A molecular marker related to oxidative stress in Tibetan sheep and its application
By discovering and verifying the G/C variant SNP marker at 107317507 base on chromosome 4 of the International Sheep Genome, the problem of lack of effective molecular markers in the prior art for assisted breeding is solved, and efficient screening and breeding guidance on the antioxidant stress ability of Tibetan sheep are achieved.
Patent Information
- Application Number
- CN202411253476.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-09-09
- Publication Date
- 2025-03-21
- Estimated Expiration
- 2044-09-09
AI Technical Summary
In the prior art, there are not many molecular markers related to the oxidative stress ability of Tibetan sheep for assisted breeding, and there is a lack of effective molecular marker resources to screen for Tibetan sheep with strong antioxidant stress ability.
A SNP molecular marker is provided, located at the 107317507 base on chromosome 4, version 4 of the International Sheep Genome Oar_v4.0, and the variant type is G/C. By detecting the genotype of this site, the content of the antioxidant stress indicators of Hide Sheep can be judged.
Through the correlation analysis of different genotypes and antioxidant stress indicators ROS and MDA content, it was found that the antioxidant stress indicators of individuals with GC and CC genotypes were significantly higher than those of individuals with GG genotypes, providing a new SNP molecular marker resource, providing a basis for screening for Tibetan sheep with strong antioxidant stress ability and assisted breeding.
Smart Images
Figure CN119162328B_ABST
Abstract
Description
Technical Field
[0001] The invention relates to the technical field of molecular biology detection, and in particular to a molecular marker related to oxidative stress in Tibetan sheep and an application thereof. Background Art
[0002] Tibetan sheep are an important part of grassland animal husbandry in the high-altitude pastoral areas of the Qinghai-Tibet Plateau. The characteristics of the Qinghai-Tibet Plateau are: high altitude, low air pressure, strong ultraviolet rays, hypoxia, etc. Due to the harsh environment of the Qinghai-Tibet Plateau, a series of non-specific reactions will be caused in Tibetan sheep, mainly immune stress, cold stress and oxidative stress, among which oxidative stress is the main one. After being stimulated by stressors, the dynamic balance of the oxidation system and antioxidant system in the body of Tibetan sheep is destroyed, the content of reactive oxygen species (ROS) and malondialdehyde (MDA) increases, and the content of antioxidants decreases. The body will be damaged by oxidation, thus affecting the growth performance and reproductive performance of Tibetan sheep.
[0003] Reactive oxygen species (ROS) and malondialdehyde (MDA) are important indicators for detecting oxidative stress response. The oxidative stress capacity and health status of Tibetan sheep can be evaluated by detecting the content of reactive oxygen species (ROS) and malondialdehyde (MDA). By detecting the indicators of anti-oxidative stress, the oxidative stress response capacity of Tibetan sheep can be discovered in time, and certain measures can be taken to improve their oxidative stress capacity, so that they can better adapt to the harsh environmental conditions of the Qinghai-Tibet Plateau, and provide a basis for the auxiliary breeding of Tibetan sheep.
[0004] Molecular markers are genetic markers based on nucleotide sequence variation in genetic material between individuals, and are a direct reflection of genetic polymorphism at the DNA level. Molecular marker technology can find variant sites in genes at the gene level, and through the association analysis between them and traits, the relationship between genes and traits can be discovered, and early selection can be carried out to improve the efficiency and accuracy of breeding. It can fundamentally improve the oxidative stress capacity of Tibetan sheep and has broad application value.
[0005] Therefore, molecular markers lay the foundation for people to study the genetic mechanism of oxidative stress capacity of Tibetan sheep at the molecular level. Screening corresponding molecular markers for more efficient use in Tibetan sheep breeding is an important issue in this field. There are not many studies on molecular markers related to the oxidative stress capacity of Tibetan sheep in the prior art for assisted breeding. It is particularly important to provide a molecular marker related to the oxidative stress capacity of Tibetan sheep, so as to be used in molecular marker-assisted breeding of Tibetan sheep and screen Tibetan sheep with strong anti-oxidative stress capacity. Summary of the invention
[0006] The purpose of the present invention is to provide a molecular marker related to oxidative stress in Tibetan sheep and application thereof.
