAGCTGTA 3 BRAF_Forward GACCCACTCCATCGAGATTTC 4 BRAF_reverse GCTTGCTCTGATAGGAAAATGAG

[0118] Table 2: Intermediate probes. In the sequences, the probe regions are shown in uppercase letters; bases associated with point mutations are marked in bold. The C3 spacer is preferably a chemical blocking group for the chain containing three carbon atoms to prevent nonspecific polymerase extension of the chain.

[0119]

[0120] Table 3: Target sequence independent reporter molecules (fluorophore modification is located inside the first 3' base of the stem-loop structure (nt 22 (7; 6) or nt 20 (8); shown as 6, 7 or 8); quencher is attached to the first base of the stem-loop structure on the 5' side (nt 1)). The C3 spacer is preferably a chemical blocking group for the chain containing three carbon atoms to prevent non-specific polymerase extension of the chain.

[0121]

[0122] Table 4: Target sequences (primer hybridization regions are underlined; point mutations / SNPs are in bold)

[0123]

[0124]

[0125] Example 1

[0126] In this embodiment, a signal is generated when the mediator probe binds to a nucleic acid target sequence and is digested or cleaved by a polymerase, which amplifies the nucleic acid sequence as part of a PCR reaction. As a result, the mediator or mediator sequence is released and can bind to a target sequence-independent reporter molecule. If the bound mediator is now recognized by the polymerase as a primer or starting oligonucleotide for amplification during the PCR reaction and is bound and extended by the polymerase, the quencher or fluorophore located "downstream" (downstream in the direction of amplification) of the mediator binding site is separated or replaced, thereby generating a signal from the fluorophore that was previously quenched by contact quenching. The signal is characteristic of the nucleic acid target sequence to which the mediator probe was previously bound. The method of the present invention is accomplished by using at least two target sequence-independent reporter molecules (see Figure 1 Target-independent reporters) enable (direct) single-color multiplexing in digital PCR, with each reporter having a different fluorophore modification (see Figure 1 , which are shown as circles or triangles), have an emission maximum in one (e.g., red) detection channel, and are configured to enable signal identification. Figure 1 In the figure, circles of different sizes represent different signal intensities of fluorescence. By using target sequence-independent reporters, contact quenching can be more effectively adjusted compared to the target sequence-specific Taqman probes of the prior art, making it easier to amplify or model the signal intensity differences of different fluorophores in the same detection channel.

[0127] For (direct) multiplexing, i.e. the simultaneous detection of different target sequences in the samples to be analyzed and / or reactions, the prior art generally requires multiple optical channels, further process steps or complex concentration adjustments or modifications of the reporter molecules. In contrast, the method according to the invention allows the detection of different target sequences in the sample in the same detection channel without being restricted by the above-mentioned points. The use of target sequence-independent reporter molecules also allows the reuse of optimized designs for different target sequences and correspondingly makes their application more efficient. For example, different intensity combinations of individual labels and / or different fluorophore colors, preferably different extension mediator sequences and therefore different detection target sequences can be encoded and distinguished.

[0128] In an embodiment, different target sequence independence reporter molecules can be used to simultaneously detect multiple target sequences by different fluorescence intensities and / or fluorescence colors. These target sequence independence reporter molecules each have different media binding sites, which are labeled with fluorescence and / or quenchers of different signal intensities and / or colors / emission spectra. However, preferably, target sequence independence reporter molecules are used, wherein at least two reporter molecules are always able to produce a signal that can be measured / detected in the same detection channel.

[0129] By generating signals with different signal intensities, these signals can be distinguished in one fluorescent channel. These embodiments provide considerable advantages, particularly in digital PCR, for distinguishing different signal clusters and represent an improvement over the prior art.

[0130] Example 2

[0131] The embodiment of using two target sequence-independent reporter molecules with different numbers of fluorophores and quenchers and emission maxima in the red detection channel is another embodiment of (direct) monochrome multiplexing according to the present invention. In this embodiment, different fluorescence signal intensities are generated by different numbers of fluorophores during digital PCR, thereby achieving signal recognition. By using target sequence-independent reporter molecules, for example, as opposed to target sequence-specific Taqman probes, symmetrical multiple modifications can be used more effectively on fluorophores and quenchers, thereby amplifying the signal intensity differences of different fluorophores in the same detection channel.

[0132] Example 3

[0133] In one sample analysis, (direct) monochrome multiplexing is performed by using two target sequence-independent reporters labeled with different fluorophores in the red detection channel. Here, the two different target sequence-independent reporters are labeled with Cy5 or Atto-647N. The analysis includes amplification reactions in the context of digital PCR (mediated probe PCR) in the Stilla Naica system, where the results obtained can be graphically displayed in multiple dimensions of the data space.

[0134] Figure 2 Graphical evaluation and representation of digital PCR results are shown in the form of 1-D (one-dimensional) graphs.

[0135] Figure 3 A graphical evaluation and representation of digital PCR results is shown in the form of a 2-D (two-dimensional) graph. Here, in the two-dimensional data space, the specific signal of the reporter complex / reporter molecule in the red channel ("red", Y-axis) is compared with the background signal (background noise) in the blue detection channel ("blue", X-axis). The two different signals of the reporter complex / reporter molecule can be easily distinguished from each other as different signal populations and background noise (in the blue detection channel) in the two-dimensional data space.

[0136] Figure 4 A graphical evaluation and representation of digital PCR results is shown in the form of a 3-D (three-dimensional) graph. Here, the specific signal of the reporter complex / reporter molecule in the red channel ("red", Y-axis) is compared with the background signal in the blue detection channel ("blue", X-axis) and the signal of the negative control (sample without target gene) in the green channel ("green", Z-axis). In this example, the two different signals of the reporter complex / reporter molecule can also be easily distinguished from each other as different signal populations and background noise in the three-dimensional data space and the signal of the negative control - not detected here, but may be present in other analyses.

