A molecular marker associated with yak immune indicators and its application in breeding.

Abstract

The present invention belongs to the field of molecular biology detection technology, and in particular, relates to a molecular marker related to yak immune indicators and its application in breeding. The present invention obtains a SNP molecular marker related to yak immune traits through screening, which is located at the 26593056th base of chromosome 3 of the yak reference genome LU_Bosgru_v3.0 version, and the mutant base is G or A. The present invention uses the SNP molecular marker to obtain the content of immunoglobulin A, immunoglobulin G, and immunoglobulin M of individual yaks, providing a new SNP molecular marker resource for marker-assisted selection of yak immune traits for non-diagnostic purposes, and providing a basis for breeding yaks with high immunity.

Description

Technical Field

[0001] The invention relates to the technical field of molecular biological detection, and in particular to a molecular marker related to yak immune indexes and application thereof in breeding. Background Art

[0002] Yaks have lived in plateau areas for a long time and face harsh environmental conditions. They need to have high immunity and disease resistance to adapt to the pressures of high altitude, low air pressure, strong ultraviolet rays, hypoxia and malnutrition. In the yak farming industry, diseases pose a serious threat to their health and cause significant economic losses. Although diseases can be prevented to a certain extent by improving feeding management, taking measures such as drugs and vaccines, these methods have not been able to effectively control the spread of infectious diseases. At the same time, the widespread use of drugs may lead to the development of drug resistance and affect the safety of livestock products. Therefore, in the long run, carrying out disease-resistant breeding through gene screening and improving the disease resistance of yaks is the fundamental way to solve this problem.

[0003] Immune indicators are an important basis for reflecting the disease resistance of yaks, which depends on the health status and function of their immune system. The main function of the immune system is to identify and eliminate invading pathogens. When pathogens invade, the immune system will respond quickly and initiate a series of immune processes to resist and eliminate pathogens. Immune indicators such as antibody levels and immunoglobulin counts are important references for measuring animal health and disease resistance. By monitoring changes in immune indicators, we can identify yaks' immune problems in a timely manner and take measures to improve their disease resistance, prevent and treat diseases.

[0004] Immunoglobulins are a group of proteins with antibody activity, which are mainly found in plasma and are also found in other body fluids, tissues and some secretions. Immunoglobulins are divided into five categories, namely immunoglobulin G (IgG), immunoglobulin A (IgA), immunoglobulin M (IgM), immunoglobulin D (IgD) and immunoglobulin E (IgE). Immunoglobulins are closely related to the disease resistance of animals. For example, if the content of IgG and IgA in the body decreases, it is easy to cause low immune function. If the content of IgG and IgA in the body increases, the body's disease resistance is enhanced. The enhancement of disease resistance can reduce the use of drugs, reduce production costs and increase breeding benefits. Therefore, immunoglobulins can be used as immune indicators. Through the changes in immunoglobulins, the immune problems of yaks can be discovered in time, and corresponding measures can be taken to improve their disease resistance, prevent and treat diseases.

[0005] With the rapid development of molecular marker technology, the use of molecular markers for early selection in yak breeding to screen out individuals with high disease resistance has become an important means to improve breeding efficiency and accuracy. Through the screening of variant sites at the gene level and the association analysis with disease resistance traits, the relationship between related genes and immune traits is discovered, which promotes the development of disease-resistant breeding. This provides a new way and resource for the selection and breeding of yaks with high disease resistance, which has important application value. Summary of the invention

[0006] The purpose of the present invention is to provide SNP molecular markers related to yak immune indicators and applications thereof.

[0007] In order to achieve the above object, the present invention proposes the following technical solutions:

[0008] The invention provides a SNP molecular marker related to yak immune traits, wherein the SNP molecular marker is located at the 26593056th base on chromosome 3 of the yak reference genome LU_Bosgru_v3.0 version, and the mutant base is G or A.

