Salt-alkali tolerance-related transcription factor LcbZIP46 and its encoding gene and application

Abstract

The present invention discloses a salt-alkali tolerance-related transcription factor LcbZIP46 and its encoding gene and application. The salt-alkali tolerance-related transcription factor LcbZIP46, its amino acid sequence is shown in SEQ ID No.1. The encoding gene of the salt-alkali tolerance-related transcription factor LcbZIP46, its nucleotide sequence is shown in SEQ ID No.2. The present invention also includes a recombinant expression vector, an expression cassette, a transgenic cell line, a transgenic plant tissue, a transgenic plant organ or a recombinant bacterial cell containing the encoding gene of the salt-alkali tolerance-related transcription factor LcbZIP46. The LcbZIP46 protein provided by the present invention can regulate the ability of plants to resist salt-alkali stress, is induced by salt-alkali stress, can participate in the response of sheep grass to salt-alkali stress, improve the salt-alkali resistance of plants, and can be applied to the cultivation of new salt-alkali resistance varieties required for crops and important livestock grasses.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and specifically relates to a salt-alkali tolerance related transcription factor LcbZIP46 and a coding gene and application thereof. Background Art

[0002] There are 1 billion hm in the world 2 my country has the third largest area of ​​saline-alkali soil in the world, and the soda saline-alkali land in the Songnen Plain is one of the three largest distribution areas of soda saline soil in the world. With the changes in the global climate and the impact of human activities, the trend of land salinization is becoming increasingly severe. The salinized soil seriously restricts the growth and development of plants, causing crop yield reduction, limiting the development of agriculture and animal husbandry, and even affecting world food security. The exploration of salt-alkali tolerant plant germplasm resources and the study of salt-alkali tolerance mechanisms are of great significance to the breeding of plant salt-alkali tolerance.

[0003] Plant growth and development are adversely affected by adverse factors such as soil salinization. Plant cells perceive stress signals in the environment and, through signal transduction, show specific changes in physiology, metabolism, and gene expression, thereby producing stress resistance. Abscisic acid (ABA) is an important plant hormone that regulates plant growth and development and various abiotic stress responses. The ABA-dependent signal transduction pathway is the main signal transduction pathway for plants to respond to saline-alkali stress. The transmission of stress signals regulates stomatal opening, activates the binding of transcription factors to cis-acting elements in the promoter region of downstream target genes, and regulates the expression of downstream saline-alkali stress-related genes, thereby enhancing plant stress resistance. As a key endogenous stress messenger, abscisic acid participates in the response to a variety of biotic and abiotic stresses. Transcriptional expression studies on model plants Arabidopsis and rice have shown that 5-10% of the genes in the genome are regulated by ABA, drought, salinity, and low temperature stress, and more than half of the genes are shared by ABA, drought, and salt stress responses.

[0004] When most bZIP genes are induced to express under abiotic stress conditions, some of them play a negative regulatory role in the response to the stress environment, while others can act as positive regulatory factors to participate in the plant's response to stress. bZIP transcription factors can bind to cis-acting elements such as ABRE and G-box (CACGTG) in the promoter region of downstream genes to regulate the expression of downstream genes, thereby participating in a variety of abiotic stresses such as salinity and drought.

[0005] As the dominant species of the original natural vegetation in the Songnen Plain, Leymus chinensis grows all year round in a saline-alkali soil environment containing salt ions such as Na+, Cl-, HCO3-, and CO32-. It has evolved strong salt-alkali tolerance and is rich in salt-alkali tolerance gene resources. It is of great significance to conduct research on the salt-alkali tolerance of Leymus chinensis germplasm resources. Mining the salt-alkali tolerance genes in Leymus chinensis and exploring its salt-alkali tolerance molecular mechanism can provide a technical basis for plant salt-alkali resistance genetic engineering breeding.

[0006] Domestic and foreign scholars have explored the adaptation mechanism and stress resistance mechanism of Leymus chinensis to abiotic stress from the perspective of molecular biology, and discovered many genes related to stress resistance. Previous studies have found that many transcription factors are involved in the response network of Leymus chinensis to abiotic stresses such as drought, salinity, and low temperature. Among them, the functions of Leymus chinensis WRKY, DREB, MADS-box, AP2 / ERF, MYB, and NAC transcription factors in abiotic stress response have been reported, but there are few reports on the study of bZIP family transcription factors in the regulation of Leymus chinensis salt-alkali stress resistance.

[0007] Therefore, there is an urgent need in the prior art for a Leymus chinensis bZIP transcription factor involved in salt-alkali stress response, a gene encoding the bZIP transcription factor, and an application thereof in cultivating transgenic plants with enhanced salt-alkali resistance. Summary of the invention

[0008] The purpose of the present invention is to overcome the shortcomings of the prior art and provide a salt-alkali tolerance related transcription factor LcbZIP46, a coding gene of the salt-alkali tolerance related transcription factor LcbZIP46, and the use of the transcription factor LcbZIP46 or its coding gene in cultivating transgenic plants with enhanced salt-alkali resistance.

[0009] The objective of the present invention is achieved through the following technical scheme: The present invention first excavates a transcription factor from the salt-alkali tolerant plant Leymus Chinensis (Trin.) Tzvel, which is strongly induced by salt-alkali stress, marked as LcbZIP46, and its amino acid sequence is shown in SEQ ID No. 1. The coding gene of the transcription factor LcbZIP46 related to salt-alkali tolerance, its nucleotide sequence is shown in SEQ ID No. 2.

[0010] In order to facilitate the purification and detection of the protein in the sequence SEQ ID No. 1, a specific tag antibody can be connected to the amino terminus or carboxyl terminus of the protein consisting of the amino acid sequence shown in SEQ ID No. 1.