[0137] Example 4

[0138] In this experiment, (direct) single-color multiplexing in two detection channels (e.g., red and green channels) was performed using mediator probes in a digital PCR reaction by using four different types of target sequence-independent reporters (ZUR1-ZUR4), which were labeled with different fluorescent markers. In a graphical representation of the signals detected during a digital PCR reaction, these signals generated by the different types of reporters can be represented as a population of signals in a data space (the space generated or spanned by the X-axis and the Y-axis, where the data is represented graphically).

[0139] Figure 5A theoretical schematic diagram representing the analysis of the signal of an embodiment with four different reporter molecules (ZUR1-ZUR4) is shown, where different fluorescent signal intensities are represented by circles of different sizes and positions in the data space. Figure 5 The data space in consists of an X-axis representing the signal intensity detected in the red detection channel (ZUR4 and ZUR2) and a Y-axis representing the signal intensity detected in the green detection channel (ZUR3 and ZUR1). The signal population in the data space can be clearly assigned to one of the four types of activated target-independent reporters and can therefore be effectively used to detect different target panels (target sets or combinations) rather than target-specific reporters (e.g., Taqman probes).

[0140] Example 5

[0141] In another embodiment of the present invention, during (direct) monochrome medium probe multiplex PCR, samples in red, green and blue detection channels can be analyzed in parallel. To this end, samples are amplified and analyzed in a corresponding digital PCR system (e.g., Stilla Naica system). For each detection channel, two, one or zero DNA target sequences are added to a duplex reaction (the reaction mixture contains two different types of reporter molecules, each reporter molecule is specific to one of the two DNA target sequences), so that both target sequences can be detected simultaneously, or only one of them or neither can be detected in the respective detection channels.

[0142] Figure 6 The results of this embodiment using two different reporter complexes / reporter molecules in the red detection channel in the (direct) monochrome multiplex analysis of the Stilla Naica system are shown. The signal of the double reaction (double reaction) is shown, wherein the characteristic signals of target sequence 1 and target sequence 2 (X axis) are shown in the data space on the far left. In the middle data space, the reaction signals of the single addition of the target sequence (single reaction in the double reaction method) are shown, which are specific to a single target sequence 1 (X axis) or target sequence 2 (X axis). The data space on the far right shows the measured signal of the negative control (NTC; X axis). The Y axis shows the signal intensity detected in the red detection channel. Both types of target sequence-independent reporter molecules (ZUR05 and ZUR06) are labeled with Cy5 / BHQ-2 or BHQ-2 / Atto-647N for signal generation.

[0143] The different signals of the reporter complex / reporter molecule can be easily distinguished from each other as different signal populations in the two-dimensional data space, allowing specific detection of both target sequences in each case.

[0144] Figure 7 The results of this embodiment using two different reporter complexes / reporters in the green detection channel in the (direct) monochrome multiplex analysis of the Stilla Naica system are shown. The signal of a double reaction (double reaction) is shown, in which the signals detected for target sequence 1 and target sequence 2 (X-axis) specificity are shown in the data space on the far left. After adding only one DNA target sequence, two separate detections of target sequence 1 (X-axis) and target sequence 2 (X-axis) are shown in the data space in the middle. The negative control (NTC; X-axis) is shown in the data space on the far right. The signal intensity in the green detection channel is shown on the Y-axis. Two types of target sequence independence reporter molecules (ZUR02 and ZUR04) are labeled with Dy530 and BMN-Q1 or with BMN536 and BHQ-1 for generating signals.

[0145] The different signals of the reporter complex / reporter molecule can be easily distinguished from one another as different signal populations in the two-dimensional data space, so that in each case both target sequences can be specifically detected.

[0146] Figure 8 The results of this embodiment using two different reporter complexes / reporters in the (direct) monochrome multiplex analysis of the Stilla Naica system are shown. The signal of a double reaction (double reaction) is shown, wherein the signal specific for target sequence 1 and target sequence 2 (X-axis) is shown in the data space on the far left. Two separate detections after adding only one DNA target sequence are shown in the middle data space, which indicate the presence of a separate target sequence 1 (X-axis) or target sequence 2 (X-axis). The signal of the negative control (NTC; X-axis) is shown in the data space on the far right. The signal intensity in the blue detection channel is shown on the Y-axis. Two target sequence independence reporters (ZUR07 and ZUR08) are labeled with FAM / BHQ-1 or Atto488 / BMN-Q1, respectively, for generating signals.

[0147] The different signals of the reporter complex / reporter molecule can be easily distinguished as different signal populations in the two-dimensional data space, so that both target sequences can be specifically detected in each case.

[0148] Example 6

[0149] In another embodiment of the present invention, during (direct) single-color intermediate probe multiplex PCR, samples in green and blue detection channels can be simultaneously analyzed for the presence of 4 target sequences. To this end, samples are amplified and analyzed in a corresponding digital PCR system (e.g., Stilla Naica system). In this "4-Plex intermediate probe PCR", four target sequence-independent reporter molecules and four target sequence-specific intermediate probes are provided to detect DNA target sequences: I-KRAS G12A (KRAS gene mutation G12A), II-KRAS WT (KRAS wild-type gene), III-BRAF V600E (BRAF gene mutation V600E) and IV-BRAF WT (BRAF wild-type gene). Reporter molecules for KRAS target gene variants (different BRAF or KRAS single nucleotide polymorphisms (SNPs) or wild-type (WT) variants) produce signals in the green detection channel (BMN536 and Dy-530 fluorophores) upon activation, and reporter molecules for BRAF target gene variants produce signals in the blue detection channel (FAM and Atto 488 fluorophores) upon activation.