[0009] Preferably, the genotype of the yak with the mutant base G is GG or GA; the genotype of the yak with the mutant base A is AA; the content of immunoglobulin A in yak individuals with the genotype GG is higher than that in yak individuals with the genotype GA or AA; the content of immunoglobulin G and immunoglobulin M in yak individuals with the genotypes GG and GA is higher than that in yak individuals with the genotype AA.

[0010] The present invention also provides the use of the SNP molecular marker in preparing products for detecting yak immunity or yak assisted breeding products.

[0011] The present invention also provides a primer pair for amplifying the SNP molecular marker, and the sequence of the primer pair is shown in SEQ ID NO: 1-2.

[0012] The present invention also provides the use of the primer pair in preparing a product for detecting yak immunity or a product for yak auxiliary breeding.

[0013] The present invention also provides a kit for detecting yak immunity, comprising a reagent for detecting the SNP molecular marker or the primer pair.

[0014] The present invention also provides a kit for yak assisted breeding, comprising a reagent for detecting the SNP molecular marker or the primer pair.

[0015] The present invention also provides a method for marker-assisted selection of yak immune traits for non-diagnostic purposes, comprising the following steps:

[0016] (1) Extracting yak genomic DNA;

[0017] (2) using the yak genomic DNA obtained in step (1) as a template, and performing amplification using the primer pair to obtain an amplified product;

[0018] (3) Performing genotyping analysis on the amplified products to obtain yaks with different genotypes; correlating the genotypes of the yaks with immune indicators; the immunoglobulins are one or more of immunoglobulin A, immunoglobulin G and immunoglobulin M.

[0019] Preferably, the amplification system in step (2) is 25 μL in total, including: 12.5 μL 2×L-Exp Taq Master Mix, 8.5 μL RNase free water, 1 μL upstream primer, 1 μL downstream primer, and 2 μL template;

[0020] Preferably, the amplification program in step (2) is: 94°C for 1 min, 98°C for 10 s, 58°C for 30 s, 72°C for 1 min, for a total of 35 cycles; and extension at 72°C for 2 min.

[0021] Compared with the prior art, the present invention has the following beneficial effects:

[0022] The present invention provides a SNP molecular marker related to yak immune index and its role in breeding. The present invention finds through research that the SNP site related to yak immunity is located at the 26593056th base on chromosome 3 of the yak reference genome LU_Bosgru_v3.0 version, the variation type is G / A, and there are 3 genotypes. When the 26593056th base on chromosome 3 is G, the genotype is GG or GA: when the 26593056th base on chromosome 3 is A, the genotype is AA;

[0023] Through the association analysis between different genotypes and the contents of immunoglobulin A, immunoglobulin G, and immunoglobulin M, it was found that the content of immunoglobulin A in yak individuals with the GG genotype was higher than that in yak individuals with the GA or AA genotypes (p<0.05); the content of immunoglobulin G and immunoglobulin M in yak individuals with the GG and GA genotypes were higher than that in yak individuals with the AA genotype (p<0.05).

[0024] The present invention can obtain the content of immunoglobulin A, immunoglobulin G and immunoglobulin M of individual yaks by detecting the base at the 26593056th nucleotide site on chromosome 3 of yaks. The present invention provides a new SNP molecular marker resource for marker-assisted selection of yak immune traits for non-diagnostic purposes, and provides a basis for breeding yaks with high immunity. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying creative work.

[0026] Figure 1 It is the PCR amplification product: M represents Marker; 1, 2, and 3 represent 3 groups of repetitions.

[0027] Figure 2 The peak diagram and sequence obtained after sequencing the PCR product. DETAILED DESCRIPTION

[0028] The present invention provides a SNP molecular marker associated with yak immune traits, wherein the SNP molecular marker is located at the 26593056th base on chromosome 3 of the yak reference genome LU_Bosgru_v3.0 version, and the mutant base is G or A.