[0007] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:
[0008] The invention provides a SNP molecular marker related to the oxidative stress ability of Tibetan sheep. The SNP molecular marker is located at the 107317507th base on chromosome 4 of the international sheep genome Oar_v4.0 version, and the mutant base is G or C.
[0009] Preferably, the genotype of the Tibetan sheep with the mutant base G is GG or GC;
[0010] The genotype of Tibetan sheep with the mutant base C is CC;
[0011] The anti-oxidative stress indicators ROS and MDA of Tibetan sheep individuals with GC and CC genotypes were significantly higher than those of individuals with GG genotype;
[0012] There was no significant difference in the antioxidant stress indicators ROS and MDA between the Tibetan sheep individuals with the GC and CC genotypes.
[0013] The present invention also provides the use of the SNP molecular marker in marker-assisted selection of Tibetan sheep anti-oxidative stress traits for non-diagnostic purposes.
[0014] The present invention also provides application of the SNP molecular marker in Tibetan sheep assisted breeding.
[0015] The present invention also provides a primer pair for amplifying the SNP, and the primer pair is shown in SEQ ID NO. 2-3.
[0016] The present invention also provides the use of the primer pair in preparing a product for marker-assisted selection of Tibetan sheep anti-oxidative stress traits for non-diagnostic purposes.
[0017] The present invention also provides application of the primer pair in preparing products for auxiliary breeding of Tibetan sheep.
[0018] The present invention also provides a method for marker-assisted selection of Tibetan sheep anti-oxidative stress traits for non-diagnostic purposes, comprising the following steps:
[0019] (1) Extracting Tibetan sheep genomic DNA;
[0020] (2) using the Tibetan sheep genomic DNA obtained in step (1) as a template, and performing amplification using the primer pair to obtain an amplified product;
[0021] (3) performing genotyping analysis on the amplified products to obtain Tibetan sheep with different genotypes; and correlating the genotypes of the Tibetan sheep with anti-oxidative stress indicators;
[0022] The anti-oxidative stress indicators include reactive oxygen species and / or malondialdehyde.
[0023] Preferably, the amplification system in step (2) is: 22 μL of Gold Mix (green), 1 μL of upstream and downstream primers, and 1 μL of template DNA;
[0024] The amplification program of step (2) is: 98°C for 2 min; 98°C for 10 s, 56°C for 10 s, 72°C for 10 s, for a total of 40 cycles; and extension at 72°C for 2 min.
[0025] The present invention also provides a kit for marker-assisted selection of Tibetan sheep anti-oxidative stress traits and / or Tibetan sheep assisted breeding for non-diagnostic purposes, comprising a reagent for detecting the SNP molecular marker or the primer pair.
[0026] Compared with the prior art, the present invention has the following beneficial effects:
[0027] The SNP molecular marker described in the present invention is located at the 107317507th base on chromosome 4 of the international sheep reference genome Oar_v4.0 version; the variation type is G / C, named g107317507G>C, and there are three genotypes. When the 107317507th base on chromosome 4 is G, the genotype is GG or GC; when the 107317507th base on chromosome 4 is C, the genotype is CC; through the association analysis of different genotypes with the content of ROS and MDA, the antioxidant stress indicators of Tibetan sheep individuals with GC and CC genotypes were found to be significantly higher than those of individuals with GG genotypes (p<0.05), and the antioxidant stress indicators of Tibetan sheep individuals with GC and CC genotypes ROS and MDA were not significantly different (p>0.05). By detecting the base at the 107317507th nucleotide site on chromosome 4 of Tibetan sheep, the content of ROS and MDA, the antioxidant stress indicators of individual Tibetan sheep, can be determined. The present invention provides a new SNP molecular marker resource for marker-assisted selection of antioxidant stress-like Tibetan sheep for non-diagnostic purposes. BRIEF DESCRIPTION OF THE DRAWINGS
[0028] Figure 1 It is the amplification product of SNP site detected by agarose gel electrophoresis, where M represents Marker; 1, 2, and 3 represent 3 groups of repeats;
[0029] Figure 2 The peak diagram and sequence are obtained after the PCR amplification product is purified and sequenced. DETAILED DESCRIPTION
[0030] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.