[0011] The LcbZIP46 protein shown in SEQ ID No. 1 can be artificially synthesized, or its encoding gene can be synthesized first and then expressed biologically.

[0012] The gene encoding the LcbZIP46 protein in the sequence SEQ ID No.1 can be obtained by deleting one or several codons of amino acid residues in the DNA sequence of SEQ ID No.2, and / or performing missense mutation of one or several base pairs, and / or connecting the coding sequence at its 5′ end and / or 3′ end.

[0013] The present invention also relates to a nucleic acid molecule encoding the LcbZIP46 protein.

[0014] The present invention also relates to biological materials such as recombinant expression vectors, expression cassettes, transgenic cell lines, transgenic plant tissues, transgenic plant organs or recombinant bacteria containing the nucleic acid molecules.

[0015] In the above biological material, the nucleic acid molecule may be the following b1), b2), b3) or b4):

[0016] b1) The coding sequence is a cDNA molecule or a DNA molecule of SEQ ID No. 2 in the sequence list;

[0017] b2) the nucleotide sequence is a cDNA molecule or a DNA molecule of sequence SEQ ID No. 2 in the sequence list;

[0018] b3) a cDNA molecule or genomic DNA molecule that has a homology of more than 94.54% with the nucleotide sequence defined in b1) or b2) and encodes LcbZIP46;

[0019] b4) a cDNA molecule or genomic DNA molecule that hybridizes with the nucleotide sequence defined in b1) or b2) under stringent conditions and encodes LcbZIP46.

[0020] The nucleic acid molecule may be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule may also be RNA, such as mRNA or hnRNA.

[0021] A person skilled in the art can easily mutate the nucleotide sequence encoding the LcbZIP46 protein of the present invention by using known methods, such as directed evolution and point mutation. Those artificially modified nucleotides having a higher homology of 94.54% with the nucleotide sequence of the LcbZIP46 protein isolated from the present invention are derived from the nucleotide sequence of the present invention and are equivalent to the sequence of the present invention as long as they encode the LcbZIP46 protein and have the function of the LcbZIP46 protein.

[0022] The invention also relates to the application of the transcription factor LcbZIP46 or the coding gene in cultivating the transgenic plants with enhanced salt-alkali resistance.

[0023] The plant is Arabidopsis thaliana or rice.

[0024] The present invention also relates to the use of a recombinant expression vector, an expression cassette, a transgenic cell line, a transgenic plant tissue, a transgenic plant organ or a recombinant bacterial cell containing a gene encoding a transcription factor LcbZIP46 related to salt-alkali resistance in cultivating transgenic plants with enhanced salt-alkali resistance.

[0025] In the above application, the recombinant expression vector can be a plasmid, a cosmid, a phage or a viral vector. The recombinant expression vector can be specifically pHB-LcbZIP46, pBWA(V)HS-LcbZIP46-3×flag or pBWA(V)HS-LcbZIP46-Glosgfp, wherein the pHB-LcbZIP46 is a recombinant vector obtained by replacing the DNA fragment between the HindIII and BamHI recognition sequences of pHB with the DNA fragment shown in the sequence SEQ ID No.2, and the pHB-LcbZIP46 can express the LcbZIP46 protein shown in the sequence SEQ ID No.1; the pBWA(V)HS-LcbZIP46-3×flag or pBWA(V)HS-LcbZIP46-Glosgfp is a recombinant vector obtained by replacing the DNA fragment between the BsaI and Eco31I recognition sequences of the pBWA(V)HS vector with the DNA fragment shown in the sequence SEQ The DNA fragment shown in IDNo.2 is connected to a recombinant vector obtained by connecting a 3×flag tag or a Glosgfp tag. The pBWA(V)HS-LcbZIP46-3×flag can express a fusion protein of LcbZIP46 fused to a 3×flag tag, and the pBWA(V)HS-LcbZIP46-Glosgfp can express a fusion protein of LcbZIP46 fused to a GFP tag.

[0026] The expression cassette (LcbZIP46 gene expression cassette) containing the nucleic acid molecule encoding the LcbZIP46 protein described in the above application refers to a DNA capable of expressing the LcbZIP46 protein in a host cell, and the DNA may include not only a promoter for initiating transcription of the LcbZIP46 gene, but also a terminator for terminating transcription of the LcbZIP46 gene. Further, the expression cassette may also include an enhancer sequence, such as a translation enhancer or a transcription enhancer, and these enhancer regions may be ATG start codons or adjacent region start codons, etc., but must be the same as the reading frame of the coding sequence to ensure the correct translation of the entire sequence. The sources of the translation control signal and the start codon are extensive, and may be natural or synthetic. The translation initiation region may come from a transcription initiation region or a structural gene. In order to facilitate the identification and screening of transgenic plant cells or plants, the plant expression vector used may be processed, such as adding genes for enzymes or luminescent compounds that can produce color changes in plants, antibiotic markers with resistance, or chemical resistance marker genes, etc. Considering the safety of transgenic plants, no selective marker genes need to be added and transformed plants can be directly screened by phenotype.

[0027] Promoters that can be used in the present invention include, but are not limited to, constitutive promoters, tissue, organ and development-specific promoters, and inducible promoters. Existing expression vectors can be used to construct a recombinant vector containing the LcbZIP46 gene expression cassette. The plant expression vector includes a binary Agrobacterium vector and a vector that can be used for gene gun technique. The plant expression vector may also contain the 3′ non-translated region of the foreign gene, i.e., a polyadenylation signal and any other DNA fragments involved in mRNA processing or gene expression.