[0029] In the present invention, the genotype of the yak with the mutant base G is GG or GA; the genotype of the yak with the mutant base A is AA; the content of immunoglobulin A in the yak individual with the genotype GG is higher than the content of immunoglobulin A in the yak individual with the genotype GA or AA; the content of immunoglobulin G and immunoglobulin M in the yak individual with the genotype GG and GA is higher than the content of immunoglobulin G and immunoglobulin M in the yak individual with the genotype AA.

[0030] The present invention also provides the use of the SNP molecular marker in preparing a product for detecting yak immunity or a product for screening a yak breed with high immunity.

[0031] The present invention also provides a primer pair for amplifying a gene fragment including the SNP molecular marker, and the sequence of the primer pair is shown in SEQ ID NO: 1-2.

[0032] SEQ ID NO: 1 is an upstream primer, and its sequence is:

[0033] 5′-CACACAGGAAGCAAAGGCAC-3′;

[0034] SEQ ID NO: 2 is a downstream primer, and its sequence is:

[0035] 5′-TAGGACAGCAAAGCCAGCAA-3′.

[0036] The present invention also provides the use of the primer pair in preparing a product for detecting yak immunity or a product for yak auxiliary breeding.

[0037] The present invention also provides a kit for detecting yak immunity, comprising a reagent for detecting the SNP molecular marker or the primer pair.

[0038] The present invention also provides a kit for yak assisted breeding, comprising a reagent for detecting the SNP molecular marker or the primer pair.

[0039] The present invention also provides a method for marker-assisted selection of yak immune traits for non-diagnostic purposes, comprising the following steps:

[0040] (1) Extracting yak genomic DNA;

[0041] (2) using the yak genomic DNA obtained in step (1) as a template, and performing amplification using the primer pair to obtain an amplified product;

[0042] (3) Performing genotyping analysis on the amplified products to obtain yaks with different genotypes; correlating the genotypes of the yaks with immune indicators; the immunoglobulins are one or more of immunoglobulin A, immunoglobulin G and immunoglobulin M.

[0043] In the present invention, the amplification system described in step (2) is 25 μL in total, including: 2×L-Exp TaqMasterMix 12.5 μL, RNase free water 8.5 μL, upstream primer 1 μL, downstream primer 1 μL, template 2 μL;

[0044] In the present invention, the amplification program described in step (2) is: 94°C for 1 min, 98°C for 10 s, 58°C for 30 s, 72°C for 1 min, for a total of 35 cycles; and extension at 72°C for 2 min.

[0045] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0046] Example 1

[0047] 1. Sample collection

[0048] The invention uses the Niangya yak breed as the detection object, collects 5 mL of blood samples from 192 fasting yaks from the Jiali County ranch in Nagqu City, Tibet Autonomous Region, and puts them in a clean pro-coagulant vacuum blood collection tube, lets them stand for 30 minutes, and then centrifuges them at 3500r / min for 10 minutes, aspirates the supernatant into a PE tube, seals it and stores it in a -20°C low-temperature refrigerator; another 5 mL of blood sample is collected in a blood collection tube with EDTA-K2 anticoagulant added, and after the blood sample is collected, it is quickly mixed, temporarily stored in a sampling box containing an ice pack, and transported back to the laboratory and frozen in a -20°C refrigerator for extraction of genomic DNA.

[0049] 2 Main reagents and instruments

[0050] EDTA-K2 vacuum blood collection tubes were purchased from Jiangsu Yuli Medical Instrument Co., Ltd.; blood genomic DNA extraction kits were purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.; Nano Drop 2000 spectrophotometer was purchased from Thermo Fisher Scientific, USA; DL2000 Marker, agarose, and nucleic acid dyes were purchased from Beijing Solebold Technology Co., Ltd.; 2×L-Exp Taq MasterMix (dye plus) was purchased from Hunan Aikerui Bioengineering Co., Ltd.; electrophoresis instrument was purchased from Beijing Liuyi Instrument Factory; PCR instrument was purchased from BioRad. IgA (MB-4907A), IgG (MB-4616A), and IgM (MB-4908A) detection kits were purchased from Jiangsu Enzyme Biotechnology Co., Ltd.