[0031] Example 1
[0032] 1. Sample collection
[0033] The samples came from Tibetan sheep populations under natural grazing conditions, including 58 samples from Gannan Tibetan Autonomous Prefecture, Gansu Province, 64 samples from Yushu Tibetan Autonomous Prefecture, Qinghai Province, and 37 samples from Shigatse City, Tibet Autonomous Region. 5 mL of blood samples were collected from 159 fasting Tibetan sheep and placed in a clean pro-coagulant vacuum blood collection tube, left to stand for 30 minutes, and then centrifuged at 3500r / min for 15 minutes. The supernatant was aspirated into a clean PE tube, which was sealed and stored in a -20℃ low-temperature refrigerator. Another 5 mL of blood sample was collected in a blood collection tube with EDTA-K2 anticoagulant added. After the blood sample was collected, it was quickly mixed and temporarily stored in a sampling box containing an ice pack. After being transported back to the laboratory, it was frozen in a -20℃ refrigerator for extraction of genomic DNA.
[0034] 2 Main reagents and instruments
[0035] EDTA-K2 vacuum blood collection tubes were purchased from Jiangsu Yuli Medical Instrument Co., Ltd.; blood genomic DNA extraction kits were purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.; NanoDrop2000 spectrophotometer was purchased from Thermo Fisher Scientific, USA; DL2000 Marker, agarose, and nucleic acid dyes were purchased from Beijing Solebaugh Technology Co., Ltd.; Gold Mix (green) was purchased from Beijing Qingke Biotechnology Co., Ltd.; electrophoresis instrument was purchased from Beijing Liuyi Instrument Factory; PCR instrument was purchased from BioRad. Reactive oxygen species ROS (E004-1-1) and malondialdehyde MDA (A003-1-2) detection kits were purchased from Nanjing Jiancheng Bioengineering Institute.
[0036] 3 Methods
[0037] 3.1 Detection of ROS and MDA in serum
[0038] The DCFH-DA probe was used for determination according to the ROS detection kit of Nanjing Jiancheng Bioengineering Institute. The determination steps are as follows: (1) add 190 μl of serum and 10 μl of 1 mmol / L DCFH-DA solution (the final concentration of DCFH-DA is 50 μmol / L) to a 96-well ELISA plate, and mix thoroughly with a micropipette; (2) place in an ELISA reader, keep at 37°C for 30 minutes, and then detect the fluorescence intensity at an excitation wavelength of 485 nm and an emission wavelength of 538 nm; (3) take 50 μl of serum, dilute 30 times, and take 100 μl for protein quantification; (4) The results are expressed as fluorescence intensity / mg protein.
[0039] The determination was performed using the TBA method according to the MDA detection kit of Nanjing Jiancheng Bioengineering Institute. The determination steps are as follows: (1) add 0.2mL of anhydrous ethanol and 0.2mL of reagent 1 to the blank tube, add 0.2mL of 10nmo / mL standard and 0.2mL of reagent 1 to the standard tube, add 0.2mL of the test serum and 0.2mL of reagent 1 to the test tube, and add 0.2mL of the test serum and 0.2mL of reagent 1 to the control tube, and shake to mix; (2) add 3mL of reagent 2 and 1mL of reagent 3 to the blank tube, standard tube and test tube, and add 3mL of reagent 2 and 1mL of 50% glacial acetic acid to the control tube, vortex to mix, and then place in a 95°C water bath for 40 minutes, take out and cool in running water, and then centrifuge at 4000 rpm for 10 minutes; (3) take the supernatant and measure the absorbance value of each tube at 532nm; (4) calculate the MDA content according to the formula provided in the kit instructions.
[0040] 3.2 Extraction of genomic DNA from blood
[0041] The blood genome extraction kit of Tiangen Biochemical Technology (Beijing) Co., Ltd. was used to extract genomic DNA from the blood samples. The extracted DNA was placed under an ultraviolet spectrophotometer to detect the concentration and purity. The concentration was greater than 20 ng / μL and OD260 / OD280 was between 1.7 and 1.9, which met the experimental requirements. It was stored at -20°C for future use.
[0042] 3.3 Primer design
[0043] Referring to the gene sequence of chromosome 4 of the international sheep genome Oar_v4.0 version (GenBank accession number: NC_019461.2), a pair of specific primers including the g107317507G>C SNP site were designed using primerpremier5.0 software.