[0150] Fig. 9 The results of the SNP analysis are shown, wherein the signals of the target sequences I and II detected separately in the partition are displayed in the upper left quadrant of the data space. The signals of the target sequences III and IV detected separately in the partition are displayed in the lower right quadrant of the data space. The signals of a KRAS and a BRAF target sequence (i.e., I+III, II+III, I+IV, and II+IV) detected simultaneously in a partition are displayed in the upper right quadrant of the data space. The Y axis represents the signal intensity in the green detection channel (BMN536 and Dy-530 fluorophores), and the X axis represents the signal intensity in the blue detection channel (FAM and Atto 488 fluorophores).

[0151] like Fig. 9 As shown, each detection channel can detect multiple signal clusters, which can be assigned to activated, target sequence-independent reporter molecules and thus to the corresponding target sequences.

[0152] Example 7

[0153] In another embodiment of the present invention, during (direct) monochrome media probe multiplex PCR, samples in green, red and blue detection channels can be simultaneously analyzed for the presence of 6 target sequences. To this end, samples are amplified and analyzed in a corresponding digital PCR system (e.g., Stilla Naica system). In this "6-Plex Media Probe PCR" experiment, 6 target sequence-independent reporter molecules and 6 target sequence-specific media probes are provided to analyze target sequences: I-BRAF V600E (BRAF gene mutation V600E), II-BRAF WT (BRAF wild-type gene), III-KRAS WT (KRAS wild-type gene), IV-KRASG12A (KRAS gene mutation G12A), V-KRAS G12D (KRAS gene mutation G12D), VI-KRAS G12V (KRAS gene mutation G12V). Reporter molecules for BRAF target gene variants BRAF V600E and WT produce signals in the blue detection channel (FAM or Atto 488 fluorophores) upon activation, reporter molecules for KRAS WT and G12A target gene variants produce signals in the green detection channel (DY-530 or BMN-536 fluorophores) upon activation, and reporter molecules for KRAS G12D and G12V target gene variants produce signals in the red detection channel (Cy5 and Atto-647N fluorophores) upon activation.

[0154] Fig.10 The results of this analysis are shown, wherein the signals of target sequences I and II detected separately in the partition are shown on the X-axis of the data space. The signals of target sequences V and VI detected separately in the partition are shown on the Y-axis of the data space. The signals of target sequences III and IV detected separately in the partition are shown on the Z-axis of the data space. The signals of the respective KRAS or BRAF target sequences detected simultaneously in the partition are also shown in the data space. The signal intensity in the red detection channel is shown on the Y-axis, the signal intensity in the blue detection channel is shown on the X-axis, and the signal intensity in the green detection channel is shown on the Z-axis.

[0155] like Fig.10 As shown, each detection channel can detect multiple signal clusters, which can be assigned to activated, target sequence-independent reporter molecules and thus to the corresponding target sequences.

[0156] Example 8

[0157] By using the described method, data classification can also be performed in higher dimensional data space (>3 dimensions, more than 3 detection channels). Using the described method, the number of distinguishable target sequences in digital PCR can theoretically be at least twice the number of available detection channels, provided that this is not itself limited by device-side technical limitations (such as crosstalk between different detection channels):

[0158]

[0159]

[0160] Those skilled in the art are familiar with corresponding methods for classifying higher-dimensional data structures.

[0161] Example 9

[0162] In another embodiment, using the method, the multiplexing capacity of each detection channel can be increased by more than two times. Therefore, the multiplexing capacity of each detection channel can be increased by at least three times or further. This can be achieved by using at least three reporter molecules in the detection channel, which generate at least three distinguishable groups in the data space of the respective detection channels, and these groups are specifically assigned to each reporter molecule. This allows up to three target sequences to be detected in one detection channel, which triples the device-side detection channel capacity, provided that they themselves are not limited by device-side technical limitations (such as crosstalk between different detection channels). Fig.12 The results of a three-fold increase in detection channels in Stilla Prism-6 are shown. Here, the presence of three target sequences was analyzed simultaneously in the infrared detection channel of Stilla Prism-6. To this end, the samples were amplified and analyzed in a corresponding digital PCR system (e.g., StillaNaica system). In this "3-Plex Mediated Probe PCR", three target sequence-specific mediated probes are provided, and three target sequences are detected by three target sequence non-specific reporter molecules and fluorophore quencher combinations Cy5.5+BHQ2 (I KRAS G12D), Dy636+BHQ2 (II KRAS WT) and Atto680+BHQ2 (III KRAS G12V): I-KRAS G12D (KRAS single point mutation G12D), II KRAS WT (KRAS wild-type genomic sequence) and III KRAS G12V (KRAS single point mutation G12V). A particular advantage of this approach compared to existing techniques is that the use of target sequence non-specific reporters makes signal generation very robust and simplifies data analysis by generating populations at comparable distances from each other in data space across multiple independent experiments. This has the added benefit of signal optimization required for such population separation.

[0163] Example 10

[0164] In another embodiment, since one or more different DNA target sequences are detected by cutting one or more different mediator probes and releasing one or more different mediator sequences, and the signal is generated by extending one or more mediator sequences on one or more different target sequence-independent reporter molecules, a set of target sequence-independent reporter molecules can be used to detect different sets of DNA target sequences. In this case, the target sequence-independent reporter molecules remain unchanged and are adapted to different DNA target sequences by exchanging mediator probes and / or primers. In this way, the optimization efficiency of the fluorescent signals of the target sequence-independent reporter molecules is much higher, because compared with the prior art, these fluorescent signals only need to be optimized once for each detection device (such as a digital PCR thermal cycler). This means that signal optimization can be used more efficiently than before to generate many different, highly distinguishable fluorescent signal populations in the data space, because this optimization only needs to be performed once and can then be transferred to other DNA target sequence panels. Therefore, the corresponding optimization process is more efficient and is generally known to those skilled in the art and described in the professional literature (Lehnert et al., 2018). This means that, due to signal optimization, assays using direct single-color multiplexing can achieve better performance in terms of sensitivity, precision or specificity with less effort than prior art assays, which have to optimize the signal again for each new target sequence. Compared to the prior art, this has the particular advantage that the signal can always be unambiguously assigned to the same reporter molecule simply by its position in the data space, and there is no need to correlate this position in the data space with other information (such as temperature or the position of other signal populations in the data space) in order to determine the activation of non-specific reporters of the corresponding target sequence.