[0028] In the above application, the microorganism can be yeast, bacteria, algae or fungi. Among them, the bacteria can be Agrobacterium or Escherichia coli, such as Agrobacterium EHA105, GV3101, Escherichia coli DH5α, BL21 (DE3).

[0029] The recombinant expression vector can be introduced into plant cells by conventional biotechnology methods such as Ti plasmid, plant virus vector, direct DNA transformation, microinjection, and electroporation.

[0030] In the above applications, the transgenic plant cell lines, transgenic plant tissues and transgenic plant organs do not include propagation materials.

[0031] The invention relates to a plant salt-alkali resistance product, which contains LcbZIP46 or the biological material.

[0032] The plant salt-alkali resistance product can have LcbZIP46 or the biological material as its active ingredient, and LcbZIP46 or the biological material can also be used together with other substances with plant salt-alkali resistance effects as its active ingredients.

[0033] The present invention also provides any of the following applications of LcbZIP46 or the biomaterial:

[0034] C1) Application in regulating plant resistance to salt and alkali;

[0035] C2) Application in the preparation of products for regulating plant salt-alkali resistance;

[0036] C3) Application in improving the salt-alkali resistance of plants;

[0037] C4) Application in the preparation of products for improving plant resistance to salt and alkali;

[0038] C5) Application in breeding plants with enhanced salt and alkali resistance.

[0039] The application of the present invention in cultivating transgenic plants with enhanced salt-alkali resistance includes: increasing the activity of LcbZIP46 in the target plant, increasing the content of LcbZIP46 in the target plant or promoting the expression of the coding gene of LcbZIP46 to obtain salt-alkali resistant plants with enhanced salt-alkali resistance compared with the target plant.

[0040] In the above method, the salt-alkali resistant plant is obtained by introducing the coding gene of LcbZIP46 into the target plant.

[0041] The plant may be a monocot or a dicot. The dicot may be Arabidopsis thaliana, such as Arabidopsis thaliana of the Columbia ecotype (Col-0). The monocot may be rice, such as Nipponbare rice.

[0042] The gene encoding LcbZIP46 may be the nucleic acid molecule.

[0043] The LcbZIP46 encoding gene can be modified as follows before being introduced into the target plant to achieve a better expression effect:

[0044] 1) Modify and optimize according to actual needs to achieve efficient gene expression; for example, according to the codons preferred by the target plant, the codons of the gene encoding LcbZIP46 of the present invention can be changed while maintaining the amino acid sequence to meet the plant preference;

[0045] 2) Modifying the gene sequence adjacent to the initiation methionine to allow efficient initiation of translation; for example, using a sequence known to be effective in plants;

[0046] 3) Connected to various plant-expressed promoters to facilitate their expression in plants; the promoters may include constitutive, inducible, temporally regulated, developmentally regulated, chemically regulated, tissue-preferred and tissue-specific promoters; the choice of promoter will vary with the temporal and spatial requirements of expression, and also depends on the target species; for example, a tissue or organ-specific expression promoter, depending on the stage of development at which the receptor is required; although it has been demonstrated that many promoters derived from dicotyledons can function in monocotyledons and vice versa, ideally, dicotyledon promoters are selected for expression in dicotyledons, and monocotyledon promoters are selected for expression in monocotyledons;

[0047] 4) Connecting with a suitable transcription terminator can also improve the expression efficiency of the gene of the present invention; any available terminator known to work in plants can be connected with the gene of the present invention;

[0048] Said salt-alkali resistant plants are understood to include not only the first generation transgenic plants obtained by transforming the coding gene of LcbZIP46 into the target plant, but also its progeny. For transgenic plants, the gene can be propagated in the species, and the gene can also be transferred into other varieties of the same species by conventional breeding techniques, especially including commercial varieties. Said salt-alkali resistant plants include seeds, callus, complete plants and cells.

[0049] In the present invention, the above salt-alkali resistance can be embodied as resistance to 30mM NaCl+3mM NaHCO3, 50mM NaCl+5mM NaHCO3, and 70mM NaCl+7mM NaHCO3 stress treatments.

[0050] The beneficial effects of the present invention are as follows: the LcbZIP46 protein provided by the present invention can regulate the ability of plants to resist salt-alkali stress, is induced by salt-alkali stress, can participate in the response of sheep grass to salt-alkali stress, and improves the salt-alkali resistance of plants. LcbZIP46 and its encoding gene can be used for the cultivation of new salt-alkali resistant varieties required for crops and important livestock grasses. BRIEF DESCRIPTION OF THE DRAWINGS

[0051] Figure 1 This is the agarose gel electrophoresis image of total RNA from Leymus chinensis in West Ujimqin;

[0052] Figure 2 This is the agarose gel electrophoresis image of the PCR amplification product of the LcbZIP46 gene in Xiwuzhumuqin Leymus;

[0053] Figure 3 is the relative expression analysis of LcbZIP46 gene in Leymus chinensis under saline-alkali stress conditions;

[0054] Figure 4is the expression analysis of LcbZIP46 gene in different tissues of Leymus chinensis;

[0055] Figure 5 This is a laser confocal / TIRF microscopy image of the pBWA(V)HS- -Glosgfp empty vector transiently expressed in wheat protoplasts;

[0056] Figure 6 This is a laser confocal / TIRF microscopy image of the pBWA(V)HS-LcbZIP46-Glosgfp fusion expression vector transiently expressed in wheat protoplasts;

[0057] Figure 7 This is the PCR test result of Arabidopsis plants transgenic for LcbZIP46 gene;

[0058] Figure 8 This is the PCR test result of the transgenic rice plant with LcbZIP46 gene;

[0059] Fig. 9 This is the result of the salt-alkaline resistance test of the T3 generation of LcbZIP46 gene-transfected Arabidopsis during the germination period;

[0060] Fig.10 The results of the root growth experiment of the T3 generation transgenic Arabidopsis thaliana strains with LcbZIP46 gene and wild-type Arabidopsis thaliana under saline-alkali stress;

[0061] Fig.11 These are the results of the root length experiment of T3 generation transgenic LcbZIP46 rice lines and wild-type rice under saline-alkali stress. DETAILED DESCRIPTION

[0062] The present invention is described in detail below with reference to the accompanying drawings.