[0044] Primer sequences:
[0045] F: 5'-AAGAAGGACTTGACACGACA-3';
[0046] R: 5'-CAGTTAATCTGTTGGACTGC-3'.
[0047] (as shown in SEQ ID NO.2~3)
[0048] The length of the amplified fragment was 330 bp, and the primers were synthesized by Beijing Qingke Biotechnology Co., Ltd.
[0049] 3.4 PCR amplification and sequencing
[0050] PCR amplification system 25 μL: Gold Mix (green) 22 μL, upstream and downstream primers 1 μL each, template DNA 1 μL.
[0051] PCR amplification program: 98°C for 2 min; 98°C for 10 s, 58°C for 10 s, 72°C for 10 s, for a total of 40 cycles; extension at 72°C for 2 min.
[0052] The PCR product was detected by 1.5% agarose gel electrophoresis. After the PCR product was qualified by agarose gel electrophoresis, it was sequenced by direct sequencing, and the sequencing was completed by Beijing Qingke Biotechnology Co., Ltd. The amplified nucleotide sequence is shown in SEQ ID No.1, and the SNP marker is located at position 74 of the nucleotide sequence shown in SEQ ID No.1.
[0053] The biological analysis software MEGA 6.0 was used to compare the sequencing results of PCR products, analyze the sequencing peak graph, and complete the typing.
[0054] SEQ ID No.1
[0055] AAGAAGGACTTGACACGACAGAAGTAAATAAGCTGGCCTTTGATGCTAGGGAAATTATAGATCAAAGGAGAGAGAGAACAGATTTACAACCCAAGTAAAGAATGTGCCTCAGAGCAGAGAGGCAAGAACGAGCATGGCCCAGCACACATGAAGGCTACTCAGGAG AGCAGCCTAAAAGGTTTATGTGTGTAAATTAAAAAATGATGAGGTTATGACAGGATCACCTTACAGAATATCAGAACAAAGAATTTAAGTGGGAAGGAAAAAACACTATAGATAATACAGAGGGATATGGTGAAAGTCAGGAGGGGCAGTCCAACAGATTAACTG.
[0056] 4 Statistical analysis
[0057] According to the genotyping results, the number of individuals with different genotypes at each site was counted. Popgen32 software was used to calculate the g107317507G>C gene frequency, genotype frequency, effective allele number (Ne), site heterozygosity (He), and Hardy-Weinberg equilibrium test, and PIC (polymorphism information content, referred to as PIC) calculation software was used to calculate the polymorphic information content. The general linear model in IBM SPSS Statistics 22 software was used to analyze the association between different genotypes of Tibetan sheep and the antioxidant stress indicators ROS and MDA, and the results were expressed as "mean ± standard error".
[0058] 5 Results
[0059] 5.1 PCR amplification and sequencing results
[0060] The amplified product of the g107317507G>C SNP site on chromosome 4 of Tibetan sheep was detected by 1.5% agarose gel (see Figure 1 ), the bands were clear without any other bands, the specificity was good, and the PCR product fragment size was 330bp, which was in line with the expected size, so the next step of the experiment could be carried out.
[0061] The peak diagram and sequence obtained after the PCR product was purified and sequenced are shown in Figure 2 .Depend on Figure 2 It can be seen that a GC mutation occurred at the g107317507G>CSNP site, and there are three genotypes: GG, GC, and CC.
[0062] 5.2 Statistical analysis results
[0063] The genotype and allele frequencies of the g107317507G>C SNP site on chromosome 4 of Tibetan sheep were analyzed from the perspective of population genetics. As shown in Table 1, at the g107317507G>C SNP site, the GG genotype frequency was the highest, which was the dominant genotype, and the C allele frequency was 92.1%, which was a dominant allele. The χ2 fitness test showed that the SNP site significantly deviated from the Hardy-Weinberg equilibrium state (P<0.05) (Table 1). The expected heterozygosity of this site was 1.169, the PIC was 0.134, and the PIC was <0.25, which was a low degree of polymorphism.