[0165] Attached photos

[0166] The invention is further described in the following drawings. These are not intended to limit the scope of the invention, but rather represent preferred embodiments of aspects of the invention and are used to illustrate the invention described herein.

[0167] Figure 1: Direct monochrome multiplexing in digital PCR using two target sequence-independent reporters ("ZUR") of the first (A) type and the second (B) type, each reporter molecule having a different fluorophore label (shown as a circle or triangle) with maximum emission in the red detection channel, which is configured to enable signal recognition. The different signal intensities of the fluorescence are characteristic of the respective nucleic acid target sequences, represented by circles of different sizes. Compared to target sequence-specific Taqman probes, by using target sequence-independent reporters, contact quenching (quenching of at least one fluorophore by at least one quencher) can be more effectively adjusted, thereby amplifying the signal intensity differences of different fluorophores in the same detection channel. At least one quencher is located at the 5' end of the reporter molecule ("5'-quencher modification"). Each type of reporter molecule ("ZUR1" under (A) or "ZUR2" under (B)) binds to and activates a specific mediator sequence ("Mediator 1" under (A) or "Mediator 2" under (B)), which has been previously cut and / or released from the corresponding mediator probe ("Mediator Probe 1" under (A) or "Mediator Probe 2" under (B)).

[0168] Figure 2 : The figure shows the results of Example 3 by means of a one-dimensional graph (1-D graph). In Example 2, two nucleic acid target sequences were detected by (direct) single-color ("mediator probe") duplex PCR (digital PCR in the Stilla Naica system) using a first type and a second type of relevant specific target sequence-independent reporter molecule types. The two different reporter molecule types included the red fluorophore Cy5 or the red fluorophore Atto 647N as labels, which are characteristic of the respective nucleic acid target sequences and were detected and analyzed in the red detection channel of the Stilla Naica system (digital PCR system).

[0169] Figure 3 : The figure represents the results of Example 3 by a two-dimensional (2-D) graph. In Example 2, two nucleic acid target sequences were detected by (direct) monochrome ("media probe") dual PCR (digital PCR in the Stilla Naica system) using a first type and a second type of related specific target sequence independent reporter molecule types. The two different reporter molecule types include red fluorophore Cy5 or red fluorophore Atto647N as markers, which are characteristic of the respective nucleic acid target sequences and are detected in the red detection channel of the Stilla Naica system (digital PCR system). The figure compares the specific signal of the reporter molecule complex / reporter molecule in the red channel ("red", Y axis) with the background signal (background noise) in the blue detection channel ("blue", X axis) in a two-dimensional data space. Unit of the Y axis: relative fluorescence unit (RFU).

[0170] Figure 4 : The figure represents the results of Example 3 in a three-dimensional (3-D) graph. In Example 2, two nucleic acid target sequences were detected by (direct) monochrome ("mediator probe") duplex PCR (digital PCR in the Stilla Naica system) using a first type and a second type of related specific target sequence independent reporter molecule types. The two different reporter molecule types include a red fluorophore Cy5 or a red fluorophore Atto647N as a marker, which are characteristic of the respective nucleic acid target sequences and are detected in the red detection channel of the Stilla Naica system (digital PCR system). The figure compares the specific signal of the reporter molecule complex / reporter molecule in the red channel ("red", Y axis) with the background signal (background noise) in the blue detection channel ("blue", X axis) and the signal of the negative control (not containing target sequence) in the green detection channel ("green", Z axis) in the 3-D data space. Unit of the axis: relative fluorescence unit (RFU).

[0171] Figure 5 : shows a schematic diagram of the test design and reporter molecules used in Example 4. In Example 4, four different types of target sequence-independent reporter molecules (ZUR1-ZUR4) with different fluorescent labels are used to perform direct monochrome multiplexing of two detection channels (e.g., red channel (X axis) and green channel (Y axis)) in a digital PCR reaction. The four different types of target sequence-independent reporter molecules (ZUR1-ZUR4) are respectively bound and activated by specific mediator sequences (mediator types 1-4), wherein the fluorescent signals generated and detected are specific for the corresponding nucleic acid target sequences.

[0172] Figure 6 : The results of Example 5 are shown. In the (direct) monochrome multiplex PCR analysis in the Stilla Naica system, two different target sequence independent reporter molecule types are used in the red detection channel. The signal of the double reaction (double reaction) is shown, wherein the signal indicating the presence of target sequence 1 and target sequence 2 (X axis) is shown in the data space on the far left. The signal of a single detection (after adding only one DNA target sequence to each) for target sequence 1 (X axis) and target sequence 2 (X axis) is shown in the data space in the middle. The signal of the negative control (NTC; X axis) is shown in the data space on the far right. The signal intensity in the red detection channel ("red") is shown on the Y axis. Two types of target sequence independent reporter molecules (ZUR05 and ZUR06) are used to generate signals, and the two types of target sequence independent reporter molecules are labeled with Cy5 / BHQ-2 or BHQ-2 / Atto-647N. Y axis unit: relative fluorescence unit (RFU).