[0063] The present invention provides a kind of Leymus chinensis The salt-alkali resistance-related transcription factor of the (Trin.) Tzvel.) variety of Xiwuzhumuqin Leymus chinensis is named LcbZIP46, and its amino acid sequence is shown in SEQ ID No. 1. The coding gene sequence of the salt-alkali resistance-related transcription factor LcbZIP46 is shown in SEQ ID No. 2.

[0064] The quantitative tests in the following examples of the present invention were repeated three times, and the results were averaged. In the following examples, unless otherwise specified, the first position of each nucleotide sequence in the sequence table is the 5' terminal nucleotide of the corresponding DNA, and the last position is the 3' terminal nucleotide of the corresponding DNA.

[0065] Example 1 Cloning of the LcbZIP46 gene of Leymus chinensis and obtaining its CDS sequence

[0066] 1. Treat the three-leaf stage Leymus chinensis seedlings with a mixed solution of 100mM NaCl and 200mM NaHCO3 for 2h. Take the young leaves of the stressed Leymus chinensis plants, freeze them in liquid nitrogen immediately, and store them at -80℃ for later use.

[0067] 2. The total RNA of the young leaves of the Leymus chinensis plants in step 1 was extracted using the TRIzol method. The quality of the total RNA was tested using 0.8% agarose gel electrophoresis. The results are as follows: Figure 1 As shown, RNA showed two obvious electrophoresis bands, 28S RNA and 18S RNA from top to bottom. The results showed that a relatively high purity and complete total RNA was obtained.

[0068] 3. Use Tiangen's Fast King RT Mix reagent to synthesize cDNA: Take 2μg of the total RNA extracted in step 2 as a template, add 4μL of 5×Fast King RT Mix, and add ddH2O to 20μL. The reverse transcription reaction conditions are: 42℃, 15min; 95℃, 3min (enzyme inactivation).

[0069] 4. Using the cDNA obtained in step 3 as a template, perform PCR amplification using Q5 enzyme. The amplification reaction system is shown in Table 3-1, and the reaction procedure is shown in Table 3-2. The PCR amplification product is tested by 1.2% agarose gel electrophoresis. The results are as follows: Figure 2 As shown, the primers used are as follows:

[0070] LcbZIP46cds-F: ATGGAGATGCCGGGAGGGAGC (as shown in SEQ ID No. 3)

[0071] LcbZIP46 cds-R: CTAAACTGGAAGTGTCAGATCACATCAACGAATAAAGTACAACAT (as shown in SEQ ID No. 4)

[0072] Table 3-1 PCR amplification reaction system

[0073] Component Volume (μL) <![CDATA[ddH2O]]> 16.25 5× Q5 reaction buffer 5 Q5 High-Fidelity DNA Polymerase 0.25 Primer (+) (10 μM) 1.25 Primer (-)(10μM) 1.25 Template DNA 1 Total volume 25

[0074] Table 3-2 PCR amplification reaction procedure

[0075] Temperature Time Cycles 98℃ 30 sec 1 98℃ 5-10 sec 30 50℃ 10-30 sec 30 72℃ 30 sec 30 72℃ 2 min 1 10℃ 30 min 1

[0076] 5. Use Tiangen's DNA gel recovery kit to recover the target fragment. The full-length cDNA of LcbZIP46 was successfully amplified.

[0077] 6. The target fragment obtained by the above amplification was connected to DH5α competent cells using Sangon's zero background TOPO Blunt blunt end cloning kit. The positive monoclonal strain was selected for sequencing to confirm the CDS sequence of the LcbZIP46 gene.

[0078] Example 2 Analysis of the expression of LcbZIP46 gene in Leymus chinensis under stress conditions and tissue specificity

[0079] 1. Expression analysis under stress conditions

[0080] The seeds of Xiwuzhumuqin Leymus chinensis germinated in the culture room until the three-leaf stage, and the seedlings were treated with a mixed solution of 100mM NaCl and 200mM NaHCO3 for saline-alkali stress; the treatment time was set to seven gradients: 0h (CK), 2h, 6h, 12h, 24h, 48h, and 72h. The young leaves of the stressed Leymus chinensis plants were taken to extract total RNA, and the expression pattern of the LcbZIP46 gene was analyzed by qRT-PCR using the Leymus chinensis Actin gene as an internal reference using the SangonBiotech 2×SG Fast qPCR Master Mix (Low Rox) kit, and 2 -ΔΔCt The relative expression of genes was calculated by Figure 3 As shown in the figure (the expression level of LcbZIP46 gene at 0h was set as 1), LcbZIP46 gene was induced by saline-alkali stress, and the transcription level increased sharply after 2h of stress. As the stress time prolonged, the expression level of LcbZIP46 fell back to normal level after 6h of stress, indicating that LcbZIP46 was significantly induced in the early stage of saline-alkali stress. The primers used are as follows:

[0081] LcbZIP46-qF: TCAGGGCAATGTGGTCGC (shown in SEQ IDNo.5)

[0082] LcbZIP46-qR: TCTTCCCAAACCCATTCAGC (as shown in SEQ ID No. 6)