[0051] 3 Methods

[0052] 3.1 Immunoglobulin IgA, IgG, and IgM detection

[0053] According to the IgA, IgG, and IgM detection kits of Jiangsu Enzyme Biotechnology Co., Ltd., the double antibody one-step sandwich method was used for determination. First, the required strips were taken out from the aluminum foil bag after equilibration at room temperature for 20 minutes, and the remaining strips were sealed with a self-sealing bag and returned to 4°C. Set up standard wells and sample wells, and add 50μL of different concentrations of standard wells to each standard well; first add 10μL of the sample to be tested to the sample well, and then add 40μL of sample diluent; blank wells are not added. In addition to the blank wells, 100μL of horseradish peroxidase (HRP)-labeled detection antibody is added to each well of the standard well and sample well, and the reaction wells are sealed with a sealing film, and incubated at 37°C water bath or constant temperature box for 60min. Discard the liquid, pat dry on absorbent paper, fill each well with washing solution, let stand for 1min, shake off the washing solution, pat dry on absorbent paper, and repeat the washing 5 times (you can also use a plate washer to wash the plate). Add 50μL of substrate A and B to each well and incubate at 37°C in the dark for 15min. Add 50 μL of stop solution to each well, and measure the OD value of each well at a wavelength of 450 nm within 15 minutes. Finally, draw a standard curve: in an Excel worksheet, use the concentration of the standard as the horizontal axis and the corresponding OD value as the vertical axis to draw a linear regression curve of the standard, and calculate the IgA, IgG, and IgM concentration values ​​of each sample according to the curve equation.

[0054] 3.2 Extraction of genomic DNA from blood

[0055] The blood genome extraction kit of Tiangen Biochemical Technology (Beijing) Co., Ltd. was used to extract genomic DNA from the blood samples. The extracted DNA was placed under an ultraviolet spectrophotometer to detect the concentration and purity. The concentration was >20ng / μL and OD 260 / OD 280 A value between 1.7 and 1.9 meets the experimental requirements and can be stored at -20°C for future use.

[0056] 3.3 Primer design

[0057] With reference to the gene sequence of chromosome 3 of the yak genome LU_Bosgru_v3.0 version (GenBank accession number: GCA_005887515.1), the Pick Primers online tool provided by the NCBI website was used to design specific primers, including the g26593056G>A SNP site.

[0058] Primer sequences

[0059] F: 5'-CACACAGGAAGCAAAGGCAC-3' (SEQ ID NO: 1);

[0060] R: 5'-TAGGACAGCAAAGCCAGCAA-3' (SEQ ID NO: 2).

[0061] The length of the amplified fragment was 389 bp, and the primers were synthesized by Beijing Qingke Biotechnology Co., Ltd.

[0062] 3.4 PCR amplification and sequencing

[0063] PCR amplification system 25μL: 2×L-Exp Taq Master Mix (dye plus) 12.5μL, RNase free water 8.5μL, upstream primer 1μL, downstream primer 1μL, template 2μL.

[0064] PCR amplification program: 94°C for 1 min, 98°C for 10 s, 58°C for 30 s, 72°C for 1 min, for a total of 35 cycles; extension at 72°C for 2 min.

[0065] The PCR products were tested by 1% agarose gel electrophoresis. After the PCR products passed the agarose gel electrophoresis test, they were sequenced by direct sequencing, and the sequencing was completed by Beijing Qingke Biotechnology Co., Ltd. Figure 1 shown. Figure 1 It shows that the length of the sequence obtained by PCR amplification is 389bp. After sequencing, it is found that the nucleotide sequence at position 189 of the amplified product (base 26593056 on chromosome 3 of the genome LU_Bosgru_v3.0 version) has a G / A mutation. The amplified product band is clear without any mixed bands and has good specificity. The site was preliminarily identified as the SNP marker site of yak and named g26593056G>A SNP. The sequence obtained by PCR amplification is shown in SEQ ID NO:3, and the 189th position of the sequence is a G mutation. The fragment size of the PCR amplified product meets the expected size, and the next step of the experiment can be carried out.