[0173] Figure 7: The results of this Example 5 are shown, i.e., two different reporter complexes / reporter molecules are used in the green detection channel in the (direct) monochrome multiplex analysis of the Stilla Naica system. The signals of the double reaction (double reaction) are shown, wherein the signals specific to target sequence 1 and target sequence 2 (X-axis) are shown in the data space on the far left. After adding only one DNA target sequence, two separate detections for detecting a single target sequence 1 (X-axis) or target sequence 2 (X-axis) are shown in the data space in the middle. The signal of the negative control (NTC; X-axis) is shown in the data space on the far right. The signal intensity in the green detection channel is shown on the Y-axis. Two target sequence-independent reporter molecules (ZUR02 and ZUR04) are used to generate signals, and the two target sequence-independent reporter molecules are labeled with Dy530 / BMN-Q1 or BMN536 / BHQ-1. Y-axis unit: relative fluorescence unit (RFU).

[0174] Figure 8 : The results of this embodiment 5 are shown, i.e., in the (direct) monochrome multiplex analysis of the Stilla Naica system, two different reporter complexes / reporter molecules are used in the blue detection channel. The signal of the double reaction (double reaction) is shown, wherein the signal specific to target sequence 1 and target sequence 2 (X axis) is shown in the data space on the far left. In the data space in the middle, a single detection after adding only one DNA target sequence is shown, which indicates the presence of a single target sequence 1 (X axis) or target sequence 2 (X axis). The signal of the negative control (NTC; X axis) is shown in the data space on the far right. The Y axis represents the signal intensity in the blue detection channel. Two types of target sequence-independent reporter molecules (ZUR07 and ZUR08) are used for signal generation, and the two types of target sequence-independent reporter molecules are labeled with FAM / BHQ-1 or Atto488 / BMN-Q1. Y axis unit: relative fluorescence unit (RFU).

[0175] Fig. 9: The results of Example 6 are shown, in which the samples in the green and blue detection channels are simultaneously analyzed for the presence of 4 target sequences using (direct) single-color mediated probe multiplex PCR. To this end, the samples are amplified and analyzed in a corresponding digital PCR system (Stilla Naica system). In this "4-Plex mediated probe PCR", specific target sequence-independent reporters are used for the target sequences: I-KRAS G12A (KRAS gene mutation G12A), II-KRAS WT (KRAS wild-type gene), III-BRAF V600E (BRAF gene mutation V600E) and IV-BRAF WT (BRAF wild-type gene). The reporter of the KRAS target gene variant generates a signal in the green detection channel (Y axis) after activation, and the reporter of the BRAF target gene variant generates a signal in the blue detection channel (X axis) after activation. In the 2-D figure (2-D data space) shown, the signals of the target sequences I and II detected separately in the partition are displayed in the upper left quadrant of the data space. The lower right quadrant of the 2-D data space shows the signals of target sequences III and IV detected individually in the partition. The upper right quadrant of the 2-D data space shows the signals of one KRAS and one BRAF target sequence detected simultaneously in one partition (i.e., I+III, II+III, I+IV, and II+IV). The Y-axis shows the signal intensity in the green detection channel and the X-axis shows the signal intensity in the blue detection channel. Units of the axes: relative fluorescence units (RFU).

[0176] Fig.10: The figure shows the results of Example 6 in the form of a three-dimensional (3-D) diagram, wherein samples in the green, red and blue detection channels were simultaneously analyzed for the presence of 6 target sequences using (direct) single-color intermediate probe multiplex PCR. For this purpose, the samples were amplified and analyzed in a corresponding digital PCR system (Stilla Naica system). In this “6-Plex-mediated probe PCR”, specific target sequence-independent reporters (ZUR02, ZUR04-ZUR08) were used for the following target sequences: I-BRAFV600E (BRAF gene mutation V600E; ZUR07, marker: FAM / BHQ-1), II-BRAF WT (BRAF wild-type gene; ZUR08, marker: Atto488 / BMN-W1), III-KRAS WT (KRAS wild-type gene; ZUR02, marker: DY-530 / BMN-Q1), IV-KRAS G12A (KRAS gene mutation G12A; ZUR04, marker: Cy5 / BHQ-1), V-KRAS G12D (KRAS gene mutation G12D; ZUR05, marker: Cy5 / BHQ-2), VI-KRAS G12V (KRAS gene mutation G12V, ZUR06, marker: Atto647N / BHQ-2). The reporter molecules of BRAF target gene variants BRAF V600E and WT produce signals in the blue detection channel (FAM or Atto488 fluorophore) after activation, the reporter molecules of KRAS WT and G12A target gene variants produce signals in the green detection channel (DY-530 or BMN-536 fluorophore) after activation, and the reporter molecules of KRAS G12D and G12V target gene variants produce signals in the red detection channel (Cy5 and Atto-647N fluorophore) after activation. In the 3-D graph (3-D data space), the signals of target sequences I and II detected separately in the partition are displayed on the X-axis. The signals of target sequences V and VI detected separately in the partition are displayed on the Y-axis of the 3-D data space. The signals of target sequences III and IV detected separately in the partition are displayed on the Z-axis of the 3-D data space. The signals of the respective KRAS or BRAF target sequences detected simultaneously in the partitions are also displayed in the 3-D data space. The signal intensity in the red detection channel is displayed on the Y-axis, the signal intensity in the blue detection channel is displayed on the X-axis, and the signal intensity in the green detection channel is displayed on the Z-axis. The units of the axes are relative fluorescence units (RFU).

[0177] Fig.11:A possibility of generating different signal intensities by using different labels on reporter molecules generates an embodiment of physical molecular properties such as from the labels, which are amplified by contact quenching after activating the target sequence nonspecific reporter molecules. In both figures, the X-axis shows the fixed dimensions of the label (or "marker") and the measured signal, such as wavelength, potential, frequency, etc. The variable dimension of the measured signal (in this case, signal intensity) is displayed on the Y-axis. The points in each figure represent the intersection of the respective signal intensities 1 and 2 of the fluorophore 1 or 2 and the respective measurement wavelengths.