[0064] Table 1 Polymorphism of the g107317507G>C SNP locus on chromosome 4 of Tibetan sheep
[0065]
[0066] 5.3 Correlation analysis of reactive oxygen species (ROS) and malondialdehyde (MDA) in different genotypes for antioxidant stress indicators
[0067] The general linear model in IBM SPSS Statistics 22 software was used to analyze the correlation between different genotypes of Tibetan sheep and the content of ROS and MDA, the antioxidant stress indicators. The results showed that the antioxidant stress indicators ROS and MDA of Tibetan sheep individuals with GC and CC genotypes were significantly higher than those of individuals with GG genotypes (p<0.05), and the antioxidant stress indicators ROS and MDA of Tibetan sheep individuals with GC and CC genotypes were not significantly different (p>0.05). The results showed that the bases of the g107317507G>C SNP site on chromosome 4 of Tibetan sheep were significantly correlated with ROS and MDA in Tibetan sheep, and were SNP markers related to ROS and MDA in Tibetan sheep. The results are shown in Table 2.
[0068] Table 2 Relationship between different genotypes and anti-oxidative stress indicators ROS and MDA
[0069]
[0070] Note: Different lowercase letters between data in the same row indicate significant differences (P<0.05).
[0071] In summary, the SNP molecular marker described in the present invention is located at the 107317507th base on chromosome 4 of the international sheep reference genome Oar_v4.0 version; the variation type is G / C, named g107317507G>C, and there are three genotypes. When the 107317507th base on chromosome 4 is G, the genotype is GG or GC; when the 107317507th base on chromosome 4 is C, the genotype is CC; through the association analysis of different genotypes with the antioxidant stress indicators ROS and MDA content, it was found that the antioxidant stress indicators ROS and MDA of Tibetan sheep individuals with the GC and CC genotypes were significantly higher than those of the GG genotype individuals (p<0.05), and the antioxidant stress indicators ROS and MDA of Tibetan sheep individuals with the GC and CC genotypes were not significantly different (p>0.05). By detecting the base at the 107317507th nucleotide site on chromosome 4 of Tibetan sheep, the content of ROS and MDA, the antioxidant stress indicators of individual Tibetan sheep, can be determined. The present invention provides a new SNP molecular marker resource for marker-assisted selection of antioxidant stress traits of Tibetan sheep for non-diagnostic purposes, provides a basis for screening Tibetan sheep with strong antioxidant stress resistance, and provides a new direction for assisted breeding of Tibetan sheep.
[0072] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.
Claims
1. Use of a reagent for detecting SNP locus genotype in the preparation of a Tibetan sheep anti-oxidative stress trait auxiliary breeding detection reagent, characterized in that: The SNP site is located at the 107317507th base on chromosome 4 of the international sheep genome Oar_v4.0 version, and the mutated base is G or C; among them, the antioxidant stress indexes reactive oxygen and malondialdehyde content of Tibetan sheep individuals with GC and CC genotypes are significantly higher than those of individuals with GG genotype; the antioxidant stress indexes reactive oxygen and malondialdehyde content of Tibetan sheep individuals with GC and CC genotypes are not significantly different.
2. The use according to claim 1, characterized in that: The reagent for detecting the genotype of the SNP site is a primer pair, and the primer pair is shown in SEQ ID NO.2~3.
3. A method for marker-assisted selection of Tibetan sheep anti-oxidative stress traits for non-diagnostic purposes, characterized in that: The steps include: (1) Extraction of Tibetan sheep genomic DNA; (2) using the Tibetan sheep genomic DNA obtained in step (1) as a template, and performing amplification using the primer pairs shown in SEQ ID NOs. 2-3 to obtain an amplified product; (3) performing genotyping analysis on the amplified product to obtain Tibetan sheep with different genotypes; and correlating the genotype of the Tibetan sheep with an anti-oxidative stress index; The primer pair is used to amplify the SNP molecular marker, the sequence of the SNP molecular marker is shown in SEQ ID No.1, and the 74th base in the sequence is G or C; wherein, the antioxidant stress indexes active oxygen and malondialdehyde content of Tibetan sheep individuals with GC and CC genotypes are significantly higher than those of individuals with GG genotype; the antioxidant stress indexes active oxygen and malondialdehyde content of Tibetan sheep individuals with GC and CC genotypes are not significantly different.
4. The method according to claim 3, characterized in that The amplification program in step (2) is: 98°C for 2 min; 98°C for 10 s, 56°C for 10 s, 72°C for 10 s, for a total of 40 cycles; and extension at 72°C for 2 min.