[0066] SEQ ID NO:3

[0067] CACACAGGAAGCAAAGGCACCTCAGGTTCCTAAATGAGGAATCAAGTTAACATTCCCATTCTCCTCTATTGAGTTATCATTTTTGTCCATTTTGTTCTCCTTGTCCCAGTGCCTTACCCACCACATACACACTGTTACTCTGAGCTGAAACCCTTGCAGGGCATTAGCAGTCACACACCTGACCACT GCCTTCTATCATCATACATTAATGCTCTTTTAACATTTATTTATTTTTAATTGGAAGATAATTGCTTTACAATGTTGTGGTTGGTTTCTGCCATACATCAACATGAATCATTCATAGGTATACATATATCCCCTCTCTCTTGAACCTCCTTCATCATATACTTTTGTGATAAAATAGAAAATTGCTGGCTTTGCTGTCCTA

[0068] The biological analysis software MEGA 11.0 was used to compare the sequencing results of PCR products, analyze the sequencing peak graph, and complete the typing.

[0069] 4 Statistical analysis

[0070] According to the genotyping results, the number of individuals with different genotypes at each site was counted. Popgen32 software was used to calculate the g26593056G>A gene frequency, genotype frequency, effective allele number (Ne), site heterozygosity (He), and Hardy-Weinberg equilibrium test, and PIC (polymorphism information content, referred to as PIC) calculation software was used to calculate the polymorphic information content. The general linear model in IBM SPSS Statistics 26 software was used to analyze the association between different genotypes of yaks and immunoglobulins IgA, IgG, and IgM, and the results were expressed as "mean ± standard error".

[0071] 5 Results

[0072] 5.1 PCR amplification and sequencing results

[0073] The amplified product of the g26593056G>A SNP site on chromosome 3 of yak was detected by 1% agarose gel (see Figure 1 ), the bands were clear without any other bands, the specificity was good, and the PCR product fragment size was 389 bp, which was in line with the expected size, so the next step of the experiment could be carried out.

[0074] The peak diagram and sequence obtained after the PCR product was purified and sequenced are shown in Figure 2 .Depend on Figure 2 It can be seen that the GA mutation occurred at the g26593056G>ASNP site, and there are three genotypes: GG, GA, and AA.

[0075] 5.2 Statistical analysis results

[0076] The genotypes and allele frequencies of the g26593056G>A SNP locus on chromosome 3 of yaks were analyzed from the perspective of population genetics. As shown in Table 1, at the g26593056G>A SNP locus, the GA genotype frequency was the highest, being the dominant genotype, and the G allele frequency was 54.2%, showing as the dominant allele. By χ 2 The fitness test indicated that the SNP locus conformed to the Hardy-Weinberg equilibrium state (P>0.05) (Table 1). The expected heterozygosity of this locus was 0.497, and the PIC was 0.373. Since 0.25<PIC<0.50, it belonged to moderate polymorphism.

[0077] Table 1 Polymorphism of the g26593056G>A SNP locus on chromosome 3 of yaks

[0078]

[0079] 5.3 Association analysis of different genotypes with immunoglobulins IgA, IgG, and IgM

[0080] The general linear model in IBM SPSS Statistics 26 software was used to analyze the association between different genotypes of yaks and the contents of immunoglobulins IgA, IgG, and IgM. The results showed that the content of immunoglobulin A in yak individuals with the GG genotype was higher than that in yak individuals with the GA or AA genotype (p<0.05); the contents of immunoglobulin G and immunoglobulin M in yak individuals with the GG and GA genotypes were higher than those in yak individuals with the AA genotype (p<0.05). This indicated that the bases at the g26593056G>A locus on chromosome 3 of yaks were significantly correlated with yak IgA, IgG, and IgM (p<0.05), serving as SNP markers related to yaks. The results are shown in Table 2.