[0178] Fig.12 : Describe the results of Example 9, in which three different DNA target sequences were detected in one detection channel by three different target sequence non-specific reporters, each with three different fluorescent labels, as part of a 3plex (heavy) mediated probe PCR, using three different mediated probes in the infrared channel of Prism6. In this "3-Plex mediated probe PCR", three target sequences: I-KRAS G12D (KRAS single point mutation G12D), II KRAS WT (KRAS wild-type genomic sequence) and III KRAS G12V (KRAS single point mutation G12V) were characterized by three target sequence non-specific reporters with fluorophore quencher combinations Cy5.5+BHQ2 (I KRAS G12D), Dy636+BHQ2 (II KRAS WT) and Atto680+BHQ2 (III KRAS G12V). Therefore, each of these target sequence non-specific reporters generates a specific population in the data space that can be assigned to one of the three DNA target sequences.

[0179] References

[0180] Faltin, Bernd; Wadle, Simon; Roth, Günter; Zengerle, Roland; Stetten, Felixvon (2012): Mediator probe PCR: a novel approach for detection of real-time PCR based on label-free primary probes and standardized secondary universal fluorogenic reporters. In: Clinical chemistry 58(11), pp.1546-1556. DOI:10.1373 / clinchem.2012.186734.

[0181] Garcia-Murillas, Isaac; Schiavon, Gaia; Weigelt, Britta; Ng, Charlotte; Hrebien, Sarah; Cutts, Rosalind J., et al. (2015): Mutation tracking in circulating tumor DNA predicts relapse in early breast cancer. In: Science translational medicine 7(302), 302ra133. DOI: 10.1126 / scitranslmed.aab0021.

[0182] Hughesman, Curtis B.; Lu, XJ David; Liu, Kelly YP; Zhu, Yuqi; Poh, Catherine F.; Haynes, Charles (2016): A Robust Protocol for Using Multiplexed Droplet Digital PCR to Quantify Somatic Copy Number Alterations in Clinical Tissue Specimens. In: PloS one 11(8), e0161274. DOI: 10.1371 / journal.pone.0161274.

[0183] Kipf, Elena; Schlenker, Franziska; Borst, Nadine; Fillies, Marion; Kirschner-Schwabe, Renate; Zengerle, Roland, et al. (2022): Advanced Minimal Residual Disease Monitoring for Acute Lym-phoblastic Leukemia with Multiplex Mediator Probe PCR. In: The Journal of molecular diagnostics: JMD 24(1), pp. 57-68. DOI: 10.1016 / j.jmoldx.2021.10.001.

[0184] Lehnert, Michael; Kipf, Elena; Schlenker, Franziska; Borst, Nadine; Zengerle, Roland; Stetten, Felix von (2018): Fluorescence signal-to-noise optimisation for real-time PCR using universal reporter oligonucleotides. In: Anal. Methods 10(28), pp. 3444-3454. DOI: 10.1039 / C8AY00812D.

[0185] Milbury, Coren A.; Zhong, Qun; Lin, Jesse; Williams, Miguel; Olson, Jeff; Link, Darren R.; Hutchison, Brian (2014): Determining lower limits of detection of digital PCR assays for cancer-related gene mutations. In: Biomolecular detection and quantification 1(1), pp. 8-22. DOI: 10.1016 / j.bdq.2014.08.001.

[0186] Pecoraro S.,Berben G.,Burns M.,Corbisier P.,De Giacomo M.,De LooseM.,Dagand E.,Dobnik D.,Eriksson R.,Holst-Jensen A.,Kagkli DM,Kreysa J.,Lievens A., D., Mazzara M., Paternò A., Peterseil V., Savini C., Sovová T., Sowa S., Spilsberg B.: Overview and recommendations for the application of digital PCR. JRC Technical Report. Luxembourg: Publications Office of the European Union, 2019 (2019). Available online at https: / / publications.jrc.ec.europa.eu / repository / handle / JRC115736.

[0187] Schlenker, Franziska; Kipf, Elena; Borst, Nadine; Hutzenlaub, Tobias; Zengerle, Roland; Stetten, Felix von; Juelg, Peter (2021a): Virtual Fluorescence Color Channels by Selective Photobleaching in Digital PCR Applied to the Quantification of KRAS Point Mutations. In: Analytical chemistry 93(30), pp.10538-10545. DOI:10.1021 / acs.analchem.1c01488.

[0188] Schlenker, Franziska; Kipf, Elena; Deuter, Max; Inga; Lehnert, Michael; Zengerle, Roland, et al. (2021b): Stringent Base Specific and Optimization-Free Multiplex Mediator Probe ddPCR for the Quantification of Point Mutations in Circulating Tumor DNA. In: Cancers 13(22). DOI: 10.3390 / cancers13225742.

[0189] Schuler, Friedrich; Trotter, Martin; Zengerle, Roland; Stetten, Felix von (2016): Monochrome Multiplexing in Polymerase Chain Reaction by Photobleaching of Fluorogenic Hydrolysis Probes. In: Analytical chemistry 88(5), pp. 2590-2595. DOI: 10.1021 / acs.analchem.5b02960.

[0190] Whale, Alexandra S.; Huggett, Jim F.; Tzonev, Svilen (2016): Fundamentals of multiplexing with digital PCR. In: Biomolecular detection and quantification 10, pp. 15-23. DOI: 10.1016 / j.bdq.2016.05.002.