[0083] LcActin-F:TGTCAGCCATACTGTGCCAATC (as shown in SEQ ID No. 7)

[0084] LcActin-R: CCCGTTCAGCAGTCGTGGT (as shown in SEQ ID No. 8)

[0085] 2. Tissue-specific expression analysis

[0086] The roots, rhizomes, stems, leaves, leaf sheaths, flag leaves, and panicle tissues of two-year-old Xiwuzhumuqin Leymus chinensis plants at the initial flowering stage were collected to extract total RNA, and the tissue-specific expression of LcbZIP46 was analyzed by qRT-PCR. Figure 4 As shown (the expression level of LcbZIP46 gene in the root was set to 1), the expression levels of LcbZIP46 in various tissues of Leymus chinensis were different, and the highest expression level was in the panicle.

[0087] Example 3 Subcellular localization of LcbZIP46 gene

[0088] 1. Using the correctly sequenced positive clone plasmid obtained in Example 1 as a template, the ORF region of LcbZIP46 was amplified using the following primers:

[0089] LcbZIP46-GFP-F: atttggagagaacacgggggactttgcaacatggagatgccgggagggagcgggg (as shown in SEQ ID No. 9)

[0090] LcbZIP46-GFP-R: ggaaccactccctgaagcggccgctgtacaccatggacccgtcagtgttcgtcgc (as shown in SEQ IDNo.10)

[0091] The PCR amplification reaction system is shown in Table 3-3, and the reaction procedure is shown in Table 3-4.

[0092] Table 3-3 PCR amplification reaction system

[0093] Component Volume (μL) <![CDATA[ddH2O]]> 20 PCR Mix 25 Primer (+) (10 μM) 2 Primer (-)(10μM) 2 Template DNA 1 Total volume 50

[0094] Table 3-4 PCR amplification reaction procedure

[0095] Temperature Time Cycles 94℃ 5 min 1 94℃ 30 sec 30 50℃ 45 sec 30 72℃ 62 sec 30 72℃ 10 min 1 16℃ 30 min 1

[0096] The PCR product was electrophoresed on a 1% agarose gel at 5 v / cm for 20 minutes. The electrophoresed fragment of LcbZIP46 was cut under UV light and recovered using the Tiangen DNA gel recovery kit. For details, see the manufacturer's kit instructions. The recovered DNA was dissolved in a total volume of 40 μL of sterile water and used for vector recombination after testing.

[0097] 2. Connect the recovered product containing the LcbZIP46 gene shown in SEQ ID No. 2 to the pBWA(V)HS vector containing GFP (Greenfluorescence protein), and digest it with BsaI / Eco31I. Purify the vector digestion product and the recovered fragment digestion product together with a PCR purification kit. Digest at 37°C for 1h according to the digestion and connection system shown in Table 3-5. Purify the vector digestion product with a PCR purification kit (the purified product is marked as GFP (D)), reconstitute at 37°C for 30h according to the reaction system in Table 3-6, and transform the ligation product into competent cells.

[0098] Table 3-5 Vector restriction endonuclease PCR reaction system

[0099] Component Volume (μL) <![CDATA[ddH2O]]> 13 10×Buffer 2 BsaI / Eco31I 1 pBWA(V)HS-ccdb-Glosgfp 4 Total volume 20

[0100] Table 3-6 Recombinant PCR reaction system

[0101] Component Volume (μL) 2×EasyClone Mix 10 PCR recovery product 5 GFP(D) 5 Total volume 20

[0102] 3. Transform 5-10 μL of the ligation product into competent cells, transfer to a kanamycin-containing resistance plate, and culture at 37°C for 12 hours. Pick 10 plaques for colony PCR identification. Identification primers: HS)35seq, NOSseq-R. Sequence the bacterial solution corresponding to the three positive bands and extract the target plasmid. The PCR identification reaction system is shown in Table 3-7, and the reaction procedure is shown in Table 3-8.

[0103] Table 3-7 Colony PCR reaction system

[0104] Component Volume (μL) <![CDATA[ddH2O]]> 9.5 PCR Mix 12.5 HS)35seq (10μM) 1 NOSseq-R (10 μM) 1 Template 1 Total 25

[0105] Table 3-8 Colony PCR reaction procedure

[0106] Temperature Time Cycles 94℃ 5 min 1 94℃ 30 sec 30 50℃ 45 sec 30 72℃ 62 sec 30 72℃ 10 min 1 16℃ 30 min 1

[0107] 4. The obtained recombinant expression vector with the correct sequence was named pBWA(V)HS-LcbZIP46-Glosgfp. According to the analysis of homologous protein sequences in LcbZIP46 and other Gramineae species, it was found that Leymus chinensis has the closest genetic relationship with wheat and is a wild relative of wheat. Therefore, the constructed GFP fusion vector was transiently expressed in wheat protoplasts. At the same time, wheat protoplasts transferred with the pBWA(V)HS- -Glosgfp empty vector were used as controls. GFP fluorescence was detected using a laser confocal microscope. The specific steps are as follows:

[0108] Take the leaves of wheat seedlings grown for 7-10 days, cut them into small pieces of about 1mm, add 5-10mL of enzyme solution, and let them stand for 4 hours at 24℃; filter them with a 40μm filter, centrifuge them at 300rpm for 3min, and remove the supernatant; wash them twice with 10mL of pre-cooled W5 solution, centrifuge them at 4℃, 300rpm for 3min; add 500μL of MMG solution as needed to suspend them. Under a 40x microscope, there are 20-40 complete protoplasts in each field of view. Take 100μL of protoplast suspension + 10 μL DNA (more than 500ng of purified pBWA(V)HS-LcbZIP46-Glosgfp vector plasmid), take PEG-4000 solution (110 μL) equal to the sum of the volume of DNA and protoplasts, and mix them gently and evenly; dilute with 1mL of W5 to terminate the reaction, centrifuge at 300rpm for 3min to collect the protoplasts, and remove the supernatant; add 1mL of W5 to wash 1-2 times. Finally, 1 mL of W5 solution was added and cultured at 24°C for 18-24 h. The supernatant was removed, leaving only 100 μL of protoplasts, and GFP fluorescence was detected using a laser confocal microscope.