[0081] Table 2 Correlation analysis between different genotypes and immunoglobulins IgA, IgG, and IgM

[0082]

[0083] Note: Different lowercase letters marked between data in the same row indicate significant differences (P<0.05).

[0084] The SNP molecular marker described in the present invention is located at the 26593056th base on chromosome 3 of the reference yak genome LU_Bosgru_v3.0 version; the variation type is G / A, named g26593056G>A, and there are three genotypes. When the 26593056th base on chromosome 3 is G, the genotype is GG or GA; when the 26593056th base on chromosome 3 is A, the genotype is AA; through the association analysis of different genotypes with IgA, IgG, and IgM contents, it is found that the immunoglobulin A content in yak individuals with genotype GG is higher than that in yak individuals with genotype GA or AA (p<0.05); the immunoglobulin G and immunoglobulin M contents in yak individuals with genotypes GG and GA are higher than those in yak individuals with genotype AA (p<0.05). The present invention can determine the immunoglobulin A, immunoglobulin G and immunoglobulin M content of individual yaks by detecting the base at the 26593056th nucleotide site on chromosome 3 of the yak. ​​The present invention provides a new SNP molecular marker resource for marker-assisted selection of yak immune traits for non-diagnostic purposes.

[0085] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. Use of a reagent for detecting SNP molecular markers in the preparation of an in vitro detection reagent for yak immune traits or a detection reagent for yak immune traits assisted breeding, characterized in that: The SNP molecular marker is located at the 26593056th base on chromosome 3 of the yak reference genome LU_Bosgru_v3.0 version, and the mutant base is G or A; Among them, the genotype of the yak with the mutant base A is AA; the immunoglobulin A content in the yak individuals with the genotype GG is higher than that in the yak individuals with the genotype GA or AA; the immunoglobulin G and immunoglobulin M contents in the yak individuals with the genotypes GG and GA are higher than those in the yak individuals with the genotype AA.

2. The use according to claim 1, characterized in that: The primer pair for detecting the SNP molecular marker is shown in SEQ ID NO.1~2.

3. A method for marker-assisted selection of yak immune traits for non-diagnostic purposes, characterized in that: The steps include: (1) Extraction of yak genomic DNA; (2) using the yak genomic DNA obtained in step (1) as a template, amplifying using the primer pairs shown in SEQ ID NO. 1-2 to obtain an amplified product; (3) performing genotyping analysis on the amplified products to obtain yaks with different genotypes; correlating the genotypes of the yaks with immune indicators; the immunoglobulin is one or more of immunoglobulin A, immunoglobulin G and immunoglobulin M; The primer pair is used to amplify the SNP molecular marker, which is located at the 189th base as shown in SEQ ID No.3, and the mutant base is G or A; wherein the yak genotype with the mutant base A is AA; the immunoglobulin A content in the yak individuals with the genotype GG is higher than the immunoglobulin A content in the yak individuals with the genotype GA or AA; the immunoglobulin G and immunoglobulin M contents in the yak individuals with the genotypes GG and GA are higher than the immunoglobulin G and immunoglobulin M contents in the yak individuals with the genotype AA.

4. The method according to claim 3, characterized in that The amplification system described in step (2) is 25 μL in total, including: 2× L-Exp Taq Master Mix 12.5μL, RNase free water 8.5μL, upstream primer 1μL, downstream primer 1μL, template 2μL.

5. The method according to claim 3, characterized in that: The amplification program in step (2) is: 94°C for 1 min, 98°C for 10 s, 58°C for 30 s, 72°C for 1 min, for a total of 35 cycles; and extension at 72°C for 2 min.

Images