[0191] Corné,Julien;Le Du,Fanny;Quillien,Véronique;Godey,Florence;Robert,Lucie;Bourien, et al. (2021): Development of multiplex digital PCR assays for the detection of PIK3CA mutations in the plasma of metastatic breast cancer patients. In: Scientific reports 11(1), p.17316. DOI:10.1038 / s41598-021-96644-6.

[0192] Faltin, Bernd; Wadle, Simon; Roth, Günter; Zengerle, Roland; Stetten, Felixvon (2012): Mediator probe PCR: a novel approach for detection of real-time PCR based on label-free primary probes and standardized secondary universal fluorogenic reporters. In: Clinical chemistry 58(11), pp.1546-1556. DOI:10.1373 / clinchem.2012.186734.

[0193] Garcia-Murillas, Isaac; Schiavon, Gaia; Weigelt, Britta; Ng, Charlotte; Hrebien, Sarah; Cutts, Rosalind J., et al. (2015): Mutation tracking in circulating tumor DNA predicts relapse in early breast cancer. In: Science translational medicine 7(302), 302ra133. DOI: 10.1126 / scitranslmed.aab0021.

[0194] Hughesman, Curtis B.; Lu, XJ David; Liu, Kelly YP; Zhu, Yuqi; Poh, Catherine F.; Haynes, Charles (2016): A Robust Protocol for Using Multiplexed Droplet Digital PCR to Quantify Somatic Copy Number Alterations in Clinical Tissue Specimens. In: PloS one 11(8), e0161274. DOI: 10.1371 / journal.pone.0161274.

[0195] Kipf, Elena; Schlenker, Franziska; Borst, Nadine; Fillies, Marion; Kirschner-Schwabe, Renate; Zengerle, Roland, et al. (2022): Advanced Minimal Residual Disease Monitoring for Acute Lym-phoblastic Leukemia with Multiplex Mediator Probe PCR. In: The Journal of molecular diagnostics: JMD 24(1), pp. 57-68. DOI: 10.1016 / j.jmoldx.2021.10.001.

[0196] Lehnert, Michael; Kipf, Elena; Schlenker, Franziska; Borst, Nadine; Zengerle, Roland; Stetten, Felix von (2018): Fluorescence signal-to-noise optimisation for real-time PCR using universal reporter oligonucleotides. In: Anal. Methods 10(28), pp. 3444-3454. DOI: 10.1039 / C8AY00812D.

[0197] Madic, Jordan; Jovelet, Cécile; Lopez, Julien; André, Barbara; Fatien, Jean; Miran, Isabelle, et al. (2018): EGFR C797S, EGFR T790M and EGFR sensitizing mutations in non-small cell lung cancer revealed by six-color crystal digital PCR. In: Oncotarget 9(100), pp.37393-37406. DOI:10.18632 / oncotarget.26446.

[0198] Milbury, Coren A.; Zhong, Qun; Lin, Jesse; Williams, Miguel; Olson, Jeff; Link, Darren R.; Hutchison, Brian (2014): Determining lower limits of detection of digital PCR assays for cancer-related gene mutations. In: Biomolecular detection and quantification 1(1), pp. 8-22. DOI: 10.1016 / j.bdq.2014.08.001.

[0199] Pecoraro S.,Berben G.,Burns M.,Corbisier P.,De Giacomo M.,De LooseM.,Dagand E.,Dob-nik ​​D.,Eriksson R.,Holst-Jensen A.,Kagkli DM,Kreysa J.,Lievens A., D., Mazzara M., Paternò A., Peterseil V., Savini C., Sovová T., Sowa S., Spilsberg B.: Overview and recommendations for the application of digital PCR. JRC Technical Report. Luxembourg: Publications Office of the European Union, 2019 (2019). Available online at https: / / publications.jrc.ec.europa.eu / repository / handle / JRC115736.

[0200] Schlenker, Franziska; Kipf, Elena; Borst, Nadine; Hutzenlaub, Tobias; Zengerle, Roland; Stetten, Felix von; Juelg, Peter (2021a): Virtual Fluorescence Color Channels by Selective Photobleaching in Digital PCR Applied to the Quantification of KRAS Point Mutations. In: Analytical chemistry 93(30), pp.10538-10545. DOI:10.1021 / acs.analchem.1c01488.

[0201] Schlenker, Franziska; Kipf, Elena; Deuter, Max; Inga; Lehnert, Michael; Zengerle, Roland, et al. (2021b): Stringent Base Specific and Optimization-Free Multiplex Mediator Probe ddPCR for the Quantification of Point Mutations in Circulating Tumor DNA. In: Cancers 13(22). DOI: 10.3390 / cancers13225742.

[0202] Schuler, Friedrich; Trotter, Martin; Zengerle, Roland; Stetten, Felix von (2016): Monochrome Multiplexing in Polymerase Chain Reaction by Photobleaching of Fluorogenic Hydrolysis Probes. In: Analytical chemistry 88(5), pp. 2590-2595. DOI: 10.1021 / acs.analchem.5b02960.

[0203] Stilla Technologies: High multiplex, ultrasensitive EGFR detection using the EGFR6-color Crystal Digital PCR TM kit.Stilla Technologies).Available online at https: / / www.stillatechnologies.com / wp-content / uploads / 2021 / 12 / StillaTechnologies-6-color-EGFR-kit-App-Note.pdf.

[0204] Whale, Alexandra S.; Huggett, Jim F.; Tzonev, Svilen (2016): Fundamentals of multiplexing with digital PCR. In: Biomolecular detection and quantification 10, pp. 15-23. DOI: 10.1016 / j.bdq.2016.05.002.