[0109] The results are as follows Figure 5 , Figure 6 shown. Figure 5 This is a laser confocal / TIRF microscopy image of the pBWA(V)HS- -Glosgfp empty vector transiently expressed in wheat protoplasts. Figure 5 In the figure, (a) is the wheat protoplast under the fluorescence channel, (b) is the wheat protoplast under the chloroplast fluorescence channel, (c) is the wheat protoplast under the bright field, and (d) is the overlay of a, b, and c. Figure 5 (a) The green fluorescence produced by the fusion of the empty vector and the GFP fluorescent protein can be observed to be distributed in the cytoplasm and the nucleus; Figure 5 (b) Red fluorescence signals can be observed from chloroplasts; Figure 5 (c) Bright field image shows the overall morphology and structure of wheat protoplasts, including the nucleus, cytoplasm, and cell membrane, but no fluorescent signal; Figure 5 (d) After superimposing the fluorescence channel with the bright field image, one can simultaneously see the morphological structure of the protoplasts and the fluorescent signal after the fluorescent protein fusion diffusely distributed in the cells.

[0110] Figure 6 This is a laser confocal / TIRF microscopy image of the pBWA(V)HS-LcbZIP46-Glosgfp fusion expression vector transiently expressed in wheat protoplasts. Figure 6 In the figure, (a) is the wheat protoplast under the fluorescence channel, (b) is the wheat protoplast under the chloroplast fluorescence channel, (c) is the wheat protoplast under the bright field, and (d) is the superposition of a, b, and c. Figure 6(a) It can be seen that the green fluorescence emitted by the fusion of LcbZIP46 protein and GFP fluorescent protein is localized in the cell nucleus; Figure 6 (b) It can be seen that the chloroplasts emit red fluorescence signals under the chloroplast fluorescence channel; Figure 6 (c) Bright field image shows the overall morphology and structure of wheat protoplasts, including the nucleus, cytoplasm, and cell membrane, but no fluorescent signal; Figure 6 (d) After superimposing the fluorescence channel with the bright field image, the morphological structure of the protoplast and the fluorescence localization of the LcbZIP46 protein can be seen simultaneously, confirming that the LcbZIP46 protein is localized in the cell nucleus.

[0111] In summary, the protein expressed in wheat protoplasts transformed with the empty vector pBWA(V)HS- -Glosgfp was distributed throughout the cell, while the protein expressed in wheat protoplasts transformed with the recombinant expression vector pBWA(V)HS-LcbZIP46-Glosgfp was specifically localized in the nucleus. This result indicates that the LcbZIP46 protein is localized in the nucleus of wheat protoplasts.

[0112] Example 4 Obtaining Arabidopsis thaliana transgenic with LcbZIP46 gene and testing its salt-alkaline resistance

[0113] 1. Construction of expression vector pHB-LcbZIP46

[0114] The DNA fragment between the HindIII and BamHI recognition sequences of the plant genetic transformation vector pHB was replaced with the LcbZIP46 gene shown in sequence 2 by enzyme ligation. The obtained recombinant expression vector with the correct sequence was named pHB-LcbZIP46. The primers used are as follows:

[0115] pHB-LcbZIP46-F:ACCAGTCTCTCTCTCAAGCTTATGGAGATGCCGGGAGGGAG (as shown in SEQ ID No. 11)

[0116] pHB-LcbZIP46-R: GCTCCTGCAGCTCGAGGATCCCTACCATGGACCCGTCAGTG (as shown in SEQ ID No. 12)

[0117] 2. Obtaining transgenic Arabidopsis plants carrying the LcbZIP46 gene

[0118] The recombinant plasmid pHB-LcbZIP46 was introduced into Agrobacterium tumefaciens GV3101, and the Columbia ecotype (Col-0) Arabidopsis was transformed by the Agrobacterium-mediated floral dip method. Hygromycin resistance screening was performed, and transgenic Arabidopsis T1 seeds with hygromycin resistance were collected and cultured on a medium plate containing hygromycin. After 20 days, positive seedlings were identified by PCR. A total of 15 transgenic plants were obtained, and 10 positive strains were detected, marked as oe1, oe2, oe3, oe4, oe5, oe6, oe7, oe9, oe10 and oe15. The reaction system is shown in Table 3-9, and the reaction procedure is shown in Table 3-10. The results are shown in Figure 7 , Lane M is a marker, Lane Col-0 represents the non-transgenic wild-type Arabidopsis thaliana (Columbia) plant control, and Lanes 1, 2, 3, 4, 5, 6, 7, 9, 10, and 15 represent pHB-LcbZIP46 transgenic lines oe1, oe2, oe3, oe4, oe5, oe6, oe7, oe9, oe10, and oe15, respectively. The identification primers are as follows:

[0119] HPT-F: GGTCGCGGAGGCTATGGATGC (as shown in SEQ ID No. 13)

[0120] HPT-R: GCTTCTGCGGGCGATTTGTGT (as shown in SEQ ID No. 14)

[0121] Table 3-9 PCR reaction system for detecting transgenic Arabidopsis positive seedlings

[0122] Component Volume (μL) ddH2O 7.2 2×Taq Mix 10 Primer (+) (10 μM) 0.4 Primer (-)(10μM) 0.4 Template DNA 2 Total volume 20

[0123] Table 3-10 PCR reaction procedure for transgenic Arabidopsis positive seedling detection

[0124] Temperature Time Cycles 94℃ 3 min 1 94℃ 30 sec 35 55℃ 30 sec 35 72℃ 1 min 35 72℃ 5 min 1

[0125] Select healthy and consistent positive seedlings for sub-generation and seed propagation. Select the strains with a survival rate of 3:1 selected by antibiotic screening in the T2 generation and continue to propagate to obtain T3 generation seeds for subsequent verification tests.