Claims

1. A method for detecting at least two nucleic acid target sequences in the same detection channel by at least two target sequence independent reporter molecules, comprising the following steps: a. providing at least a first nucleic acid target sequence and a second nucleic acid target sequence, b. providing at least a first intermediate probe and a second intermediate probe, each intermediate probe comprising an oligonucleotide, wherein the oligonucleotide of the first mediator probe comprises a mediator sequence and a probe sequence, wherein the mediator sequence has an affinity for a first type of target sequence-independent reporter molecule, and the probe sequence exhibits an affinity for a first nucleic acid target sequence, wherein the oligonucleotide of the second mediator probe comprises a mediator sequence and a probe sequence, wherein the mediator sequence has affinity for a second type of target sequence-independent reporter molecule, and the probe sequence exhibits affinity for a second nucleic acid target sequence, wherein the at least first intermediate probe and the second intermediate probe have no signal generating label, c. providing at least two target sequence-independent reporter molecules of at least a first type and a second type, each reporter molecule comprising at least one label having a measurable signal in the same detection channel, and a nucleic acid sequence having a specific affinity for at least one intermediary sequence, wherein each type of at least two target-independent reporter molecules is characterized by at least one label such that it has a signal intensity that is distinguishable from the signal intensities of the labels of all other target-independent reporter molecule types and can be directly assigned to the respective nucleic acid target sequence, d. performing a nucleic acid detection reaction, wherein when the probe sequence of at least the first mediator probe binds to at least the first nucleic acid target sequence, at least one mediator sequence of at least the first mediator probe is released, wherein at least one released mediator sequence is bound to at least one first type of target sequence-independent reporter molecule, wherein at least one label generates a signal that is characteristic of a first nucleic acid target sequence due to its signal intensity and / or emission spectrum, said first nucleic acid target sequence being assigned to a respective target sequence-independent reporter molecule, and wherein at least one probe sequence of at least one first mediator probe has been bound to said respective target sequence-independent reporter molecule, e. Detecting the signal generated in step d., comprising detecting the signal in the detection channel and / or analyzing the signal, the signal intensity and / or the emission spectrum of the signal.

2. The method according to claim 1, wherein: The at least one label of the target sequence independent reporter molecule is at least one fluorophore and / or at least one quencher.

3. A method according to any one of the preceding claims, wherein: The analysis of the signal, signal intensity and / or emission spectrum of the signal in step e. comprises representing and / or analyzing the detected signal according to the signal intensity and / or detection channel and / or emission spectrum in the data space spanned by the evaluated detection channels.

4. A method according to any one of the preceding claims, wherein: Different target-independent reporter types differ in the signal intensity and / or emission spectrum of at least one of their labels.

5. A method according to any one of the preceding claims, wherein: At least one label of the target sequence-independent reporter molecule comprises at least two fluorophores and / or two quenchers having the same or different emission spectra and / or the same or different signal intensities.

6. A method according to any one of the preceding claims, wherein: The at least one label of the target sequence-independent reporter molecule comprises at least one fluorophore and at least one quencher, Therein, contact quenching preferably occurs between at least one fluorophore and at least one quencher as long as no mediator sequence is bound to the corresponding target sequence-independent reporter molecule, or as long as the bound mediator sequence is not extended during the nucleic acid detection reaction.

7. A method according to any one of the preceding claims, wherein: The label of at least one target sequence independent reporter molecule includes at least two complementary opposing nucleobases, each nucleobase having at least one label, or at least two opposing bases offset by one base position from a complementary base pair, each base pair having at least one label.

8. A method according to any one of the preceding claims, wherein: In steps d.-e., n different nucleic acid target sequences are indirectly detected by n different target sequence-independent reporter molecule types, wherein the detection of the signal generated in step d. is performed in k detection channels, where n>k and n≥2, and Therein, at least two different target sequence-independent reporter molecule types are detected in the same detection channel in step e. and / or are represented in the same region of the data space in the representation under step e..

9. A method according to any one of the preceding claims, wherein: The signal of the label of the target sequence-independent reporter molecule is generated by cleavage and / or separation of the target sequence-independent reporter molecule and / or by spatial separation of at least one fluorophore and at least one quencher.

10. A method according to any one of the preceding claims, wherein: The target-independent reporter molecule is an oligonucleotide or an oligonucleotide complex.

11. A method according to any one of the preceding claims, wherein: The nucleic acid detection reaction in step d. includes a DNA and / or cDNA amplification method.

12. The method according to the preceding claim, wherein: The nucleic acid detection reaction in step d. is PCR, RT-PCR, RPA or LAMP, and wherein, during the DNA amplification process, the mediator sequence of the mediator probe bound to the target nucleic acid is released by the enzymatic activity of the biological molecule, wherein the mediator probe then binds to the target sequence-independent reporter molecule to generate a signal.

13. The method according to any one of the two preceding claims, wherein: The detection in step e. is performed in the context of digital amplification and / or signal generation.

14. A method according to any one of the preceding claims, wherein: The target sequence independent reporter is a universal reporter and / or a modular reporter complex, and at least one released mediator sequence is a component of mediator probe PCR or mediator displacement LAMP.

15. A method according to any one of the preceding claims, wherein: At least one nucleic acid target sequence is generated by converting another biological molecule into DNA sequence information.

16. A kit for carrying out the method according to any one of the preceding claims, comprising: - at least one target sequence-independent reporter molecule of a first type comprising at least one label, - at least one second type of target sequence-independent reporter molecule comprising at least one label, - at least one first intermediary probe, the intermediary sequence of which has an affinity for at least one first type of target-independent reporter molecule and the oligonucleotide sequence of which exhibits an affinity for a first nucleic acid target sequence, - at least one second intermediary probe, the intermediary sequence of which has an affinity for at least one second type of target-independent reporter molecule and the oligonucleotide sequence of which exhibits an affinity for a second nucleic acid target sequence, - optionally, at least one buffer, - optionally, a polymerase, - optionally, a reverse transcriptase, - Optionally, at least one PCR primer.

Images