[0126] 3. Salt-alkali resistance test of T3 transgenic Arabidopsis thaliana carrying LcbZIP46 gene

[0127] Leaves of wild-type Arabidopsis thaliana (Col-0) and T3 plants of different transgenic Arabidopsis thaliana lines with consistent growth were selected, RNA was extracted and then cDNA was synthesized. The expression level of LcbZIP46 gene in different transgenic lines was detected by qRT-PCR using AtActin gene as internal reference gene.

[0128] The sterilized wild-type Arabidopsis seeds (Col-0) and seeds of two T3 transgenic Arabidopsis lines with higher expression levels (oe2, oe10) were sown on 1 / 2MS (basic medium) solid medium containing different concentrations of saline-alkali mixed solutions (30mM NaCl+3mM NaHCO3; 50mMNaCl+5mM NaHCO3; 70mM NaCl+7mM NaHCO3), and the 1 / 2MS solid medium without stress treatment was used as the control. After vernalization at 4℃ for 2 days, they were cultured in a light incubator for 7 days, and their growth was observed and the germination rate was calculated. The PCR detection results of the LcbZIP46 gene-transfected rice plants are shown in Figure 2. Figure 8 As shown, lane WT represents the wild-type rice plant control without transgenic genes, and the other lanes represent different pBWA(V)HS-LcbZIP46-3×flag transgenic lines. With the increase of saline-alkali stress concentration, the germination rate of transgenic lines and wild-type plants decreased sharply, but the germination rate of transgenic lines was still significantly higher than that of wild-type plants. When the saline-alkali stress concentration reached 70mM NaCl+7mM NaHCO3, the germination rate of wild-type was only 9.2%, while the germination rate of transgenic lines could still maintain 18.1% and 27.3%, indicating that the salt-alkali resistance of LcbZIP46 gene transgenic lines was significantly improved compared with wild-type Arabidopsis.

[0129] Arabidopsis wild-type and transgenic seeds were sown on a saline-alkali mixed solution (30 mM NaCl + 3 mM NaHCO3) and an untreated 1 / 2MS solid culture medium, respectively. After sealing with a sealing film and vernalization at 4°C for 2 days, the plates were placed vertically and cultured for 14 days. The taproot length was observed. The results are as follows: Fig. 9 , Fig.10 shown.

[0130] Fig. 9 The results of salt-alkali resistance test of T3 generation Arabidopsis transgenic with LcbZIP46 gene during germination period. Among them, (a) shows the germination of wild type (Col-0) and Arabidopsis transgenic with LcbZIP46 gene (oe2, oe10) before treatment; (b) shows the germination of wild type and Arabidopsis transgenic with LcbZIP46 gene under 30mM NaCl + 3mM NaHCO3 stress; (c) shows the germination of wild type and Arabidopsis transgenic with LcbZIP46 gene under 50mM NaCl + 5mM NaHCO3 stress; (d) shows the germination of wild type and Arabidopsis transgenic with LcbZIP46 gene under 70mM NaCl + 7mM NaHCO3 stress; (e) is the statistical graph of germination rate of wild type and Arabidopsis transgenic with LcbZIP46 gene under different concentrations of salt-alkali stress. Fig. 9As shown in (a) and 9 (e), when not subjected to stress treatment, there was no significant difference in the germination rate between wild-type Arabidopsis and transgenic Arabidopsis; Fig. 9 As shown in (b) and 9 (e), 30mM NaCl+3mM NaHCO3 mixed salt-alkali stress had no significant effect on the germination rate of transgenic lines and wild-type plants; Fig. 9 As shown in (c) and 9 (e), as the concentration of saline-alkali stress increased to 50mM NaCl+5mM NaHCO3, the germination rates of both transgenic lines and wild-type plants decreased dramatically, but the germination rate of transgenic lines was still significantly higher than that of wild-type plants; Fig. 9 As shown in (d) and (e), when the salt-alkali stress concentration reached 70mM / 7mM NaCl / NaHCO3, the germination rate of the wild type was only 9.2%, while the germination rate of the transgenic line could still be maintained at 18.1% and 27.3%, that is, the transgenic LcbZIP46 gene improved the salt-alkali tolerance of transgenic Arabidopsis seedlings.

[0131] Fig.10 The results of the root growth experiment of T3 generation Arabidopsis thaliana transgenic LcbZIP46 gene lines (oe2, oe10) and wild-type Arabidopsis thaliana (Col-0) under saline-alkali stress. Among them, (a) shows the root development of wild-type (Col-0) and Arabidopsis thaliana transgenic LcbZIP46 gene lines (oe2, oe10) without treatment; (b) shows the root development of wild-type and Arabidopsis thaliana transgenic LcbZIP46 gene lines under 30mM NaCl + 3mM NaHCO3 stress. Fig.10 As shown in (a), under normal growth conditions, there was no significant difference in root length between wild-type plants and transgenic Arabidopsis; Fig.10 (b) shows that under the treatment of 30mM NaCl + 3mMNaHCO3, the root growth of the wild-type plants was strongly inhibited and was significantly lower than the root length of the transgenic strains, indicating that the root length of the transgenic strains was less affected by salt-alkali stress, that is, the LcbZIP46 gene enhanced the salt-alkali tolerance of transgenic Arabidopsis seedlings.

[0132] Example 5 Obtaining LcbZIP46 transgenic rice and testing its salt-alkaline resistance

[0133] 1. Construction of expression vector pBWA(V)HS-LcbZIP46-3×flag

[0134] The DNA fragment between the BsaI and Eco31I recognition sequences of the plant expression vector pBWA(V)HS--3×flag connected to the 3×flag tag was replaced with the LcbZIP46 gene shown in sequence 2. The obtained recombinant expression vector with the correct sequence was named pBWA(V)HS-LcbZIP46-3×flag. The primers used are as follows:

[0135] LcbZIP46-flag-F: atttggagagaacacgggggactttgcaacatggagatgccgggagggagcgggg (as shown in SEQ IDNo.15)

[0136] LcbZIP46-flag-R: tttgtagtctccgtcgtggtctttgtaatcccatggacccgtcagtgttcgtcgc (as shown in SEQ IDNo.16)

[0137] 2. Obtaining transgenic rice plants carrying LcbZIP46 gene

[0138] The optimized Agrobacterium-mediated rice (japonica) genetic transformation method (SLAMET-LOEDIN et al, 2014; Liu Defang, 2019) was used to transfer the constructed vector plasmid into Agrobacterium EHA105 by electroporation. After rooting, the plants were cultured at 30°C for 7-10 days under light, and a total of 21 transgenic plants were obtained, marked as line1, line2, line3, line4, line5, line6, line7, line8, line9, line10, line11, line12, line13, line14, line15, line16, line17, line18, line19, line20 and line21. The CTAB method (POREBSKI et al, 1997) was used to extract rice genomic DNA, and PCR was performed to detect positive seedlings. The reaction system is shown in Table 3-11, the reaction procedure is shown in Table 3-12, and the results are shown in Table 3-13. Figure 8 , Lane M is a marker, Lane WT represents a non-transgenic wild-type rice plant control, and Lanes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, and 21 represent pBWA(V)HS-LcbZIP46-3×flag transgenic lines line 1, line 2, line 3, line 4, line 5, line 6, line 7, line 8, line 9, line 10, line 11, line 12, line 13, line 14, line 15, line 16, line 17, line 18, line 19, line 20, and line 21, respectively. The detection primers are as follows:

[0139] LcbZIP46-RF: cgatctactcgctcacgttc (as shown in SEQ ID No. 17)

[0140] LcbZIP46-RR: gcagaagcccatgatgtcgc (as shown in SEQ ID No. 18)

[0141] Table 3-11 PCR reaction system for detecting transgenic rice positive seedlings

[0142] Component Volume (μL) ddH2O 7.2 2×Taq Mix 10 Primer (+) (10 μM) 0.4 Primer (-)(10μM) 0.4 Template DNA 2 Total volume 20

[0143] Table 3-12 PCR reaction procedure for transgenic rice positive seedling detection

[0144] Temperature Time Cycles 94℃ 3 min 1 94℃ 30 sec 35 55℃ 30 sec 35 72℃ 1 min 35 72℃ 5 min 1

[0145] Transgenic positive plants were used for sub-generation seed propagation, and T3 generation seeds were used for subsequent functional verification tests.

[0146] 3. Detection of salt-alkaline resistance of T3 transgenic rice with LcbZIP46 gene

[0147] We selected plump and healthy wild-type rice seeds and seeds of three transgenic rice lines with high LcbZIP46 expression levels (OE1, OE2, and OE3). After sterilization, the seeds were sown on a saline-alkali mixed solution (50 mM NaCl + 5 mM NaHCO3) and an untreated 1 / 2MS solid culture medium, and placed vertically for culture. After 14 days, the length of the taproot was observed. The results were as follows: Fig.11 shown.

[0148] Fig.11 The results of the root growth experiment of T3 generation transgenic LcbZIP46 rice lines OE1 (Line5), OE2 (Line7), OE3 (Line13) and wild-type rice (WT) under saline-alkali stress. Among them, (a) shows the root development of wild-type rice and transgenic LcbZIP46 rice lines (OE1, OE2, OE3) without treatment; (b) shows the root development of wild-type and transgenic LcbZIP46 rice lines under 50mM NaCl + 5mM NaHCO3 stress. Fig.11 As shown in (a), under normal growth conditions, there was no significant difference in root length between wild-type plants and transgenic rice; Fig.11 As shown in (b), under the treatment of 50mM NaCl + 5mM NaHCO3, the root growth of the wild-type plants was strongly inhibited and was significantly lower than that of the transgenic lines, indicating that the LcbZIP46 gene can enhance the resistance of transgenic rice seedlings to salt-alkali stress.

[0149] Finally, it should be noted that the above content is only used to illustrate the technical solution of the present invention, rather than to limit the scope of protection of the present invention. Simple modifications or equivalent substitutions of the technical solution of the present invention by ordinary technicians in this field do not deviate from the essence and scope of the technical solution of the present invention.

Claims

1. A salt-alkali tolerance-related transcription factor LcbZIP46, characterized in that: Its amino acid sequence is shown in SEQ ID No.

1.

2. Use of the transcription factor LcbZIP46 according to claim 1 in cultivating transgenic plants with enhanced salt-alkali resistance, wherein the plant is Arabidopsis thaliana or rice.

Images